scholarly journals Rapid Species Identification of Cooked Poisonous Mushrooms by Using Real-Time PCR

2008 ◽  
Vol 74 (10) ◽  
pp. 3306-3309 ◽  
Author(s):  
Kazuhiko Maeta ◽  
Tomoya Ochi ◽  
Keisuke Tokimoto ◽  
Norihiro Shimomura ◽  
Nitaro Maekawa ◽  
...  
Keyword(s):  
Real Time ◽  
Species Identification ◽  
Real Time Pcr ◽  
Specific Test ◽  
Specific Identification ◽  
Specific Fluorescence ◽  
Species Specific ◽  
Poisonous Mushrooms

ABSTRACT Species-specific identification of the major cooked and fresh poisonous mushrooms in Japan was performed using a real-time PCR system. Specific fluorescence signals were detected, and no nonspecific signals were detected. Therefore, we succeeded in developing a species-specific test for the identification of poisonous mushrooms within 1.5 h.

Species-specific identification of variola, monkeypox, cowpox, and vaccinia viruses by multiplex real-time PCR assay

2011 ◽  
Vol 175 (2) ◽  
pp. 163-169 ◽  
Author(s):  
Sergei N. Shchelkunov ◽  
Dmitrii N. Shcherbakov ◽  
Rinat A. Maksyutov ◽  
Elena V. Gavrilova
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Pcr Assay ◽  
Specific Identification ◽  
Vaccinia Viruses ◽  
Species Specific

Species-specific real-time PCR cell number quantification of the bloom-forming cyanobacterium Planktothrix agardhii

2012 ◽  
Vol 194 (9) ◽  
pp. 749-757 ◽  
Author(s):  
Catarina Churro ◽  
Paulo Pereira ◽  
Vitor Vasconcelos ◽  
Elisabete Valério
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Cell Number ◽  
Planktothrix Agardhii ◽  
Species Specific

Identification of L. casei and L. rhamnosus in the dairy products using Real-Time PCR assay

2015 ◽  
Vol 4 (5) ◽  
pp. 222-225
Author(s):  
K. G. Li ◽  
G. P. Pogossian ◽  
A. K. Moldagulova ◽  
E. E. Bekenova ◽  
A. Abdikadirova ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dairy Products ◽  
Production Control ◽  
High Efficiency ◽  
High Specificity ◽  
Industrial Test ◽  
Fermented Dairy Products ◽  
Species Specific ◽  
Fermented Dairy

  Lactobacilli are essential and important biological objects used in food pro-duction and medicine. One of the sufficient problems is fast, reliable and highly specific identification of lactobacilli in the scientific research and cur-rent production control. We represent two species-specific real-time PCR in the present study to discriminate L. rhamnosus and L. casei basing on the unique peptidoglycan-hydrolase genes p40 and p75 respectively. PCR pri-mers and probes were designed to provide high specificity discrimination via high temperature of PCR annealing stage. High efficiency of the reactions is provided by the size of amplified DNA fragments minimization. Reliable re-producibility of the target sequences amplification and fluorescence detec-tion provide a basis for the future creation of industrial test-systems for op-erational control in the production of fermented dairy products.

Quantitative Detection of Species-Specific DNA in Feedstuffs and Fish Meals

2005 ◽  
Vol 68 (6) ◽  
pp. 1217-1221 ◽  
Author(s):  
PAVEL KRCMAR ◽  
EVA RENCOVA
Keyword(s):  
Mitochondrial Dna ◽  
Real Time ◽  
Dna Sequences ◽  
Real Time Pcr ◽  
Single Species ◽  
Absolute Quantification ◽  
Quantitative Detection ◽  
Vertebrate Species ◽  
Target Species ◽  
Species Specific

A sensitive and rapid method for the quantitative detection of bovine-, ovine-, swine-, and chicken-specific mitochondrial DNA sequences based on real-time PCR has been developed. The specificity of the primers and probes for real-time PCR has been tested using DNA samples of other vertebrate species that may also be present in rendered products. The quantitative detection was performed with dual-labeled probes (TaqMan) using absolute quantification with external standards of single species meat-and-bone meals. This method facilitates the detection of 0.01% of the target species–derived material in concentrate feed mixtures and fish meals.

scholarly journals Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay

2015 ◽  
Vol 9 (1) ◽  
pp. e0003469 ◽  
Author(s):  
Robin H. Miller ◽  
Clifford O. Obuya ◽  
Elizabeth W. Wanja ◽  
Bernhards Ogutu ◽  
John Waitumbi ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Novel Species ◽  
Plasmodium Ovale ◽  
Pcr Assay ◽  
Western Kenya ◽  
Plasmodium Ovale Curtisi ◽  
Species Specific

scholarly journals Development and validation of a triplex real-time PCR for rapid detection and specific identification of M. avium sub sp. paratuberculosis in faecal samples

2009 ◽  
Vol 136 (1-2) ◽  
pp. 166-172 ◽  
Author(s):  
Léonid M. Irenge ◽  
Karl Walravens ◽  
Marc Govaerts ◽  
Jacques Godfroid ◽  
Valérie Rosseels ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Rapid Detection ◽  
Specific Identification ◽  
Faecal Samples ◽  
Development And Validation

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Sign in / Sign up

Export Citation Format

Share Document