Species-specific real-time PCR cell number quantification of the bloom-forming cyanobacterium Planktothrix agardhii

2012 ◽  
Vol 194 (9) ◽  
pp. 749-757 ◽  
Author(s):  
Catarina Churro ◽  
Paulo Pereira ◽  
Vitor Vasconcelos ◽  
Elisabete Valério
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Cell Number ◽  
Planktothrix Agardhii ◽  
Species Specific

Identification of L. casei and L. rhamnosus in the dairy products using Real-Time PCR assay

2015 ◽  
Vol 4 (5) ◽  
pp. 222-225
Author(s):  
K. G. Li ◽  
G. P. Pogossian ◽  
A. K. Moldagulova ◽  
E. E. Bekenova ◽  
A. Abdikadirova ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dairy Products ◽  
Production Control ◽  
High Efficiency ◽  
High Specificity ◽  
Industrial Test ◽  
Fermented Dairy Products ◽  
Species Specific ◽  
Fermented Dairy

  Lactobacilli are essential and important biological objects used in food pro-duction and medicine. One of the sufficient problems is fast, reliable and highly specific identification of lactobacilli in the scientific research and cur-rent production control. We represent two species-specific real-time PCR in the present study to discriminate L. rhamnosus and L. casei basing on the unique peptidoglycan-hydrolase genes p40 and p75 respectively. PCR pri-mers and probes were designed to provide high specificity discrimination via high temperature of PCR annealing stage. High efficiency of the reactions is provided by the size of amplified DNA fragments minimization. Reliable re-producibility of the target sequences amplification and fluorescence detec-tion provide a basis for the future creation of industrial test-systems for op-erational control in the production of fermented dairy products.

Quantitative Detection of Species-Specific DNA in Feedstuffs and Fish Meals

2005 ◽  
Vol 68 (6) ◽  
pp. 1217-1221 ◽  
Author(s):  
PAVEL KRCMAR ◽  
EVA RENCOVA
Keyword(s):  
Mitochondrial Dna ◽  
Real Time ◽  
Dna Sequences ◽  
Real Time Pcr ◽  
Single Species ◽  
Absolute Quantification ◽  
Quantitative Detection ◽  
Vertebrate Species ◽  
Target Species ◽  
Species Specific

A sensitive and rapid method for the quantitative detection of bovine-, ovine-, swine-, and chicken-specific mitochondrial DNA sequences based on real-time PCR has been developed. The specificity of the primers and probes for real-time PCR has been tested using DNA samples of other vertebrate species that may also be present in rendered products. The quantitative detection was performed with dual-labeled probes (TaqMan) using absolute quantification with external standards of single species meat-and-bone meals. This method facilitates the detection of 0.01% of the target species–derived material in concentrate feed mixtures and fish meals.

scholarly journals Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay

2015 ◽  
Vol 9 (1) ◽  
pp. e0003469 ◽  
Author(s):  
Robin H. Miller ◽  
Clifford O. Obuya ◽  
Elizabeth W. Wanja ◽  
Bernhards Ogutu ◽  
John Waitumbi ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Novel Species ◽  
Plasmodium Ovale ◽  
Pcr Assay ◽  
Western Kenya ◽  
Plasmodium Ovale Curtisi ◽  
Species Specific

scholarly journals Rapid Species Identification of Cooked Poisonous Mushrooms by Using Real-Time PCR

2008 ◽  
Vol 74 (10) ◽  
pp. 3306-3309 ◽  
Author(s):  
Kazuhiko Maeta ◽  
Tomoya Ochi ◽  
Keisuke Tokimoto ◽  
Norihiro Shimomura ◽  
Nitaro Maekawa ◽  
...  
Keyword(s):  
Real Time ◽  
Species Identification ◽  
Real Time Pcr ◽  
Specific Test ◽  
Specific Identification ◽  
Specific Fluorescence ◽  
Species Specific ◽  
Poisonous Mushrooms

ABSTRACT Species-specific identification of the major cooked and fresh poisonous mushrooms in Japan was performed using a real-time PCR system. Specific fluorescence signals were detected, and no nonspecific signals were detected. Therefore, we succeeded in developing a species-specific test for the identification of poisonous mushrooms within 1.5 h.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

scholarly journals Developing, Modifying, and Validating a TaqMan Real-Time PCR Technique for Accurate Identification of Leishmania Parasites Causing Most Leishmaniasis in Iran

2021 ◽  
Vol 11 ◽  
Author(s):  
Reza Fotouhi-Ardakani ◽  
Seyedeh Maryam Ghafari ◽  
Paul Donald Ready ◽  
Parviz Parvizi
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Leishmania Major ◽  
Taqman Probe ◽  
Amino Acid Permease ◽  
Specific Primers ◽  
Accurate Identification ◽  
Parasitic Load ◽  
Species Specific

Many laboratory methods are used to diagnose leishmaniasis because it is characterized by varied symptoms and caused by different Leishmania species. A quantitative real-time PCR method based on a TaqMan probe was developed and modified for accurate identification of human cutaneous leishmaniasis (caused by Leishmania major or Leishmania tropica) from endemic areas of Iran. Two gene regions of amino acid permease 3 (AAP3) and cytochrome oxidase II (COII) were considered. Six new sets of species-specific primers and probes were designed. A total of 123 samples were examined and employed to evaluate and validate real-time PCR. According to parasitic load of the genesig®Leishmania Advanced Standard Kit, a serial dilution of purified plasmid (2–2×107 copies/reaction) was prepared under the same conditions for both genes. Specific primers and probes were able to detect three and six parasite copies in AAP3 and COII genes, respectively, and were able to detect three copies of parasites for L. major and L. tropica. The sensitivities of the reference kit and our method were 98.7 and 98.1%, respectively, and specificity was 100% for detecting parasite genomes in all assays. Designed primers and probes performed well in terms of efficiency and regression coefficient. For AAP3 and COII genes, respectively, the linear log range was 7 and the correlation coefficient (R2) was 0.749 and 0.996 for the reference kit using the standard generated curve and 0.98 and 0.96 with serial dilutions of parasite DNA. This research detected L. major and L. tropica definitely and opens the horizon for the other scientists in the multiplex reactions in designing and optimization of the conditions in silico and in vivo.

Species-specific identification of variola, monkeypox, cowpox, and vaccinia viruses by multiplex real-time PCR assay

2011 ◽  
Vol 175 (2) ◽  
pp. 163-169 ◽  
Author(s):  
Sergei N. Shchelkunov ◽  
Dmitrii N. Shcherbakov ◽  
Rinat A. Maksyutov ◽  
Elena V. Gavrilova
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Pcr Assay ◽  
Specific Identification ◽  
Vaccinia Viruses ◽  
Species Specific

scholarly journals Detection of Dientamoeba fragilis in animal faeces using species specific real time PCR assay

2016 ◽  
Vol 227 ◽  
pp. 42-47 ◽  
Author(s):  
Douglas Chan ◽  
Joel Barratt ◽  
Tamalee Roberts ◽  
Owen Phillips ◽  
Jan Šlapeta ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Pcr Assay ◽  
Dientamoeba Fragilis ◽  
Species Specific

Real Time PCR detection of Macrobrachium rosenbergii (de Man, 1879) larvae with emphasis to their ecology

2021 ◽  
Vol 34 ◽  
pp. 12
Author(s):  
Mahadevan Harikrishnan ◽  
Deepak Jose ◽  
B. Nidhin ◽  
K.P. Anilkumar
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Monsoon Season ◽  
Management Strategies ◽  
Macrobrachium Rosenbergii ◽  
Freshwater Prawn ◽  
Larval Abundance ◽  
Larval Stages ◽  
Species Specific ◽  
De Man

Species specific identification of early larval stages of many decapod crustaceans sampled from plankton collections remains cumbersome owing to lack of distinguishable characteristics, where DNA based molecular methods provide accurate results without taxonomic ambiguities. In the present study, an attempt was made to detect temporal occurrence of early zoea of freshwater prawn Macrobrachium rosenbergii (de Man) using real-time PCR assays in polyhaline, mesohaline and oligohaline areas of a tropical positive estuary, the Vembanad lake (S. India). High caridean larval abundance could be recorded in polyhaline areas in all seasons while it could be recorded in monsoon season in mesohaline and oligohaline areas. 113 DNA isolations were successfully made from morphologically identified taxonomic units (MOTU) and SYBR Green based RT-PCR amplifications using designed primer for M. rosenbergii yielded positive detections in 38 samples (34%) representing all seasons in all three zones. Positive detections could be recorded in all months except May in mesohaline areas and differed significantly (F = 17.2 p < 0.01) with the same in polyhaline and oligohaline areas. The present results of molecular detection of M. rosenbergii larvae extend confirmation of its breeding ground in Vembanad lake where appropriate management strategies could be enforced for stock conservation of this species.

Sign in / Sign up

Export Citation Format

Share Document