scholarly journals Cytolethal Distending Toxin of Haemophilus ducreyi Induces Apoptotic Death of Jurkat T Cells

1999 ◽  
Vol 67 (12) ◽  
pp. 6394-6402 ◽  
Author(s):  
Valentina Gelfanova ◽  
Eric J. Hansen ◽  
Stanley M. Spinola
Keyword(s):  
T Cells ◽  
T Cell ◽  
Neutralizing Antibodies ◽  
Mononuclear Cells ◽  
Haemophilus Ducreyi ◽  
Cytolethal Distending Toxin ◽  
Jurkat T Cells ◽  
Toxic Activity ◽  
Heat Labile ◽  
Human T Cell

ABSTRACT The immune response to Haemophilus ducreyi is mediated in part by T cells infiltrating the site of infection. In this study, we show that H. ducreyi antigen preparations inhibited the proliferation of peripheral blood mononuclear cells and primary human T-cell lines. H. ducreyi also inhibited Jurkat T-cell proliferation and induced apoptosis of Jurkat T cells, confirmed through the detection of DNA degradation and membrane unpacking. The cytotoxic product(s) was present in cell-free culture supernatant and whole-cell preparations of H. ducreyi and was heat labile.H. ducreyi produces two known heat-labile toxins, a hemolysin and a cytolethal distending toxin (CDT). Whole cells and supernatants prepared from a hemolysin-deficient mutant had the same inhibitory and apoptotic effects on Jurkat T cells as did its isogenic parent. Preparations made from an H. ducreyi cdtC mutant were less toxic and induced less apoptosis than the parent. The toxic activity of the cdtC mutant was restored by complementation in trans. CdtC-neutralizing antibodies also inhibitedH. ducreyi-induced toxicity and apoptosis. The data suggest that CDT may interfere with T-cell responses to H. ducreyiby induction of apoptosis.

Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element

Blood ◽  
2003 ◽  
Vol 101 (9) ◽  
pp. 3615-3621 ◽  
Author(s):  
Nozomu Hiraiwa ◽  
Tomonori Yabuta ◽  
Keijiro Yoritomi ◽  
Miki Hiraiwa ◽  
Yuetsu Tanaka ◽  
...  
Keyword(s):  
T Cells ◽  
T Cell ◽  
Virus Type ◽  
Binding Protein ◽  
T Cell Leukemia ◽  
Cell Leukemia ◽  
Jurkat T Cells ◽  
Human T Cell ◽  
Responsive Element

Human T-cell leukemic virus type 1 (HTLV-1)–infected T cells express the fucosyltransferase (Fuc-T) VIIgene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VIItranscription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5′-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)–responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C–rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)–promoter. Furthermore, CREMα, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR.

scholarly journals CD30-mediated signaling promotes the development of human T helper type 2-like T cells.

1995 ◽  
Vol 182 (6) ◽  
pp. 1655-1661 ◽  
Author(s):  
G Del Prete ◽  
M De Carli ◽  
M M D'Elios ◽  
K C Daniel ◽  
F Almerigogna ◽  
...  
Keyword(s):  
Monoclonal Antibody ◽  
T Cells ◽  
T Cell ◽  
Mononuclear Cells ◽  
Growth Factor Receptor ◽  
Cytokine Secretion ◽  
T Helper ◽  
Peripheral Blood Mononuclear ◽  
Human T Cell

We have recently shown that CD30, a member of the tumor necrosis factor/nerve growth factor receptor superfamily, is preferentially expressed by human T cell clones producing T helper (Th) type 2 cytokines. We report here that costimulation with an agonistic anti-CD30 monoclonal antibody enhanced antigen (Ag)-induced proliferation and cytokine secretion by established human Th2 and Th0 clones. Moreover, costimulation of peripheral blood mononuclear cells with the same anti-CD30 monoclonal antibody resulted in the preferential development of Ag-specific T cell lines and clones showing a Th2-like profile of cytokine secretion. In contrast, early blockade in bulk culture of CD30 ligand-CD30 interaction shifted the development of Ag-specific T cells towards the opposite (Th1-like) phenotype. Taken together, these data suggest that CD30 triggering of activated Th cells by CD30 ligand-expressing Ag-presenting cells may represent an important costimulatory signaling for the development of Th2-type responses.

scholarly journals Comparative proteomics of exosomes secreted by tumoral Jurkat T cells and normal human T cell blasts unravels a potential tumorigenic role for valosin-containing protein

Oncotarget ◽  
2016 ◽  
Vol 7 (20) ◽  
pp. 29287-29305 ◽  
Author(s):  
Alberto Bosque ◽  
Lisa Dietz ◽  
Ana Gallego-Lleyda ◽  
Manuel Sanclemente ◽  
María Iturralde ◽  
...  
Keyword(s):  
T Cells ◽  
T Cell ◽  
Comparative Proteomics ◽  
Jurkat T Cells ◽  
Human T Cell ◽  
Normal Human

scholarly journals Peripheral Blood Mononuclear Cells from Individuals Infected with Human T-Cell Lymphotropic Virus Type 1 Have a Reduced Capacity To Respond to Recall Antigens

2006 ◽  
Vol 13 (5) ◽  
pp. 547-552 ◽  
Author(s):  
Rita Elizabeth Mascarenhas ◽  
Cláudia Brodskyn ◽  
Geisa Barbosa ◽  
Jorge Clarêncio ◽  
Antônio Souza Andrade-Filho ◽  
...  
Keyword(s):  
T Cells ◽  
T Cell ◽  
Peripheral Blood Mononuclear Cells ◽  
Peripheral Blood ◽  
Mononuclear Cells ◽  
Peripheral Blood Mononuclear ◽  
Human T Cell ◽  
Blood Mononuclear Cells ◽  
Spontaneous Proliferation

ABSTRACT Evidence indicates that human T-cell lymphotropic virus type 1 (HTLV-1) infection leads to chronic immunosuppression and a greater susceptibility to infectious diseases. Spontaneous in vitro proliferation of peripheral blood mononuclear cells (PBMC) is an important immunological feature of HTLV-1-infected individuals. However, the association between spontaneous proliferation and immunosuppression is not clear. In this study, we evaluated the cellular immune responses of PBMC from 58 asymptomatic HTLV-1-infected individuals with PBMC showing or not showing spontaneous proliferation. Individuals with PBMC that spontaneously proliferated had increased proportions of CD4 T cells expressing CD45RO and dramatically reduced responses to recall antigens. In addition, frequencies of positive responses to recall antigens were also decreased in HTLV-infected individuals without spontaneous proliferation of PBMC. There was a polyclonal expansion of multiple T-cell receptor Vβ families of CD4+ T lymphocytes in patients with spontaneous proliferation. We observed that HTLV-1 induced an immunosuppression characterized by a decrease in the stimulation index to a recall antigen, even in individuals who did not present spontaneous proliferation. On the other hand, only patients with PBMC presenting spontaneous proliferation showed polyclonal activation and increased proportion of CD4 T cells expressing CD45RO.

Herpesvirus saimiri transformed T cells and peripheral blood mononuclear cells restimulate identical antigen-specific human T cell clones

2001 ◽  
Vol 254 (1-2) ◽  
pp. 99-108 ◽  
Author(s):  
C.A. Daubenberger ◽  
B. Nickel ◽  
B. Hübner ◽  
U. Siegler ◽  
E. Meinl ◽  
...  
Keyword(s):  
T Cells ◽  
T Cell ◽  
Peripheral Blood Mononuclear Cells ◽  
Peripheral Blood ◽  
Mononuclear Cells ◽  
Herpesvirus Saimiri ◽  
Peripheral Blood Mononuclear ◽  
Human T Cell ◽  
Cell Clones ◽  
Blood Mononuclear Cells

scholarly journals Retinoic acid-responsive CD8 effector T-cells are selectively increased in IL-23-rich tissue in gastrointestinal GvHD

Blood ◽  
2020 ◽  
Author(s):  
Jennifer A Ball ◽  
Andrew James Clear ◽  
James Aries ◽  
Sarah Charrot ◽  
Caroline Besley ◽  
...  
Keyword(s):  
T Cells ◽  
Retinoic Acid ◽  
T Cell ◽  
Mononuclear Cells ◽  
Effector T Cells ◽  
Cell Phenotype ◽  
Major Barrier ◽  
Hematopoietic Stem ◽  
Human T Cell ◽  
The Impact

Gastrointestinal (GI) graft-versus-host disease (GvHD) is a major barrier in allogeneic hematopoietic stem-cell transplantation (AHST). The metabolite retinoic acid (RA) potentiates GI-GvHD in mice via alloreactive T-cells expressing the RA-receptor-alpha (RARα), but the role of RA-responsive cells in human GI-GvHD remains undefined. We therefore used conventional and novel sequential immunostaining and flow cytometry to scrutinize RA-responsive T-cells in tissues and blood of AHST patients and characterize the impact of RA on human T-cell alloresponses. Expression of RARα by human mononuclear cells was increased after RA exposure. RARαhi mononuclear cells were increased in GI-GvHD tissue, contained more cellular RA-binding proteins, localized with tissue damage and correlated with GvHD severity and mortality. Using a targeted candidate protein approach we predicted the phenotype of RA-responsive T-cells in the context of increased microenvironmental IL-23. Sequential immunostaining confirmed the presence of a population of RARahi CD8 T-cells with the predicted phenotype, co-expressing the effector T-cell transcription factor T-bet and the IL-23-specific receptor. These cells were increased in GI- but not skin-GvHD tissues and were also selectively expanded in GI-GvHD patient blood. Finally, functional approaches demonstrated RA predominantly increased alloreactive GI-tropic RARahi CD8 effector T-cells, including cells with the phenotype identified in vivo. IL-23-rich conditions potentiated this effect by selectively increasing b7 integrin expression on CD8 effector T-cells and reducing CD4 T-cells with a regulatory cell phenotype. In conclusion we have identified a population of RA-responsive effector T-cells with a distinctive phenotype which are selectively expanded in human GI-GvHD and represent a potential new therapeutic target.

scholarly journals Infectious transmission of human T-cell lymphotropic virus type II in rabbits

Blood ◽  
1991 ◽  
Vol 78 (6) ◽  
pp. 1532-1537 ◽  
Author(s):  
GL Cockerell ◽  
MG Weiser ◽  
J Rovnak ◽  
B Wicks-Beard ◽  
B Roberts ◽  
...  
Keyword(s):  
T Cells ◽  
T Cell ◽  
Cell Line ◽  
Virus Type ◽  
Lymphoblastoid Cell Line ◽  
Mononuclear Cells ◽  
Lymphoid Cells ◽  
Core Antigen ◽  
Type Ii ◽  
Human T Cell

Abstract To determine the susceptibility of rabbits to experimental infection with human T-cell lymphotropic virus type-II (HTLV-II), four separate groups of four weanling rabbits each were inoculated intravenously with lethally irradiated HTLV-II-infected human cell lines Mo-T (HTLV-IIMo- infected T cells), WIL-NRA (an Epstein-Barr virus [EBV]-transformed B- lymphoblastoid cell line infected with HTLV-IINRA), 729pH6neo (an EBV- transformed lymphoblastoid cell line transfected with a molecular clone of HTLV-IIMo), or G12.1 (HTLV-II-infected T cells from a Panamanian Guaymi Indian). Two additional groups of four rabbits each were similarly inoculated with control uninfected 729 or HuT 78 cells. Early and persistent seroconversion to HTLV-II core antigen p24, as determined by Western immunoblot, occurred in all HTLV-II-inoculated rabbits and was most intense in rabbits inoculated with G12.1 cells; seroreactivity to other HTLV-II gag or env antigens occurred later, with less intensity, or not in all inoculated rabbits. Peripheral blood mononuclear cells (PBMC) and other lymphoid cells from HTLV-II- inoculated rabbits produced minimal p24 in vitro, as determined by enzyme immunosorbent capture assay. Virus was more readily detected by polymerase chain reaction amplification of HTLV-II pol sequences; this occurred most frequently in rabbits inoculated with Mo-T cells, and most frequently in PBMC as compared with other tissues tested (bone marrow, brain, and liver). No evidence of disease occurred in HTLV-II- inoculated rabbits observed for as long as 24 weeks. All control rabbits remained negative for evidence of HTLV-II infection, as determined by the same procedures. These results provide the first evidence of HTLV-II infection in a species other than humans, and demonstrate the usefulness of the rabbit as an animal model to study the biologic response to different isolates of this human retrovirus.

scholarly journals Characterization of Human CD4+ T-Cell Clones Recognizing Conserved and Variable Epitopes of the Lassa Virus Nucleoprotein

2000 ◽  
Vol 74 (5) ◽  
pp. 2186-2192 ◽  
Author(s):  
Jan ter Meulen ◽  
Marlis Badusche ◽  
Kristiane Kuhnt ◽  
Andrea Doetze ◽  
Judith Satoguina ◽  
...  
Keyword(s):  
T Cells ◽  
T Cell ◽  
Mononuclear Cells ◽  
Amino Acid Sequences ◽  
Eastern Africa ◽  
Proliferation Index ◽  
Lassa Virus ◽  
T Cell Clones ◽  
Human T Cell ◽  
Cell Clones

ABSTRACT T cells must play the major role in controlling acute human Lassa virus infection, because patients recover from acute Lassa fever in the absence of a measurable neutralizing antibody response. T cells alone seem to protect animals from a lethal Lassa virus challenge, because after experimental vaccination no neutralizing antibodies are detectable. In order to study human T-cell reactivity to single Lassa virus proteins, the nucleoprotein (NP) of Lassa virus, strain Josiah, was cloned, expressed in Escherichia coli, and affinity purified. Peripheral blood mononuclear cells (PBMC) obtained from 8 of 13 healthy, Lassa virus antibody-positive individuals living in the Republic of Guinea, western Africa, were found to proliferate in response to the recombinant protein (proliferation index ≥10). PBMC obtained from one individual with a particularly high proliferative response were used to generate 50 NP-specific T-cell clones (TCC). For six of these the epitopes were mapped with overlapping synthetic peptides derived from the sequence of the NP. These CD4+TCC displayed high specific proliferation and produced mainly gamma interferon upon stimulation with NP. Because variation of up to 15% in the amino acid sequences of the structural proteins of naturally occurring Lassa virus variants has been observed, the reactivity of the TCC with peptides derived from the homologous epitopes of the Nigeria strain of Lassa virus and of the eastern Africa arenavirus Mopeia was tested. With the Nigeria strain of Lassa virus the levels of homology were 100% for two of these epitopes and 85% for three of them, whereas homology with the respective Mopeia epitopes ranged from 92 to 69%. Reactivity of the TCC with peptides derived from the variable epitopes of the Nigeria strain and of Mopeia was reduced or completely abolished. This report shows for the first time that seropositive individuals from areas of endemicity have very strong memory CD4+ T-cell responses against the NP of Lassa virus, which are partly strain specific and partly cross-reactive with other Lassa virus strains. Our findings may have important implications for the strategy of designing recombinant vaccines against this mainly T-cell-controlled human arenavirus infection.

In vitro spontaneous lymphoproliferation in patients with human T-cell lymphotropic virus type I–associated neurologic disease: predominant expansion of CD8+ T cells

Blood ◽  
2001 ◽  
Vol 98 (5) ◽  
pp. 1506-1511 ◽  
Author(s):  
Jill A. Sakai ◽  
Masahiro Nagai ◽  
Meghan B. Brennan ◽  
Carlos A. Mora ◽  
Steven Jacobson
Keyword(s):  
T Cells ◽  
T Cell ◽  
Virus Type ◽  
Cd8 T Cells ◽  
Proviral Load ◽  
Mononuclear Cells ◽  
Spastic Paraparesis ◽  
Type I ◽  
Human T Cell

Peripheral blood mononuclear cells (PBMCs) from patients with human T-cell lymphotropic virus type I (HTLV-I)–associated myelopathy/tropical spastic paraparesis (HAM/TSP) proliferate spontaneously in vitro. This spontaneous lymphoproliferation (SP) is one of the immunologic hallmarks of HAM/TSP and is considered to be an important factor related to the pathogenesis of HAM/TSP. However, the cell populations involved in this phenomenon have not yet been definitively identified. To address this issue, the study directly evaluated proliferating cell subsets in SP with a flow cytometric method using bromodeoxyuridine and Ki-67. Although both CD4+ and CD8+ T cells proliferated spontaneously, the percentage of proliferating CD8+ T cells was 2 to 5 times higher than that of CD4+ T cells. In addition, more than 40% of HTLV-I Tax11-19–specific CD8+T cells as detected by an HLA-A*0201/Tax11-19 tetramer proliferated in culture. In spite of this expansion of HTLV-I–specific CD8+ T cells, HTLV-I proviral load did not decrease. This finding will help elucidate the dynamics of in vivo virus-host immunologic interactions that permit the coexistence of high HTLV-I–specific CD8+ cytotoxic T-lymphocyte responses and high HTLV-I proviral load in HAM/TSP.

Sign in / Sign up

Export Citation Format

Share Document