SEROLOGICAL ANALYSIS OF SOME STONE-FRUIT VIRUS ISOLATES

1962 ◽  
Vol 40 (2) ◽  
pp. 361-373 ◽  
Author(s):  
J. H. Tremaine ◽  
R. S. Willison
Keyword(s):  
Sweet Cherry ◽  
Sour Cherry ◽  
Stone Fruit ◽  
Cucumber Plant ◽  
Virus Diseases ◽  
Green Ring ◽  
Diffusion Technique ◽  
Ring Spot ◽  
Virus Isolates ◽  
Gel Diffusion

Concentrated extracts of petals from trees infected with stone-fruit virus diseases, and of cucumber plants inoculated with viruses isolated from these trees, were tested serologically by the gel-diffusion technique with antisera prepared by injection of petal and cucumber plant preparations into rabbits. An antigen, antigen Q, was detected in two yellows, latent and recurrent necrotic ring spot, two green ring mottle isolates from sour cherry, a prune dwarf isolate, two tatter leaf of sweet cherry isolates, and isolates from latent infections of plum and peach. Another antigen, the V antigen, was detected in all the isolates with the exception of a latent necrotic ring spot isolate. A third antigen, antigen P, was detected only in the two yellows, recurrent necrotic ring spot, two green ring mottle isolates from sour cherry, a prune dwarf isolate, and two tatter leaf isolates from sweet cherry. Some differences between the Q antigens in certain isolates were demonstrated, but the V antigens differed little from isolate to isolate. The recurrent necrotic ring spot isolate was shown to contain at least two distinct viruses and the P antigen was associated with one of these viruses.

SEROLOGICAL PROPERTIES COMMON TO DIFFERENT ISOLATES OF SOME STONE-FRUIT VIRUSES

1961 ◽  
Vol 39 (6) ◽  
pp. 1387-1391 ◽  
Author(s):  
J. H. Tremaine ◽  
R. S. Willison
Keyword(s):  
Sweet Cherry ◽  
Sour Cherry ◽  
Stone Fruit ◽  
Green Ring ◽  
Virus Antigens ◽  
Ring Spot ◽  
Gel Diffusion

Virus entities in cucumber associated with cherry yellows, green ring mottle, and necrotic ring spot of sour cherry; tatter leaf of sweet cherry; and prune dwarf were found to be serologically related but not identical. The virus antigens were compared in gel-diffusion precipitin tests with antisera prepared from both cucumber leaves and infected cherry petals.

SEROLOGICAL AND PHYSICAL PROPERTIES OF SOME STONE-FRUIT VIRUSES: NON-VIRUS PARTICLES ASSOCIATED WITH INFECTION

1961 ◽  
Vol 39 (6) ◽  
pp. 1447-1452 ◽  
Author(s):  
R. S. Willison ◽  
J. H. Tremaine ◽  
M. Weintraub
Keyword(s):  
Sour Cherry ◽  
Double Diffusion ◽  
Nucleic Acid Content ◽  
Yellow Virus ◽  
Spot Virus ◽  
Agar Gel ◽  
Virus Particles ◽  
Diffusion Technique ◽  
Ring Spot ◽  
Virus Isolates

Cherry yellow virus, isolates Y.2 and Y.4, and necrotic ring spot virus, isolates N.4 and N.5, purified either from cucumber leaves or from sour cherry petals, were characterized by antigenically related particles that sedimented at approximately 72 S. Some preparations of each virus derived from either host also contained either a 35 S or a 22 S component usually having a low nucleic acid content. Such preparations were shown by the agar gel double-diffusion technique to contain two antigens, V and Q, that were only distantly, if at all, related. The 72 S component is associated with the V antigen, whereas the 22 S and 35 S components are tentatively considered to be two forms of the Q antigen. The Q antigen could also be detected in clarified expressed sap of infected cucumber tissue, but not in that of healthy cucumber nor in extracts prepared from healthy sources by methods used to purify the viruses. The Q antigen is thus associated with infection, but its origin has not yet been satisfactorily determined.

scholarly journals Occurrence and detection of lesser known viruses and phytoplasmas in stone fruit orchards in Poland

2010 ◽  
Vol 22 (2) ◽  
pp. 51-57 ◽  
Author(s):  
Mirosława Cieślińska ◽  
Halina Morgaś
Keyword(s):  
Sweet Cherry ◽  
Sour Cherry ◽  
Fruit Trees ◽  
Stone Fruit ◽  
Mottle Virus ◽  
Green Ring ◽  
Japanese Plum ◽  
Fruit Orchards ◽  
Leaf Virus ◽  
Cherry Trees

Abstract A survey was carried out on 38 commercial and experimental stone fruit orchards located in major growing areas of stone fruit trees in Poland to determine the incidence of lesser known viruses and phytoplasmas. Leaf samples from 145 sweet cherry and 102 sour cherry trees were tested for Little cherry virus 1 (LChV-1), Little cherry virus 2 (LChV-2), Cherry green ring mottle virus (CGRMV), Cherry mottle leaf virus (CMLV), and Cherry necrotic rusty mottle virus (CNRMV) using RT-PCR. Sixty samples collected from peach and 20 apricot trees were also tested for CGRMV. Eleven out of 145 sweet cherry and three out of 102 sour cherry trees were infected by LChV-1. CGRMV was detected in 10 sweet cherry, four sour cherry, 14 peach and two apricot trees. No LChV-2, CMLV and CNRMV were detected in any of the tested trees. Phloem tissue from samples of shoots collected from 145 sweet cherry, 102 sour cherry, 128 peach, 37 apricot, five nectarine and 20 European as well as Japanese plum trees were tested for phytoplasmas. The nested PCR of the extracted DNA with universal and specific primer pairs showed the presence of phytoplasmas in six sweet cherry, three sour cherry, nine peach, four apricot, one nectarine and three Japanese plum trees. The RFLP patterns of 16S rDNA fragments after digestion with RsaI, MseI, AluI, and SspI endonucleases indicated that selected stone fruit trees were infected by two distinct phytoplasmas belonging to the apple proliferation group. The stone fruit trees infected by LChV-1, CGRMV and phytoplasmas were grown in orchards localised in all seven regions

Studies of rootstocks for stone fruit breeds (sweet cherry) in the condition of Hissar valley in Tajikistan

2019 ◽  
Vol 1 (4) ◽  
pp. 28-34
Author(s):  
Rahima I. Ismoilova ◽  
Sodzhida D. Umarova
Keyword(s):  
Sweet Cherry ◽  
Sour Cherry ◽  
High Specificity ◽  
Stone Fruit ◽  
Wild Cherry ◽  
Phenological Observation ◽  
Entire Observation Period ◽  
The Individual ◽  
Leaf System ◽  
Observation Period

This paper is about studying the rootstocks for stone fruit breeds (sweet cherry) in condition of Hissar valley in Tajikistan. Each type of rootstock has its own biological characteristics and imposes specific requirements for growing and development, both during reproduction in the mother plantation and during the growth of trees. For example, the root system in sour cherry is more superficial that of wild sweet cherry. Therefore, the care of trees grafted on sour cherry and wild cherry and of mother plantation bushes of these rootstocks cannot be same. Besides, there are very significant differences among the individual groups of rootstocks. Wild cherry, Mahaleb cherry and Lubskaya cherry are used as rootstocks in the conditions of the Hissar Valley in Tajikistan. High specificity of sweet cherry cultivar varieties depends on the rootstocks. Phenological observation were carried out in our experiments during years 2013-2018 in order to study their winter resistance, yield capacity and fruit quality. The same care for root and grafted plants was carried out during the entire observation period. At the same time a certain ratio between the leaf system of the rootstock and the graft was maintained by trimming the crown. As a result of the evolution and selection, we have identified the wild cherry forms which are distinguished by the highest yields. The most valuable cultivar varieties are Napoleon cherry and Bagration cherry. Compotes made of these varieties have received high evaluation in tasting.

PURIFICATION AND ELECTRON MICROSCOPY OF VIRUSES CAUSING CHERRY YELLOWS AND RELATED DISEASES

1956 ◽  
Vol 34 (1) ◽  
pp. 86-103 ◽  
Author(s):  
R. S. Willison ◽  
M. Weintraub ◽  
J. D. Ferguson
Keyword(s):  
Particle Diameter ◽  
Potassium Cyanide ◽  
Sour Cherry ◽  
Single Mode ◽  
Amyl Alcohol ◽  
Differential Centrifugation ◽  
Sodium Bisulphite ◽  
Green Ring ◽  
Ammonium Sulphate Precipitation ◽  
Ring Spot

Virus entities associated with necrotic ring spot, yellows, and green ring mottle of sour cherry, tatter leaf of sweet cherry, prune dwarf, and two viroses of rose have been purified and concentrated from cucumber leaves and/or peach and cherry petals and peach leaves by differential centrifugation. To prevent inactivation of the virus, the Prunus tissues were homogenized with 0.1% potassium cyanide in 2.5% sodium bisulphite. Infective extracts of some of the entities were also prepared by ammonium sulphate precipitation and from aqueous chloroform–amyl-alcohol emulsion. Particles ranging from less than 10 to more than 100 mμ in diameter were observed with the electron microscope in extracts from both healthy and virus-infected sources. In the former, prepared by differential centrifugation, particles were distributed about a series of peaks at 10 mμ intervals and, in the latter, about a single mode characteristic of the entity under examination. Particles associated with different entities ranged from 28 mμ diameter for rose mosaic to 50 mμ for some tatter leaf and green ring mottle isolates. In extracts known to contain two viruses, characteristic distributions of each component of the mixture could be determined if the mean particle diameter of one virus was known and differed from that of the other entity by 5 mμ or more. Evidence based on particle characteristics, supplemented by cross protections and comparative symptomatology suggests that the necrotic ring spot virus is not necessarily involved in the etiology of cherry yellows, prune dwarf, tatter leaf, or green ring mottle.

scholarly journals SPREAD OF NECROTIC RING SPOT AND SOUR CHERRY YELLOWS VIRUSES IN NIAGARA PENINSULA ORCHARDS

1964 ◽  
Vol 44 (5) ◽  
pp. 471-484 ◽  
Author(s):  
T. R. Davidson ◽  
J. A. George
Keyword(s):  
Sour Cherry ◽  
Virus Diseases ◽  
Secondary Symptom ◽  
Spot Virus ◽  
Current Season ◽  
Rapid Spread ◽  
Long Time ◽  
Ring Spot ◽  
Usual Reaction ◽  
Trace Reactions

In the Niagara Peninsula of Ontario necrotic ring spot (NRS) and sour cherry yellows (SCY) are the two principal virus diseases of sour cherry. Since 1951 most trees grown in this area have been propagated from virus-free budwood but about 4% of the rootstock used carries virus.A combination of symptoms known as ’shock’ is the usual reaction to infection with either virus. However, in some trees the first sign of infection is only an etch, which is usually considered to be a secondary symptom of NRS. In a few trees the primary symptoms are very mild trace reactions strongly suggestive of trees that have been infected for a long time. Indexing on peach seedlings is generally not a good indicator of current season infection. It is however very accurate in detecting virus in trees that have been infected for more than 1 year.The rate of virus spread in young orchards is dependent upon the age of the orchard, the proximity of older diseased trees, and the amount of disease within the orchard. Necrotic ring spot virus (NRSV) spreads very slowly in orchards under 4 years old but can spread very rapidly in orchards over 4 years old. Most rapid spread of NRS occurs after 20% of the trees in an orchard are infected. Sour cherry yellows virus on the other hand does not spread rapidly until after the 10th year. Both viruses can spread over a considerable distance, NRSV at least 800 yd and SCYV about 100 yd, but most infections of both occur within 50 ft of a known source. There is no indication that any plant other than sour cherry serves as a source of inoculum.

scholarly journals Analysis of Double-Stranded RNAs from Cherry Trees with Stem Pitting in California

Plant Disease ◽  
1998 ◽  
Vol 82 (8) ◽  
pp. 871-874 ◽  
Author(s):  
Yun-Ping Zhang ◽  
J. K. Uyemoto ◽  
B. C. Kirkpatrick
Keyword(s):  
Sweet Cherry ◽  
Prunus Avium ◽  
Sour Cherry ◽  
Rt Pcr ◽  
Cloning And Sequencing ◽  
Green Ring ◽  
Flowering Cherry ◽  
Polymerase Chain ◽  
Stem Pitting ◽  
Dsrna Species

Five distinct dsRNA species were recovered from Bing sweet cherry (Prunus avium (L.) L.) trees with stem pitting symptoms. A 4.7-kilobase pair (kbp) dsRNA was isolated from mahaleb rootstock (P. mahaleb L.); an unrelated 4.7-kbp dsRNA, always co-purified with a 1.3-kbp dsRNA, and a 9-kbp dsRNA were from Bing cherry. In addition, an 8.5-kbp dsRNA found in diseased Shirofugen flowering cherry and in Bing cherry was identified as sour cherry green ring mottle virus (CGRMV). The larger, 8.5- and 9.0-kbp dsRNA species were graft-transmissible, while the smaller ones were non-transmissible and appeared cryptic in nature. Reverse transcription-polymerase chain reaction (RT-PCR) assays were developed for each dsRNA species by cloning and sequencing cDNA synthesized from the dsRNA templates. When several diseased collections were assayed by RT-PCR, approximately 14% reacted positively with primers for the 9.0-kbp dsRNA or CGRMV. Although CGRMV and the 9.0-kbp dsRNA caused wood-marking symptoms in graft-inoculated Mazzard (P. avium) seedling trees, no xylem or canopy symptoms developed in grafted Bing cherry. The causal agent or agents of cherry stem pitting have not been identified.

scholarly journals First Report of Cherry green ring mottle virus in Plum (Prunus domestica) in North America

Plant Disease ◽  
2009 ◽  
Vol 93 (10) ◽  
pp. 1073-1073 ◽  
Author(s):  
L. P. Wang ◽  
N. Hong ◽  
G. P. Wang ◽  
R. Michelutti ◽  
B. L. Zhang
Keyword(s):  
North America ◽  
Sweet Cherry ◽  
Sour Cherry ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Prunus Species ◽  
Indicator Plants ◽  
First Report ◽  
Green Ring ◽  
Field Samples

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, is reported to infect several Prunus species including sour cherry (Prunus cerasus L.), sweet cherry (P. avium L.), flowering cherry (P. serrulata L.), peach (P. persica B.), and apricot (P. armeniaca L.). The virus has been detected in most regions of North America, Europe, New Zealand, Africa, and Japan where Prunus species are grown for production (3). In sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Other Prunus species are usually symptomless hosts of CGRMV. There is no report on the infection of CGRMV in plum so far. A survey was conducted to evaluate the sanitary status of stone fruit tree collections in the Canadian Clonal Genebank (CCG) at the Greenhouse and Processing Crops Research Center (GPCRC) in Harrow, Ontario (Canada). In October 2006, samples from 110 cultivar clones including 28 sweet cherry, 36 sour cherry, 12 hybrids, and 34 plum accessions, were bud grafted onto indicator seedlings of P. serrulata ‘Kwanzan’ for virus indexing in a greenhouse with a controlled environment. In April 2007, symptoms of epinasty and/or rusty necrotic fragments of midrib, which is indicative of Kwanzan infection by CGRMV (4), were observed on indicator plants inoculated with samples from eight clones (one sweet cherry, one cherry plum (P. besseyi × P. hortulana) and six plum). Indicator plants inoculated with samples from 19 other clones (three sweet cherry, nine sour cherry, one cherry plum and six plum) showed symptoms including small leaves and leaves that were twisted, deformed, bubbled, and/or had shot holes. Total RNA was extracted from leaves of all these symptomatic indicator plants by the cetyltrimethylammoniumbromide (CTAB) method (2). One-step reverse transcription (RT)-PCR was carried out using the primer set CGRMV1 (CCTCATTCACATAGCTTAGGTTT, 7,297 to 7,313 bp) and CGRMV2 (ACTTTAGCTTCGCCCCGTG, 8,245 to 8,227 bp) (1) for the detection of CGRMV. Amplicons of the expected size of 948 bp were consistently produced from eight samples showing symptoms of CGRMV infection, no amplicons were produced from the other 19 samples. Those results were further confirmed by RT-PCR detection for the original field samples. The fragment from plum cv. Vanier was cloned into pGEM-T Easy and sequenced in both directions of three clones. The resulting nucleotide sequence (GenBank Accession No. FJ402843) had the highest identity (97%) with that of a CGRMV isolate Star from sweet cherry (GenBank Accession No. AY841279) and had lower identity (81%) with that of a CGRMV isolate from apricot (GenBank Accession No. AY172334.1). To our knowledge, this is the first report of CGRMV infecting plum in North America. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. Plant Dis. 88:12, 2004. (3) K. G. Parker et al. USDA Agric. Handb. No. 437:193, 1976. (4) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

scholarly journals First Report of Cherry green ring mottle virus on Sweet Cherry in Poland

Plant Disease ◽  
2005 ◽  
Vol 89 (12) ◽  
pp. 1363-1363 ◽  
Author(s):  
B. Komorowska ◽  
M. Cieślińska
Keyword(s):  
Nucleotide Sequence ◽  
Sweet Cherry ◽  
Pcr Amplification ◽  
Sour Cherry ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Green Ring ◽  
Bacterial Vector ◽  
Primer Sets ◽  
Cherry Trees

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, infects several Prunus species including sweet cherry, sour cherry, ornamental cherry, peach, and apricot throughout North America and Europe. On sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Sweet cherry trees are symptomless hosts of CGRMV. During the 2004 growing season, 27 sour and sweet cherry trees were tested for the presence of CGRMV. RNA was isolated from leaves using an RNeasy kit (Qiagen GmbH, Hilden, Germany) and then evaluated by reverse transcription-polymerase chain reaction (RT-PCR) amplification. Two primer sets, GRMV7956/GRMV8316 (1) and NCP5/NCP3 (2), were used for amplification of the CGRMV coat protein gene (807 bp) or its fragment (366 bp), respectively. The cDNA fragments were cloned into bacterial vector pCR 2.1-TOPO, sequenced and analyzed using the Lasergene (DNASTAR, Madison, WI) computer program. Nucleotide sequence of the C328 isolate (GenBank Accession No. AY841279) was compared with corresponding regions of published sequences of CGRMV isolates. The nucleotide sequence of this isolate was 98% identical to the Leb isolate (GenBank Accession No. AF533157) from sour cherry. The lowest similarity (80%) was between the CP sequences of isolate C328 and an isolate from apricot (GenBank Accession No. AY172334.1). Results of biological indexing on Prunus serrulata ‘Shirofugen’ and ‘Kwanzan’ confirmed the infection of ‘Star’ sweet cherry with CGRMV. The indicators showed leaf epinasty and necrosis of fragments of midrib or veins characteristic for CGRMV (2). The CGRMV infection of the indicators was confirmed using RT-PCR. References: (1) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411, 2001. (2) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

scholarly journals First Report of Cherry necrotic rusty mottle virus on Stone Fruit Trees in China

Plant Disease ◽  
2013 ◽  
Vol 97 (2) ◽  
pp. 290-290 ◽  
Author(s):  
J. F. Zhou ◽  
G. P. Wang ◽  
L. N. Qu ◽  
C. L. Deng ◽  
Y. Wang ◽  
...  
Keyword(s):  
Sweet Cherry ◽  
Prunus Persica ◽  
Sour Cherry ◽  
Fruit Trees ◽  
Stone Fruit ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Cherry Tree ◽  
First Report ◽  
Pcr Products

During the growing seasons of 2010 through 2012, leaf tissues from 206 stone fruit trees, including one flowering cherry, three sour cherry, six nectarine (Prunus persica L. var. nucipersica Schneider), 14 apricot, 24 plum (P. domestica L.), 41 sweet cherry, and 117 peach [P. persica (L.) Batsch] trees, grown in six provinces of China, were randomly collected and tested for the CNRMV infection by RT-PCR. Out of those sampled trees, 37 showed shot holes and vein yellowing symptoms. Total RNA was extracted from leaves using the CTAB protocol reported by Li et al. (2). The primer pair CGRMV1/CGRMV2 (1) was used to amplify a fragment of 949 bp from CNRMV genome, which includes the CP gene (804 bp). PCR products with the expected size were detected in one sweet cherry, one apricot, one peach, one plum, and two sour cherry plants. However, no correlation between PCR data and symptom expression could be found. PCR products were cloned into the vector pMD18-T (TaKaRa, Dalian, China). Three independent clones from each isolate were sequenced by Genscript Corp., Nanjing, China, and sequences were deposited in the GenBank under accession nos. JX491635, JX491636, JX491637, JX648205, and JX648206. Results of sequence analysis showed that sequences of the five CNRMV isolates shared the highest nt (99.0 to 99.6%) and aa (98.9 to 100%) similarities with a cherry isolate from Germany (GenBank Accession No. AF237816). The sequence of one isolate from a peach tree (JX648205) was divergent and shared only 84.7 to 86.1% nt and 94.4 to 95.1% aa similarities with those cp sequences. Clones intra each isolate shared more than 99% nt similarities. To confirm CNRMV infection, seedlings of peach GF 305 were graft-inoculated with bud-woods from a peach and a sweet cherry tree, which was positive to CNRMV and also two other viruses: Cherry green ring mottle virus (CGRMV) and Plum bark necrosis stem pitting-associated virus (PBNSPaV), as tested by RT-PCR. Grafted seedlings were kept in an insectproof greenhouse and observed for symptom development. In May of the following year, some newly developed leaves of inoculated seedlings showed vein yellowing, ringspot, and shot hole symptoms. Results of Protein A sandwich (PAS)-ELISA using an antiserum raised against the recombinant CP of a CNRMV isolate (unpublished) and RT-PCR confirmed CNRMV infection in inoculated trees. In addition to CNRMV, tested seedlings were also found to be infected with CGRMV and PBNSPaV by RT-PCR. To our knowledge, this is the first report on the occurrence of CNRMV on stone fruit trees in China, and also the first record of the CNRMV infection in peach and plum plants. Given the economic importance of its hosts and the visible symptoms of the viral disease, it is important to prevent the virus spread by using virus-tested propagation materials. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. J. Virol. Methods 154:48, 2008.

Sign in / Sign up

Export Citation Format

Share Document