Antagonistic Evaluation of Bioactive Metabolite from Endophytic Fungus, Aspergillus flavipes KF671231

Of the total 40 endophytic fungi isolated from foliar tissues of medicinal plant Stevia rebaudiana Bertoni, a fungal isolate, Aspergillus flavipes, was subjected to bioassay guided fractionation. The fractionation was found active against medicinal plant pathogen Sclerotinia sclerotiorum with an inhibition zone of 29 mm in size. Further the metabolite was extracted which shows 20% growth inhibition in 24 h and 46% after 48 h, respectively. Bioassay guided chemical compound was identified as 1,2-benzenedicarboxylic acid, mono(2-ethylhexyl) ester. On the basis of morphological characters and rDNA sequencing of ITS region the endophyte was identified as Aspergillus flavipes which showed promising plant growth promotory properties.

Download Full-text

Cytogenetic and sequence comparison of adultPhyllodistomum(Digenea: Gorgoderidae) from the three-spined stickleback with larvae from two bivalves

Parasitology ◽

10.1017/s0031182004006109 ◽

2004 ◽

Vol 129 (6) ◽

pp. 771-778 ◽

Cited By ~ 14

Author(s):

R. PETKEVIČIŪTĖ ◽

V. STUNŽĖNAS ◽

G. STANEVIČIŪTĖ

Keyword(s):

Developmental Stages ◽

Its Region ◽

Morphological Characters ◽

Molecular Data ◽

Chromosome Morphology ◽

Published Data ◽

Larval Stages ◽

Rdna Sequences ◽

Rdna Sequencing ◽

High Level

Due to the low informative value of available morphological characters, cytogenetic and molecular methods, based on rDNA sequencing, were used to characterize adult and larval stages ofPhyllodistomumspp. Species studied have 18 chromosomes with comparable absolute and relative lengths. Conventional Giemsa staining and karyometric analysis revealed clear differences in chromosome morphology of larvalPhyllodistomumspp. infecting two bivalve host species,Sphaerium corneumandPisidium amnicum. However, karyotypes of adultP. foliumfrom three-spined sticklebacks and larval stages fromS. corneumappear almost identical both with respect to the relative lengths and centromeric indices of the corresponding chromosome pairs. The entire internal transcribed spacer (ITS) region (ITS-1, 5.8S and ITS-2) and the D1-D3 region of 28S gene were sequenced and compared. Again, sufficient differences were observed between larvalPhyllodistomumspp., while adultP. foliumand larvae fromS. corneumshowed a high level of similarity. So, both cytogenetic and molecular data support the suggestion that they represent developmental stages of the same species. The results were compared with published data obtained by cytogenetic and molecular studies on the otherPhyllodistomumspecies. Differences revealed in karyotype and rDNA sequences leads to the conclusion that the cercariaeum ofP. foliumsensu Sinitsin, 1905 could not be regarded as the larva of adultP. foliumfrom three-spined stickleback.

Download Full-text

First Report of Gray Mold Caused by Botrytis cinerea on Stevia rebaudiana in Italy

Plant Disease ◽

10.1094/pdis-93-3-0318a ◽

2009 ◽

Vol 93 (3) ◽

pp. 318-318

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

M. L. Gullino

Keyword(s):

Botrytis Cinerea ◽

Stevia Rebaudiana ◽

Its Region ◽

Morphological Characters ◽

Gray Mold ◽

Fluorescent Light ◽

Pathogenicity Test ◽

Leaf Extracts ◽

First Report ◽

Potted Plants

Stevia rebaudiana (sweetleaf) is a perennial shrub belonging to the Asteraceae family and is widely grown for its sweet leaves. With its extracts having as much as 300 times the sweetness of sugar, this species is used in many countries for the production of sugar substitutes. However, in Italy, as well as in other countries, this species cannot be grown for the use of its leaf extracts. This plant is grown in a few nurseries in the Albenga Region (northern Italy) as potted plants. In February of 2008, 3-month-old plants grown in plastic pots (14-cm diameter) under glasshouse on heated benches started showing symptoms of a previously unknown blight. The temperature in the glasshouse ranged between 16 and 20°C and plants were watered by sprinkle irrigation. Leaves, starting from the basal ones, showed small, brown spots that spread across the entire leaf surface. Subsequently, the crown and stem were infected, and the pathogen developed abundant, soft, gray mycelium on leaves and stems and in the middle of the heads of S. rebaudiana. Flowers were not present when the symptoms appeared. Severely infected leaves dried out and became necrotic. The disease was observed in one nursery in which 5% of the plants were affected. The margins of the lesions were excised from leaves, immersed in a solution containing 1% sodium hypochlorite, and then cultured on potato dextrose agar (PDA) medium. A fungus produced abundant mycelium when incubated under constant fluorescent light at 22 ± 1°C after 10 days. The conidia were smooth, hyaline, ovoid, measuring 15.5 to 8.3 × 11.1 to 7.3 (average 11.6 × 8.6) μm, and were similar to those described for Botrytis cinerea. Conidiophores were slender and branched with enlarged apical cells bearing conidia on short sterigmata. The identity of the fungus was also confirmed by the production of numerous, small, black sclerotia on PDA plates incubated for 20 days at 8 ± 1°C. Sclerotia were dark and irregular with a diameter ranging from 1 to 2 mm. These morphological characters identified the fungus as B. cinerea (2). The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and sequenced. BLAST analysis (1) of the 780-bp segment showed a 100% homology with the sequence of Botryotinia fuckeliana (perfect stage of B. cinerea). The nucleotide sequence has been assigned GenBank Accession No. FJ486270. Pathogenicity tests were performed by spraying leaves of six healthy 6-month-old potted S. rebaudiana plants with a 105 conidia/ml suspension. Six plants sprayed with water only served as controls. Plants were covered with plastic bags for 3 days after inoculation to maintain high relative humidity and were placed in a growth chamber at 20 ± 1°C. The first foliar lesions developed on leaves 4 days after inoculation, whereas control plants remained healthy. B. cinerea was consistently reisolated from these lesions. The pathogenicity test was completed twice. To our knowledge, this is the first report of the presence of B. cinerea on S. rebaudiana in Italy. The disease has been reported in Ukraine (3) and more recently in Japan (4). The economic importance of this disease is at the moment limited. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) H. L. Barnett and B. B. Hunter. Illustrated Genera of Imperfect Fungi. Burgess Publishing Company, Minneapolis, MN, 1972. (3) J. Takeuch and H. Horie. Annu. Rep. Kanto-Tosan Plant Prot. Soc. 53:87, 2006. (4) V. F. Zubenko et al. Zash. Rast. 18, 1991.

Download Full-text

Pharmacognostical fingerprinting and selective bioactivity studies of Solanum glaucophyllum Desf.

Journal of Traditional and Folk Practices ◽

10.25173/jtfp.2018.6.1.87 ◽

2018 ◽

Vol 6 (1) ◽

Author(s):

Anindya Sundar Ray ◽

Suman Kalyan Mandal ◽

Chowdhury Habibur Rahaman

Keyword(s):

Medicinal Plant ◽

Radical Scavenging ◽

Ethanol Extract ◽

Inhibition Zone ◽

Phytochemical Analysis ◽

Antimicrobial Studies ◽

Maximum Inhibition ◽

Crude Drugs ◽

Phytochemical Studies ◽

Dpph Radical Scavenging

Solanum glaucophyllum Desf. (Solanaceae) is traditionally used for curing several health conditions in both human and domesticated animals. There is no data available regarding pharmacognostic standardization and pharmacological activity of this less known medicinal plant. Therefore, the aim of the present work is to prepare pharmacognostic fingerprints of crude drugs obtained from the leaf and stem parts of S. glaucophyllum. Apart from this detailed phytochemical analysis, antioxidant and antimicrobial studies have also been carried out. Pharmacognostic study revealed that the leaves are amphistomatic and stomata are strictly of anisocytic type. Values of stomatal index, palisade ratio, ash content of the investigated parts are found distinct and can be used as pharmacognostic standards for evaluation of crude drugs of this medicinal plant. Phytochemical studies of the leaf and stem parts indicated that phenolics, flavonoids, tannins and alkaloids are present in quite impressible amount. Curcumin content in stem was found very high through HPLC analysis. In DPPH radical scavenging assay, the stem part showed significant antioxidant potential. Ethanol extract of stem produced maximum inhibition zone (11mm) against Pseudomonas aeruginosa at the concentration of 50 mg/ml among five test microorganisms. Some pharmacognostic features recorded in this study as diagnostic ones will help in proper identification of this ethnomedicinal plant in its fresh as well as dried form. On the other hand preliminary phytochemical, antioxidant and antimicrobial studies highlight the S. glaucophyllum as a promising candidate for bioprospecting.

Download Full-text

The Classification of Medicinal Plant Leaves Based on Multispectral and Texture Feature Using Machine Learning Approach

Agronomy ◽

10.3390/agronomy11020263 ◽

2021 ◽

Vol 11 (2) ◽

pp. 263

Author(s):

Samreen Naeem ◽

Aqib Ali ◽

Christophe Chesneau ◽

Muhammad H. Tahir ◽

Farrukh Jamal ◽

...

Keyword(s):

Machine Learning ◽

Medicinal Plant ◽

Texture Feature ◽

Stevia Rebaudiana ◽

Ocimum Sanctum ◽

Multi Layer Perceptron ◽

Plant Leaves ◽

Chi Square ◽

Lemon Balm

This study proposes the machine learning based classification of medical plant leaves. The total six varieties of medicinal plant leaves-based dataset are collected from the Department of Agriculture, The Islamia University of Bahawalpur, Pakistan. These plants are commonly named in English as (herbal) Tulsi, Peppermint, Bael, Lemon balm, Catnip, and Stevia and scientifically named in Latin as Ocimum sanctum, Mentha balsamea, Aegle marmelos, Melissa officinalis, Nepeta cataria, and Stevia rebaudiana, respectively. The multispectral and digital image dataset are collected via a computer vision laboratory setup. For the preprocessing step, we crop the region of the leaf and transform it into a gray level format. Secondly, we perform a seed intensity-based edge/line detection utilizing Sobel filter and draw five regions of observations. A total of 65 fused features dataset is extracted, being a combination of texture, run-length matrix, and multi-spectral features. For the feature optimization process, we employ a chi-square feature selection approach and select 14 optimized features. Finally, five machine learning classifiers named as a multi-layer perceptron, logit-boost, bagging, random forest, and simple logistic are deployed on an optimized medicinal plant leaves dataset, and it is observed that the multi-layer perceptron classifier shows a relatively promising accuracy of 99.01% as compared to the competition. The distinct classification accuracy by the multi-layer perceptron classifier on six medicinal plant leaves are 99.10% for Tulsi, 99.80% for Peppermint, 98.40% for Bael, 99.90% for Lemon balm, 98.40% for Catnip, and 99.20% for Stevia.

Download Full-text

Fungal composition of lichen thalli assessed by single strand conformation polymorphism

The Lichenologist ◽

10.1017/s0024282909990752 ◽

2010 ◽

Vol 42 (4) ◽

pp. 461-473 ◽

Cited By ~ 10

Author(s):

Lucia MUGGIA ◽

Martin GRUBE

Keyword(s):

Direct Sequencing ◽

Its Region ◽

Single Strand Conformation Polymorphism ◽

Morphological Characters ◽

Single Strand ◽

Specific Primers ◽

Lichenicolous Fungi ◽

Large Numbers ◽

Total Dna ◽

Conformation Polymorphism

AbstractFungi that are unrelated to the mycobiont species frequently colonize lichens. Some of these fungal colonists are described lichenicolous fungi, lichen parasites and pathogens that produce recognizable morphological characters, while others apparently produce no noticeable structures. Here we apply the single strand conformation polymorphism (SSCP) technique to directly assess the abundance of different fungi in lichens. Twenty-eight lichen thalli were chosen, some with and some without externally visible symptoms of parasite infection, and these were subjected to total DNA extraction. PCR was conducted with fungal-specific primers for the ITS region of ribosomal DNA. Single strands of the products were separated on native acrylamide gels. The majority of lichen specimens, both infected and those without symptoms, displayed more than one band in the stained gels. In one case, 14 bands were detected using SSCP. Some of these bands apparently represent other neighbouring lichens in the habitat, but many are apparently non-lichen-forming. Since few lichen-associated fungi have been cultured and sequenced, it is difficult to know if SSCP bands represent obligate lichenicolous fungi, other asymptomatic lichen parasites, or fungi not obligately associated with lichens, but our results indicate that large numbers of non-lichen-forming fungi commonly co-occur with lichens in nature. For specimens of the filamentous lichens Cystocoleus ebeneus and Racodium rupestre we used cloned sequences to compare the number of sequences obtained by the SSCP method to the number obtained by direct sequencing of thallus extracts, and we generally found that more sequences could be detected by SSCP than could be seen by direct sequencing.

Download Full-text

Amanita subjunquillea and its ectomycorrhizal association, reported as new for Pakistan

Mycotaxon ◽

10.5248/134.413 ◽

2019 ◽

Vol 134 (3) ◽

pp. 413-423

Author(s):

Muhammad Ishaq ◽

Arooj Naseer ◽

Munazza Kiran ◽

Muhammad Fiaz ◽

Abdul Nasir Khalid

Keyword(s):

Its Region ◽

Morphological Characters ◽

Molecular Data ◽

Sequence Analyses ◽

Dark Orange ◽

Ectomycorrhizal Roots ◽

Morphological And Molecular Data ◽

Quercus Floribunda ◽

First Time ◽

Ectomycorrhizal Association

Amanita subjunquillea and its ectomycorrhizal association are reported for the first time from moist temperate Himalayan forests of Pakistan. The sample was studied based on morphological characters and nucleotide sequence analyses of the ITS region generated from basidiomata and ectomycorrhizal roots of Quercus floribunda. Our collection differs from the type in its dark orange pileus disc and pale yellow margins. Remaining morphological and molecular data are consistent with previously reported specimens. This represents the first report of A. subjunquillea from Pakistan.

Download Full-text

Biotechnological Production of Natural Calorie Free Steviol Glycosides in Stevia rebaudiana: An Update on Current Scenario

Current Biotechnology ◽

10.2174/2211550108666191210100751 ◽

2020 ◽

Vol 8 (2) ◽

pp. 70-84

Author(s):

Abeer Kazmi ◽

Mubarak Ali Khan ◽

Sher Mohammad ◽

Amir Ali ◽

Huma Ali

Keyword(s):

Medicinal Plant ◽

Cell Cultures ◽

Metabolic Pathways ◽

Plant Material ◽

Research Work ◽

Stevia Rebaudiana ◽

Steviol Glycosides ◽

Market Demand ◽

Biotechnological Production ◽

Current Scenario

Stevia rebaudiana is a vital medicinal plant of the genus Stevia and family Asteraceae. It is commonly used as a natural sweetener plant and its products are 300 times sweeter than the commonly used sugarcane. The sweetening potential is due to the presence of calorie-free steviol glycosides (SGs). The plant species has been extensively profiled to identify steviol glycosides (SGs) with intensity sweetening properties. However, the limited production of plant material is not fulfilling the higher market demand worldwide. Researchers are working worldwide to enhance the production of important SGs through the intervention of different biotechnological approaches in S. rebaudiana. In this review, the research work conducted in the last twenty years, on the different aspects of biotechnology to enhance the production of SGs has been precisely reviewed. Biotechnological methods such as micropropagation, callus and cell cultures, elicitation and the metabolomics and transcriptomic elucidation of the biosynthetic metabolic pathways for the production of steviol glycosides have been concisely reviewed and discussed.

Download Full-text

Diversity and Distribution of Phytophthora Species in Protected Natural Areas in Sicily

Forests ◽

10.3390/f10030259 ◽

2019 ◽

Vol 10 (3) ◽

pp. 259 ◽

Cited By ~ 9

Author(s):

Thomas Jung ◽

Federico La Spada ◽

Antonella Pane ◽

Francesco Aloi ◽

Maria Evoli ◽

...

Keyword(s):

Host Plants ◽

Rhizosphere Soil ◽

Stream Water ◽

Its Region ◽

Morphological Characters ◽

Phytophthora Species ◽

Riparian Ecosystems ◽

Forest Stands ◽

Natural Areas ◽

Protected Natural Areas

: The aim of this study was to investigate the occurrence, diversity, and distribution of Phytophthora species in Protected Natural Areas (PNAs), including forest stands, rivers, and riparian ecosystems, in Sicily (Italy), and assessing correlations with natural vegetation and host plants. Fifteen forest stands and 14 rivers in 10 Sicilian PNAs were studied. Phytophthora isolations from soil and stream water were performed using leaf baitings. Isolates were identified using both morphological characters and sequence analysis of the internal transcribed spacer (ITS) region. A rich community of 20 Phytophthora species from eight phylogenetic clades, including three new Phytophthora taxa, was recovered (17 species in rhizosphere soil from forest stands and 12 species in rivers). New knowledge about the distribution, host associations, and ecology of several Phytophthora species was provided.

Download Full-text

Lactarius guangdongensis sp. nov. (Russulaceae, Russulales), a species of Lactarius sect. Deliciosi growing with a vulnerable five-needle pine, Pinus kwangtungensis

Phytotaxa ◽

10.11646/phytotaxa.393.3.4 ◽

2019 ◽

Vol 393 (3) ◽

pp. 278

Author(s):

YING HAN ◽

CUN-ZHU LIANG ◽

PEI-GUI LIU ◽

JORINDE NUYTINCK ◽

XIANG-HUA WANG

Keyword(s):

New Species ◽

South China ◽

Ex Situ Conservation ◽

Phylogenetic Analyses ◽

Its Region ◽

Morphological Characters ◽

Ex Situ ◽

Dehydrogenase Gene ◽

A New Species

Lactarius sect. Deliciosi is a group of ectomycorrhizal mushrooms showing high host specificity with trees of Pinaceae and more rarely Fagales. A new species of this section, L. guangdongensis, is described from South China. This new species has the smallest basidiocarps (pileus 1–3 cm) in the section. The pure orange basidiocarps with faint greenish discoloration are similar to those of Abies-associated L. abieticola and L. laeticolor and Pinus-associated L. vividus. The subdistant lamellae and absence of pleuromacrocystidia can be used as valid characters for this species. It grows with Chinese national protected plant Pinus kwangtungensis and might be one of the very few species that form symbiosis with five-needle pines. Phylogenetic analyses of the ITS region and glyceraldehyde-3-phosphate dehydrogenase gene (gpd) show that L. guangdongensis clearly diversified from its relatives and look-alikes and probably represents an early diverging lineage in the section. Molecular and morphological characters provided in this study will be useful for in situ and ex situ conservation of P. kwangtungensis in the future.

Download Full-text

First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1

Plant Disease ◽

10.1094/pdis-08-11-0696 ◽

2012 ◽

Vol 96 (3) ◽

pp. 456-456 ◽

Cited By ~ 2

Author(s):

G. Mercado Cárdenas ◽

M. Galván ◽

V. Barrera ◽

M. Carmona

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Staining Procedure ◽

Nuclear Staining ◽

Tobacco Plants ◽

First Report ◽

Target Spot

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text