scholarly journals Geographical range expansion of Nitzschia volvendirostrata Ashworth, Dąbek & Witkowski, 2016 (Bacillariophyta: Bacillariaceae) based on morphological and molecular analysis

2021 ◽  
Vol 14 (1) ◽  
Author(s):  
María Concepción Lora-Vilchis ◽  
Gopal Murugan ◽  
Francisco Omar López-Fuerte

AbstractIn diatoms the use of molecular tools to corroborate traditional (morphological) identification offers a new perspective in the field of biogeography. This manuscript reports the first record of the raphid pennate diatom Nitzschia volvendirostrata along the coast of Mexico, which in turn represents an expansion of the geographic range along the American continent. The cells were isolated from benthic samples taken from Balandra lagoon, La Paz, Baja California Sur, Mexico and cultured as a monoclonal culture. Morphology and morphometry of the diatom obtained from light and electron microscopy reveal that they correspond to the original description of N. volvendirostrata and also its chloroplast sequences, rbcL and psbC, showed 98.7 to 100 % similarity and a close phylogenetic relationship with N. volvendirostrata. The reported places for this taxon show that it has a tropical-temperate biogeographical affinity.

2018 ◽  
Vol 55 (3) ◽  
pp. 256-260 ◽  
Author(s):  
I. Majić ◽  
A. Sarajlić ◽  
T. Lakatos ◽  
T. Tóth ◽  
E. Raspudić ◽  
...  

Summary A survey of entomopathogenic nematodes was conducted in Croatia between 2016 and 2017. The steinernematids were recovered in two out of 100 soil samples from agricultural land characterized as loamy soils with acidic reaction. Molecular and morphological identification was used to distinguish the nematodes. The isolates were identified as two different strains conspecific with Steinernema feltiae. The variations in morphometrical characteristics of infective juveniles (IJs) and males were observed among Croatian strains and with the original description. The analysis of ITS region revealed the greatest similarity of Croatian strains with Slovenian B30 and English A2 strains, which together comprised a monophyletic group in evolutionary analysis. This is the first record of steinernematids, namely S. feltiae in Croatia.


2017 ◽  
Vol 57 (3) ◽  
pp. 23 ◽  
Author(s):  
Pablo Javier Gaudioso ◽  
Germán M. Gasparini ◽  
Rafael Herbst ◽  
Rubén Mario Barquez

The first record of the Neolicaphrium recens Frenguelli, 1921 (Mammalia, Litopterna) from Pleistocene deposits of the Río Dulce, Rio Hondo Department, Santiago del Estero Province, Argentina, is reported. The morphology and morphometry observed in the specimen MPAT073 is coincident with the diagnostic characteristics of that species. This finding represents the northernmost and westernmost record of the species, and thus extends its geographical distribution. Geological data suggest that the material comes from a still unnamed Pleistocene stratigraphic unit.


Zootaxa ◽  
2018 ◽  
Vol 4504 (4) ◽  
pp. 501
Author(s):  
LUCIAN FUSU ◽  
RICHARD R. ASKEW ◽  
ANTONI RIBES

The European species of Calymmochilus Masi (Hymenoptera, Eupelmidae) are revised. Calymmochilus atratus Masi stat. rev. is removed from synonymy under C. subnubilus (Walker) and treated as a valid species. A lectotype is designated for Calymmochilus atratus. The single extant type specimen of Eupelmus subnubilus Walker is considered as lectotype. Calymmochilus bini Fusu sp. n. is described from a single female collected in Sardinia. A female of Calymmochilus russoi Gibson is reported from Spain as a parasitoid in galls of Parapodia sinaica (Frauenfeld) (Lepidoptera, Gelechiidae) on Tamarix (Tamaricaceae), a new national and host record. The species is redescribed and illustrated, this being the first record of the species after its original description. An illustrated key to females and, when known, males of the now six recognized European species of Calymmochilus is given and available biological and distributional data are reviewed. 


Plant Disease ◽  
2012 ◽  
Vol 96 (6) ◽  
pp. 911-911 ◽  
Author(s):  
J. H. Park ◽  
S. E. Cho ◽  
K. S. Han ◽  
H. D. Shin

Rudbeckia hirta L. var. pulcherrima Farw. (synonym R. bicolor Nutt.), known as the black-eyed Susan, is a flowering plant belonging to the family Asteraceae. The plant is native to North America and was introduced to Korea for ornamental purposes in the 1950s. In July 2011, a previously unknown leaf spot was first observed on the plants in a public garden in Namyangju, Korea. Leaf spot symptoms developed from lower leaves as small, blackish brown lesions, which enlarged to 6 mm in diameter. In the later stages of disease development, each lesion was usually surrounded with a yellow halo, detracting from the beauty of the green leaves of the plant. A number of black pycnidia were present in diseased leaf tissue. Later, the disease was observed in several locations in Korea, including Pyeongchang, Hoengseong, and Yangpyeong. Voucher specimens were deposited at the Korea University Herbarium (KUS-F25894 and KUS-F26180). An isolate was obtained from KUS-F26180 and deposited at the Korean Agricultural Culture Collection (Accession No. KACC46694). Pycnidia were amphigenous, but mostly hypogenous, scattered, dark brown-to-rusty brown, globose, embedded in host tissue or partly erumpent, 50 to 80 μm in diameter, with ostioles 15 to 25 μm in diameter. Conidia were substraight to mildly curved, guttulate, hyaline, 25 to 50 × 1.5 to 2.5 μm, and one- to three-septate. Based on the morphological characteristics, the fungus was consistent with Septoria rudbeckiae Ellis & Halst. (1,3,4). Morphological identification of the fungus was confirmed by molecular data. Genomic DNA was extracted using the DNeasy Plant Mini DNA Extraction Kit (Qiagen Inc., Valencia, CA.). The internal transcribed spacer (ITS) region of rDNA was amplified using the ITS1/ITS4 primers and sequenced. The resulting sequence of 528 bp was deposited in GenBank (Accession No. JQ677043). A BLAST search showed that there was no matching sequence of S. rudbeckiae; therefore, this is the first ITS sequence of the species submitted to GenBank. The ITS sequence showed >99% similarity with those of many Septoria species, indicating their close phylogenetic relationship. Pathogenicity was tested by spraying leaves of three potted young plants with a conidial suspension (2 × 105 conidia/ml), which was harvested from a 4-week-old culture on potato dextrose agar. Control leaves were sprayed with sterile water. The plants were covered with plastic bags to maintain 100% relative humidity (RH) for the first 24 h. Plants were then maintained in a greenhouse (22 to 28°C and 70 to 80% RH). After 5 days, leaf spot symptoms identical to those observed in the field started to develop on the leaves inoculated with the fungus. No symptoms were observed on control plants. S. rudbeckiae was reisolated from the lesions of inoculated plants, confirming Koch's postulates. A leaf spot disease associated with S. rudbeckiae has been reported on several species of Rudbeckia in the United States, Romania, and Bulgaria (1–4). To our knowledge, this is the first report of leaf spot on R. hirta var. pulcherrima caused by S. rudbeckiae in Korea. References: (1) J. B. Ellis and B. D. Halsted. J. Mycol. 6:33, 1890. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ February 2, 2012. (3) E. Radulescu et al. Septoriozele din Romania. Ed. Acad. Rep. Soc. Romania, Bucuresti, Romania, 1973. (4) S. G. Vanev et al. Fungi Bulgaricae 3:1, 1997.


Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1019-1019 ◽  
Author(s):  
Y. F. Wang ◽  
S. Xiao ◽  
Y. K. Huang ◽  
X. Zhou ◽  
S. S. Zhang ◽  
...  

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.


Biotemas ◽  
2009 ◽  
Vol 22 (4) ◽  
pp. 251
Author(s):  
Fabio Wiggers ◽  
Inga Veitenheimer-Mendes

http://dx.doi.org/10.5007/2175-7925.2009v22n4p251After 35 years of its original description, Rissoa cruzi Castellanos & Fernández, 1974 is first recorded in southern Brazilian waters. An analysis of both shell and radular characteristics indicated that R. cruzi does not conform to its current generic assignment. Based on shell characters, R. cruzi is placed in the genus Alvania Risso, 1826. A comparison with other rissoids from the same region is also provided.


Phytotaxa ◽  
2017 ◽  
Vol 319 (1) ◽  
pp. 84 ◽  
Author(s):  
XUDONG LIU ◽  
HUAN ZHU ◽  
BENWEN LIU ◽  
GUOXIANG LIU ◽  
ZHENGYU HU

The genus Nephrocytium Nägeli is a common member of phytoplankton communities that has a distinctive morphology. Its taxonomic position is traditionally considered to be within the family Oocystaceae (Trebouxiophyceae). However, research on its ultrastructure is rare, and the phylogenetic position has not yet been determined. In this study, two strains of Nephrocytium, N. agardhianum Nägeli and N. limneticum (G.M.Smith) G.M.Smith, were identified and successfully cultured in the laboratory. Morphological inspection by light and electron microscopy and molecular phylogenetic analyses were performed to explore the taxonomic position. Ultrastructure implied a likely irregular network of dense and fine ribs on the surface of the daughter cell wall that resembled that of the genus Chromochloris Kol & Chodat (Chromochloridaceae). Phylogenetic analyses revealed that Nephrocytium formed an independent lineage in the order Sphaeropleales (Chlorophyceae) with high support values and a close phylogenetic relationship with Chromochloris. Based on combined morphological, ultrastructural and phylogenetic data, we propose a re-classification of Nephrocytium into Sphaeropleales, sharing a close relationship with Chromochloris.


2012 ◽  
Vol 49 (3) ◽  
pp. 187-188
Author(s):  
E. Dzika

AbstractOctomacrum europaeum (Monogenea: Octomacridae) was collected, for the first time in north-eastern Europe, from the gills of spirlin (Alburnoides bipunctatus). Morphometric characters were compared with those of other populations and conform to the original description of the species.


2020 ◽  
Vol 60 ◽  
pp. e20206021
Author(s):  
Guilherme Seiji Hocama ◽  
Fernanda De Oliveira Martins ◽  
Francisco Severo-Neto

Cascudinhos are a group of small benthic fishes included in the Hypoptopomatinae subfamily, inhabiting small to moderate streams and rivers within the Neotropical region, from Venezuela to Northern Argentina. Until now, Otothyropsis piribebuy originally described from the rio Paraguay basin, in Paraguay, is the only species of the genus not recorded in Brazil. Recent samples in the rio Tererê, rio Paraguay basin, Brazil, revealed a population of Otothyropsis with uncertain taxonomic identity. Therefore, the study aimed to unveil the distribution of Otothyropsis within Brazilian territory. External morphology, osteology, measurements, and counts (plates, teeth, and rays) of these specimens from rio Tererê were compared to data from the original description of O. piribebuy, and also with specimens of O. piribebuy sampled in Paraguayan territory. Observations indicated no differences among the analyzed specimens. Furthermore, a Principal Component Analysis (PCA), carried out using log-transformed measures from Brazilian and Paraguayan specimens, showed no separation of these populations, also indicating that all analyzed specimens pertain to the same species. Based on this, a prediction map of distribution, using Maximum Entropy, was produced. The correct identification of spatial range of occurrence is an essential step to ensure the conservation of species, and the extended distribution of Otothyropsis piribebuy was confirmed, enhancing the list of neotropical fish from Brazil.


Zootaxa ◽  
2017 ◽  
Vol 4273 (3) ◽  
pp. 431 ◽  
Author(s):  
DIEGO GALLEGO ◽  
JOSÉ LUIS LENCINA ◽  
HUGO MAS ◽  
JULIA CEVERÓ ◽  
MASSIMO FACCOLI

The Granulate Ambrosia Beetle Xylosandrus crassiusculus, an alien species of Asian origin, was recorded for first time in the Iberian Peninsula. Many specimens were collected in October 2016 in the Valencia region (Spain) from infested carob trees. The species is included in the EPPO Alert List as causing serious damage in many Mediterranean regions. A key for the morphological identification of the Xylosandrus species occurring in Europe is also reported. 


Sign in / Sign up

Export Citation Format

Share Document