Freshwater and Terrestrial Algae from Ny-Ålesund and Blomstrandhalvøya Island (Svalbard)

The egg parasitpoids Trichogrammadanausicida (Nagaraja) and Trichogrammacacaeciae (Marchal) (Hymenoptera: Trichogrammatidae), are reported for the first time in Israel. Moreover, our discovery of T.danausicida is the first report of this parasitoid species outside of India. The occurrence of those trichogrammatids was first discovered and documented in May 2016 during a survey of egg parasitoids of the False codling moth Thaumatotibialeucotreta (Lepidoptera: Tortricidae). The field survey was conducted on castor bean fruits (Ricinuscommunis) in the Israeli central coastal plain. The identity of the parasitoids was revealed by means of sequencing a portion of the cytochrome oxidase I gene (COI) of the studied parasitoids.

Download Full-text

Preliminary data on the aquatic invertebrate fauna of the Ma River, Thanh Hoa province

Journal of Vietnamese Environment ◽

10.13141/jve.vol6.no3.pp220-226 ◽

2014 ◽

Vol 6 (3) ◽

pp. 220-226

Author(s):

Xuan Nam Ngo ◽

Quoc Huy Nguyen ◽

Nguyen Hang Nguyen ◽

Thi Diep Pham ◽

Trong Hoang Mai ◽

...

Keyword(s):

Aquatic Invertebrates ◽

Field Survey ◽

Multivariable Analysis ◽

Aquatic Invertebrate ◽

Species Number ◽

Invertebrate Fauna ◽

Significant Relation ◽

The North ◽

Freshwater Habitats ◽

Data Book

A field survey for the invertebrate fauna conducted in the Ma River, Thanh Hoa province in 2013. The research applied multivariable analysis performed by the Primer v.6 software, such as CLUSTER, one-way ANOSIM, BEST and DIVERSE. The results showed a list of 138 aquatic invertebrate species. Of these, most were freshwater wide-distributing species coupled with others characterized for brackish and marine waters. The biodiversity status was quite high compared to several other rivers in the North of Vietnam. The list contained many economic-valued species and 2 of these were listed in the Red Data Book of Vietnam. The aquatic invertebrates showed a significant relation to the two different combinations of physiochemical factors for zooplanktons and zoobenthos, respectively. The values of the species number, abundance and Shannon-Weiner index for both of zooplanktons and zoobenthos showed a curved trend from the upper river segments to lower river segments. These figures for zooplanktons peaked in the middle river segments, whereas the numbers for zoobenthos achieved the highest numbers in the estuaries. The species composition of the estuaries differentiated significantly from that of other freshwater habitats. Năm 2013 đã tiến hành một đợt điều tra khu hệ động vật không xương sống sông Mã, tỉnh Thanh Hóa. Nghiên cứu sử các phân tích đa biến thông qua phần mền Primer v.6, bao gồm: CLUSTER, one-way ANOSIM, BEST và DIVERSE. Kết quả phân tích thu được 138 loài với thành phần loài chủ yếu là những loài nước ngọt thường gặp và phân bố rộng, ngoài ra còn có các loài đặc trưng cho nước lợ và mặn. Trong số các loài thu được, nhiều loài có giá trị kinh tế và 2 loài có tên trong Sách Đỏ Việt Nam. Khu hệ động vật không xương sống sông Mã có quan hệ chặt với hai nhóm chỉ số thủy lý hóa học khác nhau, tương ứng cho động vật nổi và động vật đáy. Giá trị các chỉ số sinh học gồm số lượng loài, mật độ và Shannon-Weiner hồi quy theo đường cong phi tuyến từ thượng lưu tới hạ lưu; đạt giá trị cao nhất tại cửa sông đối với động vật đáy và vùng trung lưu với động vật nổi. Thành phần loài cửa sông khác biệt rõ rệt với thành phần loài các sinh cảnh nước ngọt khác.

Download Full-text

First Report of Tomato yellow leaf curl virus Infecting Pepper Plants in Cuba

Plant Disease ◽

10.1094/pdis.2002.86.1.73a ◽

2002 ◽

Vol 86 (1) ◽

pp. 73-73 ◽

Cited By ~ 21

Author(s):

M. Quiñones ◽

D. Fonseca ◽

Y. Martinez ◽

G. P. Accotto

Keyword(s):

Field Survey ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Chain Reaction ◽

Tomato Production ◽

First Report ◽

Polymerase Chain ◽

Leaf Curl Virus ◽

Pepper Plants ◽

Leaf Curl

The begomovirus Tomato yellow leaf curl virus (TYLCV) is one of the major threats to tomato production in tropical and subtropical regions worldwide. TYLCV was found in Cuba in 1994 and later became the most serious constraint to tomato production (2). During a field survey in 2001, pepper plants (Capsicum annuum) were observed in a greenhouse in Camagüey Province, showing mild interveinal yellowing and curling of leaves. Total nucleic acids were extracted from these plants and from pepper samples collected in previous years that showed similar symptoms. Polymerase chain reaction (PCR) was performed on extracts using a primer pair (TY-1/TY-2) (1) specific for the capsid protein (CP) gene of begomoviruses and a second primer pair (IR2353+: CTGAATGTTTGGATGGAAATGTGC; IR255-:GCTCGTAAGTTTCCT CAACGGAC) designed to amplify the part of the genome encompassing the intergenic region (IR) of the Cuban isolate of TYLCV-IS (2). With these primer pairs, amplicons of the expected size were obtained from five samples (one collected in 1995 in Havana Province, two in 1999 in Sancti Spiritus, and two in 2001 in Camagüey.) The CP fragment was digested with RsaI, while the IR amplicon was digested with AvaII and EcoRI. In all cases the patterns obtained corresponded to digestion patterns for identical PCR fragments obtained from TYLCV-infected tomatoes. The IR amplicon sequence from one sample showed ≈99% identity with the corresponding region of the TYLCV-IS isolated from tomato in Cuba. To our knowledge, this is the first report of TYLCV-IS infection in peppers in Cuba. References: (1) G. P. Accotto et al. Eur. J. Plant. Pathol. 106:179, 2000. (2) Y. Martínez et al. J. Phytopathol.144:277, 1996.

Download Full-text

FIRST REPORT OF Begomovirus INFECTION ON PAPAYA IN BENGKULU, INDONESIA

JURNAL HAMA DAN PENYAKIT TUMBUHAN TROPIKA ◽

10.23960/jhptt.12149-55 ◽

2021 ◽

Vol 21 (1) ◽

pp. 49-55

Author(s):

Mimi Sutrawati ◽

Parwito Parwito ◽

Priyatiningsih ◽

Agustin Zarkani ◽

Sipriyadi ◽

...

Keyword(s):

Field Survey ◽

Virus Disease ◽

Control Strategies ◽

Dna Fragments ◽

Universal Primer ◽

First Report ◽

Activator Protein ◽

Begomovirus Infection ◽

Possible Cause ◽

Identification And Characterization

First report of Begomovirus infection on papaya in Bengkulu, Indonesia. A field survey was conducted during 2019, wefound a severe systemic yellow mosaic, striped green mosaic on leaves petiole, green spots on the fruit of papaya, leafmalformation, and stunting symptoms on three papaya cultivation area in Rejang Lebong, Kepahiang, Bengkulu Tengah, andSeluma, Bengkulu Province, Indonesia. A begomo-like virus was inferred to be the possible cause of the virus-disease-likesymptoms. The study aimed to identify the causal of those typical symptoms on papaya. PCR using universal primer fortranscriptional activator protein (TrAp) and replication-associated protein (Rep) gene of Begomovirus successfully amplifiedthe DNA fragments of 900 bp in all 10 detected samples, except for samples with leaf malformation and stunting symptoms. Itis indicating that those typical symptoms on papaya is associated with Begomovirus infection, while the causal of leafmalformation and stunting is unknown yet. This work is the first report of Begomovirus infected papaya in Indonesia. Severedisease incidence caused by this pathogen was observed on papaya plants in Bengkulu Province that was in the range of 42–100%. This finding is a precious information to be used for identification, and characterization the species of the virus,determining control strategies against the disease.

Download Full-text

Reproductive features of Pisidium casertanum (Poli, 1791) (Bivalvia: Sphaeriidae) in relict lakes of Bolshezemelskaya Tundra

Arctic Environmental Research ◽

10.3897/issn2541-8416.2019.19.3.113 ◽

2019 ◽

Vol 19 (3) ◽

pp. 113-122 ◽

Cited By ~ 1

Author(s):

YuV Bespalaya ◽

OV Aksenova ◽

AS Aksenov ◽

SE Sokolova ◽

AR Shevchenko ◽

...

Keyword(s):

Breeding Season ◽

Shell Length ◽

Brood Size ◽

Positive Relationship ◽

High Arctic ◽

Asynchronous Development ◽

Single Period ◽

Freshwater Habitats

The reproductive features of the pea clam Pisidium casertanum in relict lakes of Bolshezemelskaya Tundra were studied. The P. casertanum population in the Vashutkiny Lakes of Bolshezemelskaya Tundra has a single period of summer reproduction. We suppose that the release of embryos mainly occurs between July and August and the breeding season could probably begin in May-June. The positive relationship between brood size and parent shell length was detected. We did not find a specific brooding mechanism, accompanied by asynchronous development and release of embryos by the parent in the population of P. casertanum in the Vashutkiny Lakes. The reason for this is probably related with the environmentally more stable freshwater habitats of the relict Vashutkiny Lakes in comparison with the lakes of the High Arctic.

Download Full-text

Unusual Stylar-End Breakdown and Sour Rot on Key Lime (Citrus aurantiifolia) in Pre-Harvest Condition in Italy

Plants ◽

10.3390/plants10050989 ◽

2021 ◽

Vol 10 (5) ◽

pp. 989

Author(s):

Giorgio Gusella ◽

Alberto Fiorenza ◽

Dalia Aiello ◽

Giancarlo Polizzi

Keyword(s):

Environmental Conditions ◽

Field Survey ◽

Physiological Disorder ◽

First Report ◽

Post Harvest ◽

Agronomic Practices ◽

Sour Rot ◽

Key Lime ◽

Citrus Aurantiifolia ◽

Citrus Spp

Key lime (Citrus aurantiifolia) is an emerging crop in Italy, especially in the Southern regions, where the environmental conditions are suitable for its cultivation. A field survey in Sicily in a commercial orchard of Key lime revealed the widespread presence of water-soaked spots and sunken/dry lesions at the stylar-end, mainly in pre-harvest condition. Water-soaked spots were attributed to Geotrichum citri-aurantii, an agent of sour rot on Citrus spp., whereas the sunken/dry lesion was attributed to the physiological disorder known as stylar-end breakdown. Sour rot and stylar-end breakdown are usually considered post-harvest diseases and rarely found in the field on fruit still attached to the tree. Although Geotrichum citri-aurantii is not responsible for the stylar-end breakdown, its association with this alteration reveals the importance of the environmental conditions and the agronomic practices in diseases/disorders development. In addition, to our knowledge, this is the first report of Geotrichum citri-aurantii on Key lime in Europe.

Download Full-text

First Report of Passerilepis parina (Cestoda: Hymenolepididae) from Parus major in Iran: A Probable Fatal Case Due to Hyperin-fection

Iranian Journal of Parasitology ◽

10.18502/ijpa.v16i3.7107 ◽

2021 ◽

Author(s):

Sina Mohtasebi ◽

Aref Teimouri ◽

Mohammad Javad Abbaszadeh Afshar ◽

Hamed Abbasian ◽

Iraj Mobedi ◽

...

Keyword(s):

Field Survey ◽

Fatal Case ◽

Morphological Characteristics ◽

Parus Major ◽

Great Tit ◽

Camera Lucida ◽

First Report ◽

First Time

Cestodes are important parasites that can affect the health of humans and wildlife. Among these, the genus Passerilepis is an important endoparasite of Passeriform birds while poorly studied in Iran. During a parasitological field survey in central parts of Iran in 2018, thirty-two cestodes, as an obstructive intertwined mass, recovered from the intestine of a recently dead Parus major (great tit). Morphological characteristics of recovered cestodes were drawn carefully by a camera lucida equipped microscope and identification was carried out using standard keys. All of the collected cestodes were identified as P. parina. In the current study, we recorded P. parina from great tit for the first time in Iran.

Download Full-text

First report of Trichogramma danausicida and Trichogramma cacaeciae reared from Thaumatotibia leucotreta eggs in Israel

ZooKeys ◽

10.3897/zookeys.779.25674 ◽

2018 ◽

Vol 779 ◽

pp. 19-25

Author(s):

Roy Kaspi ◽

Svetlana Kontsedalov ◽

Murad Ghanim

Keyword(s):

Coastal Plain ◽

Field Survey ◽

Codling Moth ◽

Parasitoid Species ◽

First Report ◽

Thaumatotibia Leucotreta ◽

False Codling Moth ◽

Gene Coi ◽

First Time ◽

I Gene

The egg parasitpoids Trichogrammadanausicida (Nagaraja) and Trichogrammacacaeciae (Marchal) (Hymenoptera: Trichogrammatidae), are reported for the first time in Israel. Moreover, our discovery of T.danausicida is the first report of this parasitoid species outside of India. The occurrence of those trichogrammatids was first discovered and documented in May 2016 during a survey of egg parasitoids of the False codling moth Thaumatotibialeucotreta (Lepidoptera: Tortricidae). The field survey was conducted on castor bean fruits (Ricinuscommunis) in the Israeli central coastal plain. The identity of the parasitoids was revealed by means of sequencing a portion of the cytochrome oxidase I gene (COI) of the studied parasitoids.

Download Full-text

First Report of Orobanche aegyptiaca Parasitism on Sesame in Iran

Plant Disease ◽

10.1094/pdis-01-12-0068-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1232-1232 ◽

Cited By ~ 4

Author(s):

M. Teimoury ◽

H. Karimmojeni ◽

M. H. Ehtemam ◽

H. R. Mehri

Keyword(s):

Field Survey ◽

Yield Losses ◽

Average Yield ◽

Trap Crop ◽

College Of Agriculture ◽

First Report ◽

Air Temperatures ◽

University Of Technology ◽

Average Maximum ◽

Orobanche Aegyptiaca

A field survey revealed infestations of broomrape, Orobanche aegyptiaca (syn. Phelipanche aegyptiaca), on sesame (Sesamum indicum L.) plants in the province of Khorasan (36°12'N, 57°39'E, 972 m above sea level) in northeastern Iran in November 2011. About 5% of total sesame fields in this area were infested, and the estimated average yield losses were approximately 30 to 40%. The annual mean air temperature and the average maximum and minimum air temperatures were 17.5, 24.2, and 10.6°C, respectively. In a pot experiment that was also conducted at the Isfahan University of Technology to study the effect of sesame as a trap crop for managing broomrape, a total of 20 genotypes of sesame were infested with broomrape. The infestation of sesame was confirmed by verifying the attachment of the broomrape to the sesame roots. Broomrape plant heights were between 20 and 35 cm, with flowering stems 15 to 20 cm. The stems were erect, usually branched, slender, glandular-pubescent, pale yellowish, and inflorescent rather than lax. Flowers had one bract and two bracteoles. The bracts measured 6 to 8 mm, had ovate lanceolates shorter than the calyces, and filiform, lanceolate bracteoles measuring 8 mm. The calyces measured 10 to 11 mm, and were gamosepalous, entire, whitish, hairy, and glandular. Corollas measured 32 to 35 mm, and were blue violet or sky blue with darker veins and cream proximally, straight or slightly curved, conspicuously infundibuliform in distal parts, and glandular-pubescent with two lips. Stamens were epipetalous, inserted 4 to 5 mm above the corolla base, with filaments hairy below, sparsely so above; anthers were villous or spidery hairy along sutures. Stigma lobes were white. The Botanists Group of the College of Agriculture of IUT confirmed the plants' identity. Sesame has been mentioned before as a trap crop for broomrape (1); however, to our knowledge, this is the first report of broomrape parasitism on sesame in Iran. Reference: (1) B. M. Chittapur et al. Allelopathy J. 8:147, 2001.

Download Full-text

S202013 Field Survey on Two-Wheeled Oxcart in Turkey : First Report : At Efes Muzesi

The Proceedings of Mechanical Engineering Congress Japan ◽

10.1299/jsmemecj.2013._s202013-1 ◽

2013 ◽

Vol 2013 (0) ◽

pp. _S202013-1-_S202013-5

Author(s):

Masanori OGATA ◽

Hiroshi IKEMORI ◽

Ichiro TSUTSUMI

Keyword(s):

Field Survey ◽

First Report

Download Full-text