scholarly journals In silico approach to understand epigenetics of POTEE in ovarian cancer

2021 ◽  
Vol 0 (0) ◽  
Author(s):  
Sahar Qazi ◽  
Khalid Raza
Keyword(s):  
Ovarian Cancer ◽  
Enrichment Analysis ◽  
Epigenetic Changes ◽  
High Confidence ◽  
Model Stability ◽  
The Third ◽  
Epigenetic Analysis ◽  
Predicted Model ◽  
Residual Stretch ◽  
Very High

Abstract Ovarian cancer is the third leading cause of cancer-related deaths in India. Epigenetics mechanisms seemingly plays an important role in ovarian cancer. This paper highlights the crucial epigenetic changes that occur in POTEE that get hypomethylated in ovarian cancer. We utilized the POTEE paralog mRNA sequence to identify major motifs and also performed its enrichment analysis. We identified 6 motifs of varying lengths, out of which only three motifs, including CTTCCAGCAGATGTGGATCA, GGAACTGCC, and CGCCACATGCAGGC were most likely to be present in the nucleotide sequence of POTEE. By enrichment and occurrences identification analyses, we rectified the best match motif as CTTCCAGCAGATGT. Since there is no experimentally verified structure of POTEE paralog, thus, we predicted the POTEE structure using an automated workflow for template-based modeling using the power of a deep neural network. Additionally, to validate our predicted model we used AlphaFold predicted POTEE structure and observed that the residual stretch starting from 237-958 had a very high confidence per residue. Furthermore, POTEE predicted model stability was evaluated using replica exchange molecular dynamic simulation for 50 ns. Our network-based epigenetic analysis discerns only 10 highly significant, direct, and physical associators of POTEE. Our finding aims to provide new insights about the POTEE paralog.

Monte Carlo Algorithms for Moments of Transition Arrays

1988 ◽  
Vol 102 ◽  
pp. 79-81
Author(s):  
A. Goldberg ◽  
S.D. Bloom
Keyword(s):  
Monte Carlo ◽  
State Vector ◽  
Basis Vector ◽  
Collective State ◽  
Dispersion Characteristics ◽  
Dipole Strength ◽  
The Third ◽  
Monte Carlo Algorithms ◽  
Third Moment ◽  
Very High

AbstractClosed expressions for the first, second, and (in some cases) the third moment of atomic transition arrays now exist. Recently a method has been developed for getting to very high moments (up to the 12th and beyond) in cases where a “collective” state-vector (i.e. a state-vector containing the entire electric dipole strength) can be created from each eigenstate in the parent configuration. Both of these approaches give exact results. Herein we describe astatistical(or Monte Carlo) approach which requires onlyonerepresentative state-vector |RV> for the entire parent manifold to get estimates of transition moments of high order. The representation is achieved through the random amplitudes associated with each basis vector making up |RV>. This also gives rise to the dispersion characterizing the method, which has been applied to a system (in the M shell) with≈250,000 lines where we have calculated up to the 5th moment. It turns out that the dispersion in the moments decreases with the size of the manifold, making its application to very big systems statistically advantageous. A discussion of the method and these dispersion characteristics will be presented.

La experiencia del prácticum en educación infantil. Una narración en primera persona

2019 ◽  
pp. 60-76
Author(s):  
Victor Amar
Keyword(s):  
Early Childhood ◽  
Teacher Training ◽  
Early Childhood Education ◽  
Professional Growth ◽  
Childhood Education ◽  
The Third ◽  
Formative Experience ◽  
Narrative Methodology ◽  
Very High

The chances of success of the internship in early childhood education, which takes place in the third degree, are very high. However, there may be circumstances that may befall the teacher-training student, which in a way turn the formative experience into a pretext for personal and professional growth. In order to know and understand its practice, we use narrative methodology. It is the most suitable way we have found to share his voice, giving him epistemological authority and being a pretext to improve from his experience. Her words lead us to understand that she wants to be a teacher, and that she learns in any situation, even though her tutor is in a context and with a very particular reality. The conclusion is in continuous construction as the student has learned, disapproved and reappeared with the practice; from being a student of practice to becoming one in practice.

Effect of the Stages of Floral Development and Postharvest Temperatures to Flowering of Eremurus in Israel

HortScience ◽  
1998 ◽  
Vol 33 (3) ◽  
pp. 536d-536
Author(s):  
Rina Kamenetsky
Keyword(s):  
Morphological Analysis ◽  
Developmental Disorder ◽  
Floral Development ◽  
The Third ◽  
Initial Stage ◽  
Floral Differentiation ◽  
Soil Temperatures ◽  
Very High ◽  
Development Application ◽  
Flowering Process

The influence of postharvest temperature on the flowering response of Eremurus was studied. The plants were harvested at four different stages of development and were separated into three groups. The first group was immediately exposed to 2 °C, the second group to 20 °C followed by 2 °C, and the third group to 20 °C followed by 32 °C and, subsequently, 2 °C. Scanning electron microscopy (SEM) was used for concurrent morphological analysis of floral development. Application of 2 °C to the plants in the initial stage of floral development caused plant destruction and death, while the same treatment applied at the stage of full differentiation promoted normal flowering. Temperatures of 20 °C and, especially, 32 °C, significantly improved flowering of the plants harvested in the early stages of florogenesis, whereas the same treatment applied to the plants harvested at the end of flower differentiation did not affect the flowering process. A developmental disorder, which we term “Interrupted Floral Development” (IFD), was observed only in the plants harvested when the racemes were fully differentiated. This was probably caused by the very high air and soil temperatures that prevail in Israel during the summer. The extent of floral differentiation has a determinant role in subsequent scape elongation and flowering.

Mutations Causing Constitutive Invertase Synthesis in Yeast: Genetic Interactions with snf Mutations

Genetics ◽  
1987 ◽  
Vol 115 (2) ◽  
pp. 247-253
Author(s):  
Lenore Neigeborn ◽  
Marian Carlson
Keyword(s):  
Regulatory Region ◽  
Constitutive Expression ◽  
Genetic Interactions ◽  
The Third ◽  
Recessive Mutations ◽  
Constitutive Mutation ◽  
Complementation Groups ◽  
High Level ◽  
Yeast Genetic ◽  
Very High

ABSTRACT We have selected 210 mutants able to grow on sucrose in the presence of 2-deoxyglucose. We identified recessive mutations in three major complementation groups that cause constitutive (glucose-insensitive) secreted invertase synthesis. Two groups comprise alleles of the previously identified HXK2 and REG1 genes, and the third group was designated cid1 (constitutive invertase derepression). The effect of cid1 on SUC2 expression is mediated by the SUC2 upstream regulatory region, as judged by the constitutive expression of a SUC2-LEU2-lacZ fusion in which the LEU2 promoter is under control of SUC2 upstream sequences. A cid1 mutation also causes glucose-insensitive expression of maltase. The previously isolated constitutive mutation ssn6 is epistatic to cid1, reg1 and hxk2 for very high level constitutive invertase expression. Mutations in SNF genes that prevent derepression of invertase are epistatic to cid1, reg1 and hxk2; we have previously shown that ssn6 has different epistasis relationships with snf mutations. The constitutive mutation tup1 was found to resemble ssn6 in its genetic interactions with snf mutations. These findings suggest that CID1, REG1 and HXK2 are functionally distinct from SSN6 and TUP1.

Effect of phenology on agonistic competitive interactions between invasive and native sheet-web spiders

2016 ◽  
Vol 94 (6) ◽  
pp. 427-434 ◽  
Author(s):  
Jeremy D. Houser ◽  
Adam H. Porter ◽  
Howard S. Ginsberg ◽  
Elizabeth M. Jakob
Keyword(s):  
Competitive Advantage ◽  
Native Species ◽  
Negative Impact ◽  
Relative Size ◽  
Agonistic Interactions ◽  
Resident Species ◽  
The Third ◽  
Linyphia Triangularis ◽  
Size Interaction ◽  
Very High

The phenologies of introduced relative to native species can greatly influence the degree and symmetry of competition between them. The European spider Linyphia triangularis (Clerck, 1757) (Linyphiidae) reaches very high densities in coastal Maine (USA). Previous studies suggest that L. triangularis negatively affects native linyphiid species, with competition for webs as one mechanism. We documented phenological differences between L. triangularis and three native species that illustrate the potential for the reversal of size-based competitive advantage over the course of the year. To test whether relative size influences interaction outcome, we allowed a resident spider to build a web and then introduced an intruder. We examined whether the outcomes of agonistic interactions over the webs were influenced by the species of the resident (invasive or native), the relative size of the contestants, and the species × size interaction. We found that the importance of relative size differed among species. In interactions between L. triangularis and each of two native species, size played a greater role than resident species on the outcome of interactions, suggesting that competitive advantage reverses over the season based on phenology-related size differences. Linyphia triangularis had a negative impact on the third species regardless of relative size.

Epigenetic Mechanism and Survival Prognosis Analysis of Serum Exosomes from Ovarian Cancer Patients based on Sequencing Technology and Bioinformatics

2021 ◽  
Author(s):  
Li Xia ◽  
Huang He
Keyword(s):  
Ovarian Cancer ◽  
Cancer Patients ◽  
Target Genes ◽  
Epigenetic Modification ◽  
Gene Prediction ◽  
Enrichment Analysis ◽  
Differentially Expressed ◽  
Survival Prognosis ◽  
Signaling Axis ◽  
Serum Exosomes

Abstract Backguound: To screen the signaling axis of epigenetic modification in serum exosomes of ovarian cancer patients based on sequencing technology and raw signal analysis, in depth study of the potential mechanism of action of ovarian cancer, prediction of potential therapeutic targets and survival prognosis analysis of potential targets.Methods: Serum exosomes from three ovarian cancer patients were selected as the experimental group, and serum exosomes from three uterine fibroid patients as the control group, and whole transcriptome of serum exosomes was performed to obtain differentially expressed lncRNA and mRNA in ovarian cancer,The miRcode database and miRNA target gene prediction website were used to predict the target genes, Cytoscape software was used to draw a ceRNA network model of epigenetic modification of ovarian cancer serum exosomes, and the R language was used for GO and KEGG enrichment analysis of the target genes. Finally, the TCGA website was used to download clinical and expression data related to ovarian cancer, and the common potential target genes obtained in the previous period were analyzed for survival。Results: A total of 117 differentially expressed lncRNAs as well as 513 differentially expressed mRNAs (P < 0.05, |log2 FC|≥ 1.0) were obtained by combining sequencing data and raw signal analysis, and 841 predicted target genes were reciprocally mapped by combining mircode database and miRNA target gene prediction website, resulting in 11 potential target genes related to ovarian cancer (FGFR3, BMPR1B, TRIM29, FBN2, PAPPA, CCDC58, IGSF3, FBXO10, GPAM, HOXA10, LHFPL4), and survival prognosis analysis of the above 11 target genes revealed that the survival curve was statistically significant (P < 0.05) for HOXA10 only genes, but not for the other genes, and through enrichment analysis, we found that the above target genes were mainly involved in biological processes such as regulation of transmembrane receptor protein kinase activity, structural molecule activity with elasticity, transforming growth factor - activated receptor activity, and GABA receptor binding, and were mainly enriched in signaling pathways regulating stem cell pluripotency, bladder cancer, glycerolipid metabolism, central carbon metabolism of cancer, tyrosine stimulation to EGFR in signaling pathways such as resistance to enzyme inhibitors.Conclusions: The serum exosomal DIO3OS-hsa-miR-27a-3p-HOXA10 epigenetic modification signaling axis affects ovarian cancer development and disease survival prognosis by targeting transcriptional dysregulation pathways in cancer.

scholarly journals Efficacy of auriculotherapy for the reduction of stress in nursing students: a randomized clinical trial

2012 ◽  
Vol 20 (4) ◽  
pp. 727-735 ◽  
Author(s):  
Juliana Miyuki do Prado ◽  
Leonice Fumiko Sato Kurebayashi ◽  
Maria Júlia Paes da Silva
Keyword(s):  
Clinical Trial ◽  
Nursing Students ◽  
Sham Group ◽  
School Of Nursing ◽  
The Third ◽  
Stress Symptoms ◽  
Single Blind ◽  
Very High ◽  
Single Blind Trial

This study is a randomized single-blind trial, which aimed to evaluate the efficacy of true auriculotherapy and placebo auriculotherapy in reducing the stress levels of mid-level Nursing students of the School of Nursing of the Beneficência Portuguesa Hospital. Seventy-one students with average, high and very high scores, according to Vasconcellos' List of Stress Symptoms, were divided into three groups: Control (25), Auriculotherapy (24), and Placebo/Sham (22). They were evaluated at the baseline, 8th and 12th sessions and at the follow-up (15 days) and received Shen Men and Brainstem points (Auriculotherapy Group) and Wrist and Outer Ear points (Placebo/Sham Group). The analysis of variance (ANOVA) showed statistically significant differences between the Control/Auriculotherapy groups from the 8th session, which was maintained in the third and fourth evaluations (p=0.000) and between the Control/Placebo groups (p<0.05) at the three evaluations. It was concluded that the true auriculotherapy obtained better responses (45.39%) than the placebo (34.18%) in the reduction of the stress, but further studies are recommended for the re-evaluation of the sham points for stress. ClinicalTrials.gov Identifier: NCT01420848.

Experiments on the Effect of Residual Insecticides in Houses against Anopheles gambiae and A. funestus

1953 ◽  
Vol 44 (2) ◽  
pp. 231-254 ◽  
Author(s):  
G. Davidson
Keyword(s):  
Lethal Dose ◽  
Significant Proportion ◽  
Internal Surface ◽  
The Other ◽  
Wall Surface ◽  
The Third ◽  
Experimental Huts ◽  
Wettable Powder ◽  
Window Traps ◽  
Very High

Experimental huts similar in construction to the dwellings commonly used in East Africa, but with exit window traps, were sprayed with various formulations of the three residual insecticides, DDT, BHC, and dieldrin, and the effect on the A. gambiae and A. funestus entering them was observed.The almost complete absence of kill recorded by Muirhead Thomson (1950) in experiments in similar huts in Tanganyika treated with DDT Ditreen was not confirmed by these experiments.A significant proportion of the A. gambiae and A. funestus entering huts treated with DDT did, however, escape unharmed, even immediately after treatment, whereas with the other insecticides, BHC and dieldrin, none of these mosquitos escaped the effect at least in the first month after treatment.In preliminary experiments in which observations were carried on for nine months after treatments, BHC P.530 still showed some effect after seven months. This was almost certainly due to the fumigant effect of the small amount of insecticide still remaining below the wall surface. The irritant properties of the two DDT formulations, Ditreen and the oil-bound suspension “Supona” D, still existed after nine months.In a second group of experiments, dosages of less than 80 mg. DDT and less than 60 mg. BHC (8 mg. of the gamma isomer) per sq. ft. gave over 50 per cent. kills of A. gambiae and A. funestus for only one month.In a third group of experiments, using two formulations of BHC, five of DDT, one of a mixture of DDT and BHC and one of dieldrin:—(a) Dieldrin was by far the most efficient insecticide and gave very high kills for over seven months.(b) The DDT formulations, Murphy paste, Murphy wettable powder, suspensions of DDT crystals <30 μ and 30–70 μ in diameter, when applied to the whole internal surface of the huts, produced fairly high kills over the period of the observations (six to seven months), but significant proportions of the mosquitos escaped their action even immediately after treatment.(c) The BHC formulations, P.520 and the oil-bound suspension “Supona” B, gave high kills for three to four months only.(d) The mixture of BHC and DDT in oil-bound suspension “Supona” DB gave the high initial kill of BHC and the long-lasting moderately high kill of DDT.(e) Against C. fatigans all the DDT formulations used in the third group of experiments gave very low kills, the BHC formulations high initial kills and dieldrin high long-lasting kills.BHC has marked fumigant and particulate properties lasting for three to four months. Dieldrin has a remarkable particulate action, which produces for the whole six-month period of the experiment, very high kills among mosquitos suspended without actual contact with the insecticidal surfaces; DDT only shows this particulate effect to a slight extent.It is probable that the differences in the toxicities to mosquitos of the insecticides used in these experiments is due partly to differences in the irritant properties of the insecticides. In the case of DDT many of the mosquitos having contact with this insecticide are irritated and escape from the treated surface before acquiring a lethal dose.

scholarly journals THE USE OF THE STOKES-STRUIK APPROXIMATION FOR WAVES OF FINITE HEIGHT

2011 ◽  
Vol 1 (6) ◽  
pp. 16
Author(s):  
L. E. Borgman ◽  
J. E. Chappelear
Keyword(s):  
Wave Profile ◽  
Third Order ◽  
The Third ◽  
Finite Height ◽  
Particle Velocities ◽  
Relationship Of ◽  
The Relationship ◽  
Permanent Form ◽  
Very High ◽  
Water Depths

A formal approximate solution is derived for the profile and velocity components of a wave with permanent form of finite height m moderate water depths. The approximation is carried to the third order, sufficiently far to represent all except the very high "design" waves. The relationship of the formulas to others found in the literature is discussed. The wavelengths and the coefficients in the third-order series for the wave profile, and the water particle velocities and local accelerations are tabulated for approximately 2000 waves. The depths, heights, and periods for the listed wave conditions vary respectively from 10 to 500 feet, 5 to 40 feet, and 4 to 20 seconds. The range of applicability of the theory is discussed and approximate limits estimated. As an aid in calculations, tables of the trigonometric and hyperbolic sines and cosines for integral multiples of the argument are included.

Sign in / Sign up

Export Citation Format

Share Document