In silico approach to understand epigenetics of POTEE in ovarian cancer

Ovarian cancer is the third leading cause of cancer-related deaths in India. Epigenetics mechanisms seemingly plays an important role in ovarian cancer. This paper highlights the crucial epigenetic changes that occur in POTEE that get hypomethylated in ovarian cancer. We utilized the POTEE paralog mRNA sequence to identify major motifs and also performed its enrichment analysis. We identified 6 motifs of varying lengths, out of which only three motifs, including CTTCCAGCAGATGTGGATCA, GGAACTGCC, and CGCCACATGCAGGC were most likely to be present in the nucleotide sequence of POTEE. By enrichment and occurrences identification analyses, we rectified the best match motif as CTTCCAGCAGATGT. Since there is no experimentally verified structure of POTEE paralog, thus, we predicted the POTEE structure using an automated workflow for template-based modeling using the power of a deep neural network. Additionally, to validate our predicted model we used AlphaFold predicted POTEE structure and observed that the residual stretch starting from 237-958 had a very high confidence per residue. Furthermore, POTEE predicted model stability was evaluated using replica exchange molecular dynamic simulation for 50 ns. Our network-based epigenetic analysis discerns only 10 highly significant, direct, and physical associators of POTEE. Our finding aims to provide new insights about the POTEE paralog.

Variation of Axial Residual Strains Along the Course and Circumference of Human Aorta Considering Age and Gender

Our understanding of aortic biomechanics is customarily limited by lack of information on the axial residual stretches of the vessel in both humans and experimental animals that would facilitate the identification of its actual zero-stress state. The aim of this study was thus to acquire hitherto unreported quantitative knowledge of axial opening angle and residual stretches in different segments and quadrants of the human aorta according to age and gender. Twenty-three aortas were harvested during autopsy from the aortic root to the iliac bifurcation and were divided into ≥12 segments and 4 quadrants. Morphometric measurements were taken in the excised/curled configuration of rectangular strips considered to be under zero-stress using image-analysis software to study the axial/circumferential variation of axial opening angle, internal/external residual stretch, and thickness of the aortic wall. The measured data demonstrated: (1) an axial opening angle peak at the arch branches, decreasing toward the ascending and to a near-constant value in the descending thoracic aorta, and increasing in the abdominal aorta; (2) the variation of residual stretches resembled that of opening angle, but axial differences in external residual stretch were more prominent; (3) wall thickness showed a progressive diminution along the vessel; (4) the highest opening angle/residual stretches were found in the inner quadrant and the lowest in the outer quadrant; (5) the anterior was the thinnest quadrant throughout the aorta; (6) age caused thickening but greatly reduced axial opening angle/residual stretches, without differences between males and females.

A Phenomenological Model for Shakedown of Tough Hydrogels Under Cyclic Loads

Most tough hydrogels suffer accumulated damages under cyclic loads. The damages may stem from breakage of covalent bonds, unzipping of ionic crosslinks, or desorption of polymer chains from nanoparticle surfaces. Recent experiments report that when a tough hydrogel is subject to cyclic loads, the stress–stretch curves of tough hydrogels change cycle by cycle and approach a steady-state after thousands of cycles, denoted as the shakedown phenomenon. In this paper, we develop a phenomenological model to describe the shakedown of tough hydrogels under prolonged cyclic loads for the first time. We specify a new evolution law of damage variable in multiple cycles, motivated by the experimental observations. We synthesize nanocomposite hydrogels and conduct the cyclic tests. Our model fits the experimental data remarkably well, including the features of Mullins effect, residual stretch and shakedown. Our model is capable of predicting the stress–stretch behavior of subsequent thousands of cycles by using the fitting parameters from the first and second cycle. We further apply the model to polyacrylamide (PAAM)/poly(2-acrylanmido-2-methyl-1-propanesulfonic acid) (PAMPS) and PAAM/alginate double-network hydrogels. Good agreement between theoretical prediction and experimental data is also achieved. The model is hoped to serve as a tool to probe the complex nature of tough hydrogels, through cyclic loads.

DIRECTIONAL CONSTITUTIVE LAWS FOR RUBBERS

ABSTRACT Directional laws, also called micro-sphere laws, are based on the rubber elasticity theory and are designed to fit rubber mechanical stress–strain responses at large strain. Because they depend on material directions, directional changes may be introduced accounting for anisotropic damage or residual stretch such as resulting from Mullins softening or accounting for anisotropic strain hardening such as induced by crystallization. Directional laws provide a relevant alternative to strain invariants laws when the material isotropy evolves or when its anisotropy is difficult to guess a priori. In the current contribution, the building process involved when defining directional laws is presented. The major assumptions resulting from this process are reviewed. Finally, recent directional laws from the literature are discussed, highlighting the interest and potential of such a constitutive framework.

Determination and Modeling of the Inelasticity Over the Length of the Porcine Carotid Artery

The study of the mechanical properties of swine carotids has clinical relevance because it is important for the appropriate design of intravascular devices in the animal trial phases. The inelastic properties of porcine carotid tissue were investigated. Experimental uniaxial cyclic tests were performed along the longitudinal and circumferential directions of vessels. The work focused on the determination, comparison, and constitutive modeling of the softening properties and residual stretch set of the swine carotid artery over long stretches and stress levels in both proximal and distal regions. It was observed that the residual strain depends on the maximum stretch in the previous load cycle. The strain was higher for distal than for proximal samples and for circumferential than for longitudinal samples. In addition, a pseudoelastic model was used to reproduce the residual stretch and softening behavior of the carotid artery. The model presented a good approximation of the experimental data. The results demonstrate that the final results in animal trial studies could be affected by the location studied along the length of the porcine carotid.

Quantification of Elastin Residual Stretch in Fresh Artery Tissue: Impact on Artery Material Properties and Pulmonary Hypertension Pathophysiology

Pulmonary arterial hypertension (PAH) is characterized as a chronic elevation in mean pulmonary artery pressure (MPAP) resulting from increased hydrodynamic resistance and decreased hydraulic capacitance of the pulmonary circulatory system. These hemodynamic changes cause the heart to operate outside optimum pump efficiency. The heart compensates for the efficiency loss through ventricular hypertrophy which, if left untreated, will continue until cardiac failure results.