scholarly journals Effects of different levels of saline water on infection of tomato by Botrytis cinerea, the causal agent of gray mold

Author(s):  
Boumaaza Boualem ◽  
Boudalia Sofiane ◽  
Gacemi Abdelhamid ◽  
Benzohra .I . E ◽  
Benada M’hamed ◽  
...  

A greenhouse experiment was conducted to investigate the effect of different levels of NaCl salt on tomato upon B. cinerea infection the causal agent of gray mold disease. The disease assessment was recorded after inoculation by using the scale based on percentage leaf area affected, and the growth of the plants was recorded for each treatment. Three weeks after inoculation by conidial suspension, the estimated disease severity on plants of tomato was 35.18% compared to the control. The highest incidence disease increase of gray mold (39.21%) was obtained with using 300 mM of NaCl after inoculation with B. cinerea compared with the other concentrations and as well as distilled water. Under severe salt stress (150 and 300mM) increased susceptibility of gray mold disease severity were observed in plants inoculated with B. cinerea, while under mild salt stress (50mM of NaCl) this effect was reversed. The treatment of plant by B.cinerea has reduced the growth of the aerial part of tomato plants (39.06%) after three weeks inoculation compared to the control. Three levels of NaCl (50, 100 and 150mM) increased respectively the plant height from 12.73 to 29.84%, 0.28 to 27.16% for the fresh eight and 5.75 to 33.35% for dry weight compared to the plants inoculated and irrigated by distilled water. NaCl addition at 300mM on plants inoculated with B. cinerea decreased the height, fresh weight and dry weight at 0.99, 4.45 and 11.01% respectively.

Author(s):  
Leandro de P. Souza ◽  
Reginaldo G. Nobre ◽  
Evandro M. da Silva ◽  
Geovani S. de Lima ◽  
Francisco W. A. Pinheiro ◽  
...  

ABSTRACT The objective of this research was to evaluate the growth and formation of fresh and dry weight of ‘Crioula’ guava rootstock irrigated with waters of different saline levels and nitrogen (N) doses, in an experiment conducted in plastic tubes under greenhouse conditions. The experimental design was randomized blocks, in a 5 x 4 factorial scheme with four replicates, and the treatments consisted of five levels of water electrical conductivity - ECw (0.3, 1.1, 1.9, 2.7 and 3.5 dS m-1) and four N doses (70, 100, 130 and 160% of the N dose recommended for the cultivation of guava seedlings, cv. ‘Paluma’). The dose referring to 100% corresponds to 773 mg of N dm-3. The highest growth of ‘Crioula’ guava rootstock was obtained with ECw of 0.3 dS m-1 and fertilization of 541.1 mg N dm-3 of soil; increasing N doses did not reduce the deleterious effect of the salt stress on the growth and phytomass formation of ‘Crioula’ guava rootstock; irrigation with water of up to 1.75 dS m-1, in the production of guava rootstocks, promotes acceptable reduction of 10% in growth and quality of the seedlings.


Plant Disease ◽  
2007 ◽  
Vol 91 (7) ◽  
pp. 905-905 ◽  
Author(s):  
H. K. Yun ◽  
C. Louime ◽  
J. Lu

Anthracnose of grapes is an economically devastating disease caused by Elsinoe ampelina (2). Warm, humid weather favors disease development, and therefore in the United States, it is generally restricted to grape-growing areas east of the Rocky Mountains. Vitis vinifera is highly susceptible to the disease, which is one of the principal factors preventing the development of an industry with this high-quality grape in the southeastern United States. Growers in this area produce local species-such as muscadine grapes (V. rotundifolia Michx.) and hybrids. Muscadine grapes are known for their resistance or “immunity” to many diseases found in bunch (Euvitis spp. Planch.) grape species (1). As yet, there has been no formal report of anthracnose or its causal agent on muscadine grapes. E. ampelina was detected on muscadine leaves for the first time in the experimental vineyard at the Center for Viticulture and Small Fruit Research during the summer of 2006. Approximately 40% of the 52 muscadine cultivars in the collection showed circular or irregular black spots typical of anthracnose mainly on young leaves and tendrils. However, no symptoms were observed on fruits, shoot tips, or any other plant part. To confirm the causal agent, infected leaves were surface sterilized with 75% ethanol, dipped in 2% sodium hypochlorite for 15 s, rinsed in distilled water, dissected into small 0.5-cm leaf discs, and plated on potato dextrose agar (PDA) and incubated at 28°C. Single-spore isolates were grown on PDA. Colonies were slow growing and appeared as dark red mounds with some mycelia. Conidia were cylindrical and hyaline with pointed ends consistent with previous reports for E. ampelina (2). The identity was also confirmed by using the following PCR primers to the 18S RNA: left primer; TCCGTAGGTGAACCTGCGGA and right primer; TCCTACCTGAT CCGAGGTCA designed on the basis of the alignment of E. ampelina sequences deposited in NCBI database. To fulfill Koch's postulates, symptoms were reproduced by artificial inoculation onto young muscadines (cv. Carlos) and bunch (cv. Cabernet Sauvignon) grapevines. A conidial suspension was prepared from single-conidial cultures, and three experimental vines of each species were sprayed with 0.5 ml of suspension (2 × 105 conidia per ml), whereas three control plants were sprayed with distilled water. The plants were incubated in a moist chamber at 28°C with 16 h of light. The first typical symptoms appeared on V. vinifera 4 days postinoculation and on the muscadines 6 days postinoculation. To our knowledge, this is the first report confirming anthracnose disease on muscadine grapes. References: (1) J. Lu et al. Acta Hortic. 528:479, 2000. (2) R. C. Pearson and A. C. Gohen. Anthracnose. Pages 18–19 in: Compendium of Grape Diseases. The American Phytopathological Society. St. Paul, MN, 1994.


2018 ◽  
Vol 9 (2) ◽  
pp. 207-213
Author(s):  
Baghdad Science Journal

The effect of saline magnetized water irrigation on seed germination and seedling growth of wheat cultivar Iraq were studied. Irrigation water was supplemented with different levels of Sodium chloride 6, 12 or 18 mmhos/ cm in addition control treatment, and passed through a proper magnetic felid with 1000, 1250, 1500 or 2000 gaus in addition control treatment. The results showed significantly stimulated shoot development and led to the increase of germination, seedling emergence, area leaf, length of shoot and root and fresh and dry weight compared to the controls. Results also showed significant interaction between saline water and magnetized water. So, using magnetic treatment of saline water could be a promising technique for Agricultural improvement.


2017 ◽  
Vol 2 (2) ◽  
pp. 125-129
Author(s):  
Zineb Sellal ◽  
Jamila Dahmani ◽  
Rachid Benkirane ◽  
Amina Ouazzani Touhami ◽  
Allal Douira

A survey in the Mamora forest was done in the spring of 2010 and revealed that 67% of buds and 27% of leaves of Pyrus mamorensis (Trabut) samples collected had lesions with a gray felting. The pathogenic fungus was identified as Botrytis cinerea by the filter – paper technic. Koch´s postulate was verified by inoculating healthy leaves. The estimated disease severity on P. mamorensis leaves was respectively 75.56% and 68.81% for inoculation by conidial suspension and the mycelial disks. Conidia production of Botrytis cinerea on inoculated leaves by conidial suspension was 1.03.105 conidia.cm-2 and by mycelial disks was 0.60.105 conidia.cm-2. This was the first report of gray mold disease of Mamora pear caused by Botrytis cinerea in Morocco.


Plant Disease ◽  
2014 ◽  
Vol 98 (2) ◽  
pp. 278-278 ◽  
Author(s):  
M. A. Henriquez ◽  
D. L. McLaren ◽  
R. L. Conner ◽  
P. M. Balasubramanian ◽  
K. F. Chang ◽  
...  

Root rot is a major disease of dry bean and can cause significant yield reductions due to weakened root systems and poor plant stands. An in-depth study on root rot pathogen identification was conducted in 2011 in three commercial dry bean fields from the major production areas in Manitoba. Ten plants, sampled at each of four random sites within each field, were rated for disease severity. Twenty roots were processed for pathogen isolation and identification in the laboratory. Roots were cut into eight sections (~1 cm) and surface-sterilized in a laminar flow bench. Four root sections were placed on potato dextrose agar plates amended with 0.02% streptomycin sulfate (PDA-Strep) and four root sections were placed on peptone-pentachloronitrobenzene agar amended with 0.1% streptomycin sulfate and 0.012% neomycin sulfate. Afterward, 960 monosporic cultures were obtained representing 320 single spore isolates of potential root rot pathogens per commercial field. Common monosporic cultures from each field were subcultured on PDA-Strep and Spezieller Nährstoffarmer Agar (SNA) media. Based on morphological characteristics, 74 isolates were identified as Fusarium cuneirostrum (1). Colonies grew slowly on PDA-Strep with undulated margins, radial cream-grey mycelia, and conidia pustules with a cream-greyish pigmentation. Sporodochial conidia were falcate, mostly 5-septate, with a wedge shape and slightly protruding basal foot cell (56.3 to 71.8 × 4.6 to 6.2 μm on average). Species identity was confirmed for two isolates by sequencing the translation elongation factor 1 alpha (EF1-α) gene (2), the internal transcribed spacer (ITS) region (4), and the ribosomal intergenic spacer (IGS) (3) (GenBank Accession Nos. KF530848, KF530849, and KF025648 to 51). Sequence homology was compared using BLAST analysis and the FUSARIUM-ID database. The F. cuneirostrum isolates were deposited at the Canadian Collection of Fungal Cultures (DAOM 242540 and 242541). Pathogenicity screenings of two isolates was performed using sterilized seed of navy bean cv. Envoy. Seeds were germinated on moist filter paper for 3 days at 25°C and then inoculated by immersion in a prepared conidial suspension (2.5 × 105 conidia/ml) for 5 min. Seeds of the controls were immersed in sterile water. After inoculation, the germinated seeds were planted in 10-cm diameter pots, filled with sterile soilless mix (Sunshine #3). In the greenhouse, the experiment was arranged as a completely randomized design with three replicates with four germinated seeds per isolate, and was repeated twice. Disease assessment was performed 14 days after inoculation. Infected plants displayed dark brown lesions on the hypocotyl and primary root with a disease severity of 4 scored on a 0 to 5 scale. Fusarium cuneirostrum was re-isolated from roots of symptomatic plants. To our knowledge, this is the first report of F. cuneirostrum causing root rot of dry bean in Canada. It has been previously isolated from mung bean (Vigna radiata) in Ontario (1). References: (1) T. Aoki et al. Mycoscience. 46:162, 2005. (2) D. M. Geiser et al. Eur. J. Plant Pathol. 110:473, 2004. (4) H. Wang et al. J. Clin. Microbiol. 49:1890, 2011. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, New York, 1990.


Plant Disease ◽  
2021 ◽  
Author(s):  
Muhammad Zeshan Ahmed ◽  
Saba Saeed ◽  
Ahmad Hassan ◽  
Salman Ghuffar ◽  
Ahsan Abdullah ◽  
...  

In July 2019, leaf spot symptoms were observed on muskmelon (Cucumis melo L.) cv. Jackball-1 plants in an experimental field of 2.02 ha with a disease incidence of 30% (31°26'05.4"N 73°04'30.3"E) at the University of Agriculture, Faisalabad, Pakistan. Early symptoms consisted of small, circular, brown, necrotic spots 1 to 2 mm in size covering 10 to 30% of the leaf blade, which gradually enlarged and developed concentric rings. To identify the causal agent of the disease, a total of 20 symptomatic leaves were collected. Small pieces removed from the margin between healthy and diseased tissues were surface disinfected in 70% ethanol for 2 min, rinsed three times with sterile distilled water, plated on Potato dextrose agar and incubated at 25 ± 2°C with a 12-h photoperiod. Morphological observations were made on 7-day-old single-spore cultures. The colonies initially appeared white and then turned olive-green. All 20 fungal isolates were characterized by small, short-beaked, multicellular conidia. The conidia were ellipsoidal or ovoid and measured 11.5 to 30 μm × 7.5 to 15 μm (n = 50) with longitudinal and transverse septa. Conidia were produced on short conidiophores in chains. The beaks were short (often less than one-third the body length) and conical or cylindrical. These morphological features concur with the description of Alternaria alternata (Fr.) Keissler (Woudenberg et al. 2013). For molecular identification, genomic DNA of four representative isolates (HMSMZA 07, 08, 09, 10) were extracted and PCR amplification of the internal transcribed spacer (ITS)-rDNA, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and translation elongation factor-1 alpha (TEF-1α) gene regions were performed (White et al. 1990, Berbee et al. 1999, Carbone & Kohn, 1999) respectively. The obtained sequences were deposited in GenBank with accession numbers MT253643.1-MT253646.1 (ITS-rDNA), MT318260.1-MT318263.1 (GAPDH), and MT318280.1-MT318283.1 (TEF-1α). BLASTn analysis of HMSMZA 07 sequences showed 100% identity with ITS rDNA (MN615420.1), GAPDH (MK637438.1) and TEF-1α (MN807795.1) sequences of A. alternata. To confirm pathogenicity, 5-6 weeks-old Muskmelon (Cucumis melo L.) cv. Jackball-1 plants (true leaf stage) were sprayed until runoff (1.5 to 2 ml per plant) with A. alternata conidial suspension (106 conidia/ml; obtained from 1 week-old cultures) amended with 0.1% (vol/vol) of Tween 20 using an atomizer in the green house. The experiment included four A. alternata isolates inoculated onto three muskmelon plants per each isolate, whereas control plants (n = 3) were sprayed with sterile distilled water amended with 0.1% Tween 20. The plants were incubated at 25 ± 2°C in a greenhouse and the experiment was conducted twice. After 5 to 7 days post inoculation, necrotic leaf spots were observed on the inoculated plants and A. alternata was reisolated and confirmed by morphological and molecular (ITS) features. No disease was observed on control plants. Previously, A. alternata on muskmelon has been reported in Pakistan (Ahmad et al. 1997), however this study provides a detailed description of disease symptoms, morphological and molecular identity of the causal agent including completion of Koch’s postulates. The disease could represent a threat for muskmelon crop in Pakistan due to its increasing cultivation and therefore warrants the need to develop disease management strategies.


Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1154-1154 ◽  
Author(s):  
A. Grabke ◽  
M. Williamson ◽  
G. W. Henderson ◽  
G. Schnabel

In July 2013, two diseased peach fruit (Prunus persica (L.) Stokes) of the cv. Sweet Dream were collected from a commercial orchard in Ridge Springs, South Carolina. Affected peaches were at or near maturity and symptoms resembled anthracnose disease caused by Colletotrichum spp. with circular sunken tan to brown lesions that were firm in touch, and had wrinkled concentric rings. The center of the lesion was covered with black acervuli containing setae. To isolate the causal agent, the two symptomatic fruit were surface-sterilized in 10% bleach for 2 min and rinsed with sterile distilled water. Lesions were cut in half, and necrotic tissue from the inside of the fruit was placed on acidified potato dextrose agar (APDA). Flat colonies covered with olive-gray to iron-gray acervuli developed on APDA incubated at 22°C with a 12-h cycle of fluorescent light and darkness. Morphology of acervuli, setae (avg. 90 to 160 μm), conidiophores (up to 90 um long), and conidia (avg. 22 × 3.8 μm) of single spore isolates were consistent with descriptions of Colletotrichum truncatum (Schwein.) Andrus & W.D. Moore (3), a causal agent of anthracnose disease. Genomic DNA was extracted from isolate Ct_RR13_1 using the MasterPure Yeast DNA Purification Kit (Epicentre, Madison, WI). The ribosomal ITS1-5.8S-ITS2 region and a partial sequence of the actin gene were amplified with primer pair ITS1 and ITS4 (4), and primer pair ACT-512F and ACT-783A (2), respectively. A multilocus sequence identification in Q-bank Fungi revealed a 100% similarity with C. truncatum (1). The C. truncatum sequences from the peach isolate were submitted to GenBank (accessions KF906258 and KF906259). Pathogenicity of isolate Ct_RR13_1 was confirmed by inoculating five mature but still firm peach fruits with a conidial suspension of C. truncatum. Peaches were washed with soap and water, surface-disinfected for 2 min with 10% bleach, rinsed with sterile distilled water, and air dried. Dried fruit were stabbed at three equidistant points, each about 2 cm apart, to a depth of 9.5 mm using a sterile 26G3/8 beveled needle (Becton Dickinson & Co., Rutherford, NJ). For inoculation, a 30-μl droplet of conidia suspension prepared in distilled, sterile water (1 to 2 × 104 spores/ml) was placed on each wound; control fruit received sterile water without conidia. Fruit were incubated at 22°C for 2 days at 100% humidity and another 12 days at 70% humidity. Inoculated fruit developed anthracnose symptoms with sporulating areas as described above and the fungus was re-isolated. All control fruit remained healthy. C. truncatum has a wide host range, including legumes and solanaceous plants of the tropics, and is especially common in the Fabaceae family. Its occurrence in a commercial peach orchard is worrisome because control measures may need to be developed that are different from those developed for endemic species, i.e. C. acutatum and C. gloeoporioides, due to differences in disease cycle or fungicide sensitivity. To our knowledge, this is the first report of C. truncatum causing anthracnose on a member of the genus Prunus. References: (1) P. Bonants et al. EPPO Bull. 43:211, 2013. (2) I. Carbone et al. Mycologia 91:553, 1999. (3) U. Damm et al. Fungal Divers. 39:45, 2009. (4) T. J. White et al. Pages 315-322 in: PCR Protocols: A Guide to Methods and Application. Academic Press, NY, 1993.


Irriga ◽  
2021 ◽  
Vol 26 (1) ◽  
pp. 55-64
Author(s):  
Carolina das Chagas Silva ◽  
ADEMIR SILVA MENEZES ◽  
Marcio Facundo Aragão ◽  
Luí Gonzaga Pinheiro Neto ◽  
Francisco José Carvalho Moreira ◽  
...  

This study aimed to evaluate the effect of different levels of water salinity in the development of two varieties of cactus pear (Opuntia and Nopalea). The spineless cactus is native from Mexico, but nowadays can be found in many places throughout the world. The experiment was performed at the Federal Institute of Ceará – IFCE/Campus Sobral. The experimental design was a randomized factorial 5 x 2, with five levels of salinity in the irrigation water (0.0; 5.0; 10; 15 and 20 dS m-1) and two varieties of cactus pear Small or sweet (Nopalea cochenillifera Salm-Dick) and ‘elephants ear’ (Opuntia sp) with four replications. Variables studied were: plant height (cm), length and circumference of the paddle (cm), cladode thickness (cm) fresh weight (g) and dry weight (g). The variety “elephants’ ear” is more suitable for cultivation under irrigation with saline water, because it presented a better vegetative performance compared to the small variety, being more tolerant to saline stress in different levels of salinity. The effect of the interaction between salinity and varieties showed a decrease for all variables analyzed, with reduction in forage development of palm varieties for higher salinity levels.


Plant Disease ◽  
2021 ◽  
Author(s):  
Md Aktaruzzaman ◽  
Tania Afroz ◽  
Sung Kee Hong ◽  
Byung Sup Kim ◽  
Hyo-Won Choi

Hyacinth bean (Lablab purpureus L.) is a highly proteineous legume under the family Fabaceae. It is native to Africa, cultivated throughout the world, and recently introduced vegetable in Korea. In April 2020, approximately 10 to 15% of the total harvested pods showed gray mold rot symptoms after 3–5 days of storage at 4 °C in Jeonju, Jeonbuk province, Korea. The symptoms observed were irregular, water-soaked spots become brown or gray with white hyphae were appeared on the infected pods. Diseased tissue was excised, and surface sterilized by immersing in 1% sodium hypochlorite (NaOCl) for 1 min, rinsed three times with sterilized distilled water, placed on potato dextrose agar (PDA) plates, and incubated at 20 ± 2°C for 7 days. A total of five morphologically similar fungal isolates (HBGM001 to HBGM005) were obtained from diseased samples; isolate HBGM002 and HBGM005 were selected for identification. The fungus produced initially white colonies, after 7 days it changes to gray to dark colonies with dark mycelium that sporulated abundantly on PDA at 20ºC. The conidia (n = 50) were single-celled, ellipsoid or ovoid in shape, and 6.11 to 13.9 × 4.8 to 9.4 μm in size for HBGM001 isolate and 5.81 to 14.1× 4.5 to 9.6 μm in size for HBGM005. Conidiophores (n = 15) arose solitary or in groups, straight or flexuous, septate, with an inflated basal cell brown to light brown, and measured 103 to 420× 7 to 25 μm for HBGM001 isolate and 101 to 415 × 5 to 23 μm for HBGM005 isolate. After two weeks, the fungus formed several black sclerotia (n = 20) ranging from 0.5 to 4.2 × 0.5 to 3.4 mm for HBGM001 isolate and 0.4 to 4.4 × 0.3 to 3.3 mm for HBGM005 isolate near the edge of the Petri dish. Morphological characters were consistent with those of Botrytis cinerea Pers.: Fr. (Ellis 1971). As for molecular identification, the internal transcribed spacer (ITS) and three nuclear protein-coding genes (glyceraldehydes-3-phosphate dehydrogenase gene [G3PDH], heat-shock protein 60 gene [HSP60], and DNA-dependent RNA polymerase subunit gene [RPB2]) were amplified using primer pairs ITS1/ITS4 (White et al. 1990), G3PDH-F/G3PDH-R, HSP60-F/HSP60-R, and RPB2-F/RPB2-R (Staats et al. 2005), respectively. The ITS, G3PDH, HSP60, and RPB2 sequences of HBGM002 and HBGM005 isolates (GenBank accession number MT439648 and MT968495 for ITS; MT439649 and MT968496 for G3PDH; MT439650 and MT968497 for HSP60; MT439651 and MT968498 for RPB2 respectively) were 99% to 100% identical to those of B. cinerea (KY364366, KF015583, KJ018758, and KJ018756, respectively). To determine pathogenicity, five disinfected pods were pinpricked (3 sites per pod) with sterile needles and 50 µl of conidial suspension (1 × 105 conidia/ml) was inoculated by pipetting into the wounds. An analogous five pods, serving as controls, were inoculated with sterile distilled water. All the pods were placed in a growth chamber and maintained a temperature of 20±2ºC and a relative humidity >80%. After 5 days, gray mold symptoms developed on the inoculated pods, whereas no symptoms appeared on control pods. The pathogen was re-isolated from the inoculated pods, fulfilling Koch’s postulates. B. cinerea has been reported causing gray mold in Hyacinth bean in China, Taiwan and India (Farr and Rossman 2021). To our knowledge, this is the first report of B. cinerea causing post-harvest gray mold on hyacinth bean in Korea. The disease could represent a threat for hyacinth bean post-harvest and storage and management strategies should be investigated and applied.


2020 ◽  
Vol 27 (2) ◽  
pp. 393-401
Author(s):  
Tasawer Abbas

Increasing soil salinity due to climate change complicating weed management. Rhynchosia capitata is becoming an increasing problem in summer crops, such as cotton, soybean, pearl millet and mungbean worldwide. Study was conducted to evaluate the impact of four types of salts stresses (NaCl, Na2SO4, CaCl2 and NaHCO3) at six different levels (0, 50, 100, 150, 200 and 250 mM) on R. capitata seeds of different sizes including small, medium and large. Results revealed that R. capitata can germinate over a wide range of salt stress but as the salinity level was increased to 250 mM the germination percentage and seedling growth decreased significantly. Larger seeds have more potential to germinate and grow vigorously at an increased salt concentration as compared to medium and small seeds. Salt stress caused 40-73%, 59-96% and 40-100% inhibition in seed germination, seedling length and dry weight, respectively. Among various salt stresses CaCl2 showed less inhibition of R. capitata. The higher tolerance of this weed to wide range of salt stresses is alarming factor under current and anticipated increase in salinity, as it will disturb management plans by changing critical completion period and threshold level due to more adaptability of weed under stress than crop plants.


Sign in / Sign up

Export Citation Format

Share Document