scholarly journals (271) Expression of the NRT1 Gene in Cornus and Rhododendron

HortScience ◽  
2005 ◽  
Vol 40 (4) ◽  
pp. 1020C-1020
Author(s):  
David R. Sandrock ◽  
Anita N. Azarenko ◽  
Ruth M. Martin ◽  
Nahla V. Bassil
Keyword(s):  
Nitrate Uptake ◽  
Transport Proteins ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Specific Primers ◽  
Nucleotide Level ◽  
Pcr Product ◽  
Pcr Products ◽  
Species Specific ◽  
Hydroponically Grown

The NRT1gene family encodes transport proteins with dual or low affinity for nitrate. The objectives of this experiment were to develop a system that could be used to compare the expression of the NRT1genes between species. This was accomplished by comparing sequences of NRT1homologues from various species and designing degenerate primers in regions of high homology. These primers were used to amplify a region of the NRT1gene from species of interest. A 635 bp PCR product was amplified from each species using the MD2-1 (5' ATGTTACCAAYWTGGGCMAC-3') and MD2-2 (5'-GCCAMWARCCARTAGAAAT-3') primers. The PCR products were cloned and sequenced. At the nucleotide level, CornussericeaL. `Kelseyi' and RhododendronL. `Unique' were 79.52% identical. Species-specific primers were designed and used for RT-PCR to compare NRT1expression in roots of hydroponically grown C. sericea, C. sericea `Kelseyi', and Rhododendron`Unique'. The relative levels of NRT1expression, normalized using 18S rRNA as a standard, were ≈3.2 to 1.7 to 1.0 for C. sericea, C. sericea `Kelseyi', and Rhododendron`Unique', respectively. This approach may eventually be used to examine nitrate uptake potential in different taxa of plants at different times during the growing season.

Species-specific duplex PCR for the detection of Pratylenchus penetrans

Nematology ◽  
2009 ◽  
Vol 11 (6) ◽  
pp. 847-857 ◽  
Author(s):  
Lieven Waeyenberge ◽  
Nicole Viaene ◽  
Maurice Moens
Keyword(s):  
Internal Control ◽  
Dna Sequences ◽  
Rrna Gene ◽  
Duplex Pcr ◽  
Specific Primers ◽  
5.8S Rrna Gene ◽  
5.8S Rrna ◽  
Wide Range ◽  
Pcr Products ◽  
Species Specific

Abstract ITS1, the 5.8S rRNA gene and ITS2 of the rDNA region were sequenced from 20 different Pratylenchus species. Additionally, the same region was sequenced from seven populations of P. penetrans. After purifying, cloning and sequencing the PCR products, all sequences were aligned in order to find unique sites suitable for the design of species-specific primers for P. penetrans. Since ITS regions showed variability between and even within populations of P. penetrans, only three small DNA sequences were suitable for the construction of three potentially useful species-specific primers. New species-specific primers were paired with existing universal ITS primers and tested in all possible primer combinations. The best performing primer set, supplemented with a universal 28S rDNA primer set that served as an internal control, was tested in duplex PCR. The ideal annealing temperature, Mg2+ concentration and primer ratios were then determined for the most promising primer set. The optimised duplex PCR was subsequently tested on a wide range of different Pratylenchus spp. and 25 P. penetrans populations originating from all over the world. To test the sensitivity, the duplex PCR was conducted on DNA extracted from a single P. penetrans nematode mixed with varying amounts of nematodes belonging to another Pratylenchus species. Results showed that a reliable and sensitive P. penetrans species-specific duplex PCR was constructed.

scholarly journals First Report of Mosaic Disease Caused by Colombian datura virus on Solanum lycopersicum Plants Commercially Cultivated in Japan

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 698-698 ◽  
Author(s):  
Y. Tomitaka ◽  
T. Usugi ◽  
R. Kozuka ◽  
S. Tsuda
Keyword(s):  
Nucleotide Sequence ◽  
Solanum Lycopersicum ◽  
Mosaic Disease ◽  
Causal Agent ◽  
Cultivated Plants ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Specific Primers ◽  
Tomato Plants ◽  
First Report

In 2009, some commercially grown tomato (Solanum lycopersicum) plants in Chiba Prefecture, Japan, exhibited mosaic symptoms. Ten plants from a total of about 72,000 cultivated plants in the greenhouses showed such symptoms. To identify the causal agent, sap from leaves of the diseased plants was inoculated into Chenopodium quinoa and Nicotiana benthamiana plants. Local necrotic lesions appeared on inoculated leaves of C. quinoa, but no systemic infection was observed. Systemic mosaic symptoms were observed on the N. benthamiana plants inoculated. Single local lesion isolation was performed three times using C. quinoa to obtain a reference isolate for further characterization. N. benthamiana was used for propagation of the isolate. Sap from infected leaves of N. benthamiana was mechanically inoculated into three individual S. lycopersicum cv. Momotaro. Symptoms appearing on inoculated tomatoes were indistinguishable from those of diseased tomato plants found initially in the greenhouse. Flexuous, filamentous particles, ~750 nm long, were observed by electron microscopy in the sap of the tomato plants inoculated with the isolate, indicating that the infecting virus may belong to the family Potyviridae. To determine genomic sequence of the virus, RT-PCR was performed. Total RNA was extracted from the tomato leaves experimentally infected with the isolate using an RNeasy Plant Mini kit (QIAGEN, Hilden, Germany). RT-PCR was performed by using a set of universal, degenerate primers for Potyviruses as previously reported (2). Amplicons (~1,500 bp) generated by RT-PCR were extracted from the gels using the QIAquick Gel Extraction kit (QIAGEN) and cloned into pCR-BluntII TOPO (Invitrogen, San Diego, CA). DNA sequences of three individual clones were determined using a combination of plasmid and virus-specific primers, showing that identity among three clones was 99.8%. A consensus nucleotide sequence of the isolate was deposited in GenBank (AB823816). BLASTn analysis of the nucleotide sequence determined showed 99% identity with a partial sequence in the NIb/coat protein (CP) region of Colombian datura virus (CDV) tobacco isolate (JQ801448). Comparison of the amino acid sequence predicted for the CP with previously reported sequences for CDV (AY621656, AJ237923, EU571230, AM113759, AM113754, and AM113761) showed 97 to 100% identity range. Subsequently, CDV infection in both the original and experimentally inoculated plants was confirmed by RT-PCR using CDV-specific primers (CDVv and CDVvc; [1]), and, hence, the causal agent of the tomato disease observed in greenhouse tomatoes was proved to be CDV. The first case of CDV on tomato was reported in Netherlands (3), indicating that CDV was transmitted by aphids from CDV-infected Brugmansia plants cultivated in the same greenhouse. We carefully investigated whether Brugmansia plants naturally grew around the greenhouses, but we could not find them inside or in proximity to the greenhouses. Therefore, sources of CDV inoculum in Japan are still unclear. This is the first report of a mosaic disease caused by CDV on commercially cultivated S. lycopersicum in Japan. References: (1) D. O. Chellemi et al. Plant Dis. 95:755, 2011. (2) J. Chen et al. Arch. Virol. 146:757, 2001. (3) J. Th. J. Verhoeven et al. Eur. J. Plant. Pathol. 102:895, 1996.

scholarly journals First Report of Yam mild mosaic virus in Yam in Guangxi Province, China

Plant Disease ◽  
2011 ◽  
Vol 95 (10) ◽  
pp. 1320-1320 ◽  
Author(s):  
C. Zou ◽  
J. Meng ◽  
Z. Li ◽  
M. Wei ◽  
J. Song ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Viral Genome ◽  
Terminal Region ◽  
Mild Mosaic ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Germplasm Exchange ◽  
First Report ◽  
Pcr Products ◽  
Mild Mosaic Virus

Yams (Dioscorea spp.) are widely grown in China as vegetables and herbal medicine. However, studies on viral diseases on yams are still limited. As a pilot project of a government initiative for improving yam productivity, a small study was conducted in Guangxi, a southern province of China, on viral disease in yams. Incidence of virus-like disease for the three extensively grown D. alata cultivars, GH2, GH5, and GH6, were 12 to 40%, 12 to 29%, and 11 to 25%, respectively, as found in a field survey with a five-plot sampling method in 2010. A total of 112 leaf samples showing mosaic or mottling or leaves without symptoms were collected from the cvs. GH2, GH5, GH6, and seven additional cultivars (D. alata cvs. GY2, GY23, GY47, GY69, GY62, GY72, and D. batatas cv. Tiegun). To determine if the symptoms were caused by Yam mild mosaic virus (YMMV; genus Potyvirus, family Potyviridae), total RNA was extracted from leaves with a commercial RNA purification kit (TIANGEN, Beijing, China), and reverse-transcription (RT)-PCR was conducted with a YMMV-specific primer pair (4) that amplifies the 3′-terminal portion of the viral genome. A PCR product with the predicted size of 262 bp was obtained from samples of GH5 (number testing positive of total number of leaves = 5 of 12), GH6 (24 of 42), and GY72 (1 of 1), but not from asymptomatic leaves. PCR products from a GH5 sample (YMMV-Nanning) and a GH6 sample (YMMV-Luzhai) were cloned and sequenced using an ABI PRISM 3770 DNA Sequencer. The two PCR products were 97% identical at nucleotide (nt) level and with the highest homology (89% identity) to a YMMV isolate (GenBank Accession No. AJ305466). To further characterize the isolates, degenerate primers (2) were used to amplify viral genome sequence corresponding to the C-terminal region of the nuclear inclusion protein b (NIb) and the N-terminal region of the coat protein (CP). These 781-nt fragments were sequenced and a new primer, YMMV For1 (5′-TTCATGTCGCACAAAGCAGTTAAG-3′) corresponding to the NIb region, was designed and used together with primer YMMV UTR 1R to amplify a fragment that covers the complete CP region of YMMV by RT-PCR. These 1,278-nt fragments were sequenced (GenBank Accession Nos. JF357962 and JF357963). CP nucleotide sequences of the YMMV-Nanning and YMMV-Luzhai isolates were 94% similar, while amino acid sequences were 99% similar. BLAST searches revealed a nucleotide identity of 82 to 89% and a similarity of 88 to 97% for amino acids to sequences of YMMV isolates (AF548499 and AF548519 and AAQ12304 and BAA82070, respectively) in GenBank. YMMV is known to be prevalent on D. alata in Africa and the South Pacific, and has recently been identified in the Caribbean (1) and Colombia (3). To our knowledge, this is the first report of the natural occurrence of YMMV in China and it may have implications for yam production and germplasm exchange within China. References: (1) M. Bousalem and S. Dallot. Plant Dis. 84:200, 2000. (2) D. Colinet et al. Phytopathology 84:65, 1994. (3) S. Dallot et al. Plant Dis. 85:803, 2001. (4) R. A. Mumford and S. E. Seal. J. Virol. Methods 69:73, 1997.

scholarly journals AtypicalCTSKTranscripts andARNTTranscription Read-Through intoCTSK

2005 ◽  
Vol 6 (5-6) ◽  
pp. 268-276
Author(s):  
Fabienne S. Giraudeau ◽  
Jean-Philippe Walhin ◽  
Paul R. Murdock ◽  
Nigel K. Spurr ◽  
Ian C. Gray
Keyword(s):  
Negative Impact ◽  
Cathepsin K ◽  
Chromosome 1 ◽  
Rt Pcr ◽  
Transcription Start ◽  
Aryl Hydrocarbon ◽  
Pcr Product ◽  
Close Proximity ◽  
Pcr Products ◽  
Human Chromosome 1

The aryl hydrocarbon receptor nuclear translocator (ARNT) and cathepsin K (CTSK) genes lie in a tandem head-to-tail arrangement on human chromosome 1. The two genes are in extremely close proximity; the usualCTSKtranscription start site is less than 1.4 kb downstream of the end of the longest reportedARNTtranscript. By generating an RT-PCR product that overlaps both the 3′ end ofARNTand the 5′ end ofCTSK, we show thatARNTtranscripts may extend through theARNT–CTSKintergenic region and progress into theCTSKgene. Furthermore, by using quantitative RT-PCR from several tissues to detect theARNTexpression signature inCTSKintrons, we show thatARNTtranscripts can read through intoCTSKas far asCTSKintron 3, extending approximately 3.7 kb downstream of the end of the longest previously describedARNTmRNA. Given thatARNTandCTSKare expressed in an overlapping range of tissues,ARNTread-through may have a negative impact onCTSKtranscript levels by interfering withCTSKexpression. We also present evidence for novelCTSKtranscripts following sequence analysis ofCTSK-derived ESTs and RT-PCR products. These transcripts show alternate 5′ splicing and or 5′ extension and are sometimes initiated from a cryptic alternative promoter which is upstream of the knownCTSKpromoter and possibly in the 3′ UTR ofARNT.

scholarly journals Application of RT-PCR for Indexing Avocado Sunblotch Viroid

Plant Disease ◽  
1997 ◽  
Vol 81 (9) ◽  
pp. 1023-1026 ◽  
Author(s):  
R. J. Schnell ◽  
D. N. Kuhn ◽  
C. M. Ronning ◽  
D. Harkins
Keyword(s):  
Rt Pcr ◽  
Amplification Product ◽  
Chain Reaction ◽  
Pcr Assay ◽  
Specific Primers ◽  
Pcr Product ◽  
Polymerase Chain ◽  
Dideoxynucleotide Chain Termination Method ◽  
Slab Gels ◽  
Avocado Sunblotch Viroid

A method for the routine detection of avocado sunblotch viroid (ASBVd) in nucleic acid extracts of infected avocado tissues by reverse transcription-polymerase chain reaction (RT-PCR) was developed using ASBVd-specific primers. Amplified cDNA products were analyzed by electrophoresis on nondenaturing 6% polyacrylamide slab gels. The size of the major RT-PCR product from ASBVd-infected tissue was estimated to be 250 bp. This product was absent from amplified extracts of uninfected tissue. The amplification product from ASBVd was sequenced by the dideoxynucleotide chain termination method, and the sequence was over 97% identical to the published sequence. The RT-PCR assay is sensitive enough to allow viroid detection without requiring large amounts of tissue, highly purified ASBVd, or molecular hybridization.

scholarly journals First Report of Tomato chlorosis virus in Tomato in Costa Rica

Plant Disease ◽  
2009 ◽  
Vol 93 (9) ◽  
pp. 970-970 ◽  
Author(s):  
R. M. Castro ◽  
E. Hernandez ◽  
F. Mora ◽  
P. Ramirez ◽  
R. W. Hammond
Keyword(s):  
Costa Rica ◽  
Sequence Analysis ◽  
Nucleotide Sequence Analysis ◽  
Rt Pcr ◽  
Greenhouse Whitefly ◽  
Specific Primers ◽  
First Report ◽  
Sequence Identity ◽  
Pcr Products ◽  
Tomato Chlorosis Virus

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5′-ATGGATCTCACTGGTTGCTTGC-3′) and ToCV-p22-R (5′-TTATATATCACTCCCAAAGAAA-3′) specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5′-TCTGGCAGTACCCGTTCGTGA-3′) and ToCVCPmR (5′-TACCGGCAGTCGTCCCATACC-3′) designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5′-GGCGGTACTTTCGACACTTCTT-3′) and ToCVHSP70R (5′-ATTAACGCGCAAAACCATCTG-3′) designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.

scholarly journals First Report of Natural Infection of Zucchini by Tomato Chlorosis Virus and Cucurbit Chlorotic Yellows Virus in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Xiaohui Sun ◽  
Ning Qiao ◽  
Xianping Zhang ◽  
Lianyi Zang ◽  
Dan Zhao ◽  
...  
Keyword(s):  
Natural Infection ◽  
Pcr Analysis ◽  
Control Group ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Specific Primers ◽  
First Report ◽  
Sequence Identity ◽  
Tomato Chlorosis Virus ◽  
Cucurbit Chlorotic Yellows Virus

Zucchini (Cucurbita pepo) is an extensively cultivated and important economic cucurbit crop in China. In September 2018 and 2019, interveinal chlorosis and yellowing symptoms, suspected to be caused by either tomato chlorosis virus (ToCV; genus Crinivirus) or cucurbit chlorotic yellows virus (CCYV; genus Crinivirus) or by their co-infection, were observed on zucchini plants in a greenhouse in Shandong Province, China. The incidence of the disease in the greenhouse was 20–30%. To identify the causal agent(s) of the disease, leaf samples from 66 zucchini plants were collected in 14 greenhouses in the cities of Shouguang (n = 12), Dezhou (n = 36), Qingzhou (n = 12), and Zibo (n = 6) in Shandong. Four whitefly (Bemisia tabaci) samples and four symptomatic tomato samples were also collected from these sampling sites (one each for each site) because numerous whiteflies were observed in the sampling greenhouses and ToCV was previously reported in greenhouse tomato plants from these regions (Zhao et al. 2014). To determine whether the symptoms were associated with Crinivirus infection, reverse transcription polymerase chain reaction (RT-PCR) using Crinivirus-specific degenerate primers (CriniRdRp251F/CriniRdRp995R) (Wintermantel and Hladky 2010) was performed first on total RNA extracted using the TRIzol protocol (Jordon-Thaden et al. 2015). Thereafter, the RNA samples were subjected to RT-PCR with ToCV- or CCYV-specific primers (Sun et al. 2016; Gan et al. 2019). Of the 66 zucchini samples, 54 tested positive by the degenerate crinivirus primer pair; and among them, 10 tested positive for ToCV only, 40 positive for CCYV only, and 4 positive for both viruses. Interestingly, while both viruses were detected in all B. tabaci samples, only ToCV was detected in the tomato samples (n = 4). To confirm the identity of the viruses, the amplicons of ToCV (four samples each of tomato, B. tabaci and zucchini) and CCYV (four samples each of B. tabaci and zucchini) were Sanger sequenced (Tsingke Biotechnology Co., Ltd., Beijing, China) after cloning into pMD18-T vectors (Takara, Shiga, Japan). BLASTn analysis demonstrated that all sequences were identical to their respective amplicons. The ToCV sequences (GenBank accession numbers: tomato, MN944406; B. tabaci, MN944404; zucchini, MN944405) shared 100% sequence identity with isolates from Beijing (KT751008, KC887999, KR184675, and KP335046), Hebei (KP217196), and Shandong (KX900412). The CCYV sequence (GenBank accession number MT396249) shared 99.9% sequence identity with isolates China (JN126046, JQ904629, KP896506, KX118632, KY400633, and MK568545), Greece (LT716000, LT716001, LT716002, LT716005, and LT716006), and Cyprus (LT992909, LT992910, and LT992911). To assess the transmissibility of ToCV and CCYV, virus-free B. tabaci (n = 30) were placed in ToCV or CCYV-infected zucchini plants for one day for virus acquisition. Thereafter, the whiteflies were transferred into virus-free zucchini seedlings (cv. ‘Zaoqingyidai’, 4-leaf-stage, n = 6 for each of the control, ToCV and CCYV treatment) for one day. Three weeks after inoculation, all plants that were inoculated with either ToCV or CCYV displayed same symptoms as those observed in the greenhouses, whereas plants in the control group remained symptom free. RT-PCR analysis using ToCV- and CCYV-specific primers confirmed the infection of the plants with the respective virus, whereas control plants were free from the viruses. CCYV has been previously reported on zucchini in Algeria (Kheireddine et al. 2020), Iran (LR585225), and Cyprus (LT992910). To our knowledge, this is the first report of CCYV infection in zucchini in China, and moreover the first report of ToCV infection in zucchini in the world. Clearly, stringent management is needed to minimize the losses caused by these viruses in greenhouse operations in the region.

scholarly journals Axl-Gas6 Interaction Counteracts E1A-Mediated Cell Growth Suppression and Proapoptotic Activity

1999 ◽  
Vol 19 (12) ◽  
pp. 8075-8082 ◽  
Author(s):  
Wei-Ping Lee ◽  
Yong Liao ◽  
Dan Robinson ◽  
Hsing-Jien Kung ◽  
Edison T. Liu ◽  
...  
Keyword(s):  
Tyrosine Kinase ◽  
Tyrosine Kinases ◽  
Growth Suppression ◽  
Serum Deprivation ◽  
Transcriptional Level ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Pcr Products ◽  
Her 2 ◽  
Induced Apoptosis

ABSTRACT The adenovirus type 5 early region 1A gene (E1A) has previously been known as an immortalization oncogene because E1A is required for transforming oncogenes, such as ras andE1B, to transform cells in primary cultures. However, E1A has also been shown to downregulate the overexpression of theHer-2/neu oncogene, resulting in suppression of transformation and tumorigenesis induced by that oncogene. In addition, E1A is able to promote apoptosis induced by anticancer drugs, irradiation, and serum deprivation. Many tyrosine kinases, such as the epidermal growth factor receptor, Her-2/Neu, Src, and Axl, are known to play a role in oncogenic signals in transformed cells. To study the mechanism underlying the E1A-mediated tumor-suppressing function, we exploited a modified tyrosine kinase profile assay (D. Robinson, F. Lee, T. Pretlow, and H.-J. Kung, Proc. Natl. Acad. Sci. USA 93:5958–5962, 1996) to identify potential tyrosine kinases regulated by E1A. Reverse transcription (RT)-PCR products were synthesized with two degenerate primers derived from the conserved motifs of various tyrosine kinases. A tyrosine kinase downregulated by E1A was identified by analyzing the AluI-digested RT-PCR products. We isolated the DNA fragment of interest and found that E1A negatively regulated the expression of the transforming receptor tyrosine kinase Axl at the transcriptional level. To study whether downregulation of the Axl receptor is involved in E1A-mediated growth suppression, we transfectedaxl cDNA into E1A-expressing cells (ip1-E1A) to establish cells that overexpressed Axl. The Axl ligand Gas6 triggered a greater mitogenic effect in these ip1-E1A-Axl cells than in ip1-E1A control cells and protected the Axl-expressing cells from serum deprivation-induced apoptosis. These results indicate that downregulation of the Axl receptor by E1A is involved in E1A-mediated growth suppression and E1A-induced apoptosis and thereby contributes to E1A’s antitumor activities.

199 EXPRESSION OF HAPTOGLOBIN mRNA IN THE OVIDUCT DURING THE OESTRUS CYCLE OF SOWS

2013 ◽  
Vol 25 (1) ◽  
pp. 248
Author(s):  
M. C. Ramón ◽  
O. S. Acuña ◽  
M. J. Ruano ◽  
M. Avilés ◽  
M. J. Izquierdo-Rico
Keyword(s):  
Sus Scrofa ◽  
Luteal Phase ◽  
Acute Phase Protein ◽  
The Other ◽  
Corpora Lutea ◽  
Rt Pcr ◽  
Specific Primers ◽  
Oestrus Cycle ◽  
Pcr Product ◽  
Phase Protein

The haptoglobin is an acute phase protein that has been recently related with numerous events of mammalian reproduction. The objective of this study was to determine whether haptoglobin mRNA is expressed in the porcine oviduct and to analyse its expression during the different phases of the oestrus cycle. Porcine oviducts collected from a local abattoir were classified based on follicular morphology: prepuberal (containing only follicles 1 to 2 mm in diameter), preovulatory (containing 6 to 12 follicles 8 to 12 mm in diameter), post-ovulatory (containing 6 to 12 hemorrhagic corpora), and luteal phase (containing 6 to 12 corpora lutea). Total RNA was obtained by extracting scraps of isthmus-ampullar junction mucosa using RNAqueous® kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions and cDNA was synthesised with an oligo d(T) as primer. This cDNA was used as template in RT-PCR and quantitative PCR (qPCR) amplifications using specific primers (Fw: gctacgtggagcacatggtt and Rv: ggagattcttagccgtggtc for RT-PCR and Fw: ggtgatgcccatttgcctccct and Rv: cagccaccggcagcatgaca for qPCR) designed based on GenBank sequence for Sus scrofa haptoglobin (NM_214000). The amplification by RT-PCR resulted in a 312-bp amplicon. This PCR product was sequenced and a 100% of identity with porcine haptoglobin sequence deposited in GenBank database was confirmed. On the other hand, analysis by qPCR revealed that the haptoglobin mRNA expression was more elevated in luteal and post-ovulatory phases than in prepuber and preovulatory phases. In conclusion, the haptoglobin mRNA is present in porcine oviduct and could be considered as a progesterone-dependent transcript. The role played by this protein in the porcine oviduct remains to be investigated. This study was supported by MICINN (AGL2009-12512-C02-01-02).

Sign in / Sign up

Export Citation Format

Share Document