Etiology of bacterial diseases of young walnut trees in Serbia

In the summer and autumn of 2019-2020, young walnut orchards were monitored for the presence of bacterial diseases. Diseased walnut samples comprising trunks and branches with symptoms of vertical oozing canker (VOC), walnut bacterial blight (WBB) and superficial bark necrosis were collected from eight locations in Serbia. Based on phenotypic features, pathogenicity, and molecular assays using PCR with specific primers, 49 isolates obtained from samples showing VOC and WBB symptoms were identified as Xanthomonas arboricola pv. juglandis, while further two isolates obtained from bark necrosis were identified as Brenneria rubrifaciens. One tested X. a. pv. juglandis isolate obtained from a VOC sample produced deep cankers in the bark of inoculated trunks of young walnut trees (cultivars Chandler, Franquette and Sejnovo). Therefore, this is the first report of an association between X. a. pv. juglandis and VOC symptom in Serbia. Considering that X. a. pv. juglandis significantly endangers walnut production, the presence of this pathogen in walnut transplant imports needs to be assessed by an authorised laboratory. Furthermore, as this is also the first report of B. rubrifaciens on walnut trees in Serbia, it is noteworthy that this pathogen is not particularly harmful to young walnut trees.

Download Full-text

First Report of Xanthomonas arboricola Causing Bacterial Blight on Pecan Trees in Portugal

Plant Disease ◽

10.1094/pdis-03-18-0467-pdn ◽

2018 ◽

Vol 102 (12) ◽

pp. 2632 ◽

Cited By ~ 1

Author(s):

C. Fernandes ◽

R. Sousa ◽

F. Tavares ◽

L. Cruz

Keyword(s):

Bacterial Blight ◽

First Report ◽

Xanthomonas Arboricola

Download Full-text

First Report of Mosaic Disease Caused by Colombian datura virus on Solanum lycopersicum Plants Commercially Cultivated in Japan

Plant Disease ◽

10.1094/pdis-06-13-0668-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 698-698 ◽

Cited By ~ 1

Author(s):

Y. Tomitaka ◽

T. Usugi ◽

R. Kozuka ◽

S. Tsuda

Keyword(s):

Nucleotide Sequence ◽

Solanum Lycopersicum ◽

Mosaic Disease ◽

Causal Agent ◽

Cultivated Plants ◽

Rt Pcr ◽

Degenerate Primers ◽

Specific Primers ◽

Tomato Plants ◽

First Report

In 2009, some commercially grown tomato (Solanum lycopersicum) plants in Chiba Prefecture, Japan, exhibited mosaic symptoms. Ten plants from a total of about 72,000 cultivated plants in the greenhouses showed such symptoms. To identify the causal agent, sap from leaves of the diseased plants was inoculated into Chenopodium quinoa and Nicotiana benthamiana plants. Local necrotic lesions appeared on inoculated leaves of C. quinoa, but no systemic infection was observed. Systemic mosaic symptoms were observed on the N. benthamiana plants inoculated. Single local lesion isolation was performed three times using C. quinoa to obtain a reference isolate for further characterization. N. benthamiana was used for propagation of the isolate. Sap from infected leaves of N. benthamiana was mechanically inoculated into three individual S. lycopersicum cv. Momotaro. Symptoms appearing on inoculated tomatoes were indistinguishable from those of diseased tomato plants found initially in the greenhouse. Flexuous, filamentous particles, ~750 nm long, were observed by electron microscopy in the sap of the tomato plants inoculated with the isolate, indicating that the infecting virus may belong to the family Potyviridae. To determine genomic sequence of the virus, RT-PCR was performed. Total RNA was extracted from the tomato leaves experimentally infected with the isolate using an RNeasy Plant Mini kit (QIAGEN, Hilden, Germany). RT-PCR was performed by using a set of universal, degenerate primers for Potyviruses as previously reported (2). Amplicons (~1,500 bp) generated by RT-PCR were extracted from the gels using the QIAquick Gel Extraction kit (QIAGEN) and cloned into pCR-BluntII TOPO (Invitrogen, San Diego, CA). DNA sequences of three individual clones were determined using a combination of plasmid and virus-specific primers, showing that identity among three clones was 99.8%. A consensus nucleotide sequence of the isolate was deposited in GenBank (AB823816). BLASTn analysis of the nucleotide sequence determined showed 99% identity with a partial sequence in the NIb/coat protein (CP) region of Colombian datura virus (CDV) tobacco isolate (JQ801448). Comparison of the amino acid sequence predicted for the CP with previously reported sequences for CDV (AY621656, AJ237923, EU571230, AM113759, AM113754, and AM113761) showed 97 to 100% identity range. Subsequently, CDV infection in both the original and experimentally inoculated plants was confirmed by RT-PCR using CDV-specific primers (CDVv and CDVvc; [1]), and, hence, the causal agent of the tomato disease observed in greenhouse tomatoes was proved to be CDV. The first case of CDV on tomato was reported in Netherlands (3), indicating that CDV was transmitted by aphids from CDV-infected Brugmansia plants cultivated in the same greenhouse. We carefully investigated whether Brugmansia plants naturally grew around the greenhouses, but we could not find them inside or in proximity to the greenhouses. Therefore, sources of CDV inoculum in Japan are still unclear. This is the first report of a mosaic disease caused by CDV on commercially cultivated S. lycopersicum in Japan. References: (1) D. O. Chellemi et al. Plant Dis. 95:755, 2011. (2) J. Chen et al. Arch. Virol. 146:757, 2001. (3) J. Th. J. Verhoeven et al. Eur. J. Plant. Pathol. 102:895, 1996.

Download Full-text

First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China

Plant Disease ◽

10.1094/pdis-09-13-0953-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 702-702 ◽

Cited By ~ 1

Author(s):

B. Gao ◽

R. Y. Wang ◽

S. L. Chen ◽

X. H. Li ◽

J. Ma

Keyword(s):

Sweet Potato ◽

Dna Sequences ◽

Molecular Characteristics ◽

28S Rrna ◽

Storage Roots ◽

Specific Primers ◽

First Report ◽

Meloidogyne Enterolobii ◽

Meloidogyne Spp ◽

Meloidogyne Sp

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

First report of Cherry virus F infecting Japanese plum in Korea

Plant Disease ◽

10.1094/pdis-08-20-1725-pdn ◽

2020 ◽

Author(s):

Yeonhwa Jo ◽

Hoseong Choi ◽

Jin Kyong Cho ◽

Won Kyong Cho

Keyword(s):

Czech Republic ◽

High Throughput Sequencing ◽

Prunus Avium ◽

De Novo ◽

Protein Database ◽

Specific Primers ◽

The Czech Republic ◽

First Report ◽

Japanese Plum ◽

Leaf Spots

Cherry virus F (CVF) is a tentative member of the genus Fabavirus in the family Secoviridae, consisting of two RNA segments (Koloniuk et al. 2018). To date, CVF has been documented in only sweet cherry (Prunus avium) in the Czech Republic (Koloniuk et al. 2018), Canada, and Greece. In May 2014, we collected leaf samples from four symptomatic (leaf spots and dapple fruits) and two asymptomatic Japanese plum cultivars (Sun and Gadam) grown in an orchard in Hoengseong, South Korea, to identify viruses and viroids infecting plum trees. Total RNA from individual plum trees was extracted using two commercial kits: Fruit-mate for RNA Purification Kit (Takara, Shiga, Japan) and RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). We generated six mRNA libraries from the six different plum cultivars for RNA-sequencing using the TruSeq RNA Library Preparation Kit v2 (Illumina, CA, U.S.A.) as described previously (Jo et al. 2017). The mRNA libraries were paired-end (2 X 100 bp) sequenced with a HiSeq 2000 system (Macrogen, Seoul, Korea). The raw sequence reads were de novo assembled by Trinity program v. 2.8.6, with default parameters (Haas et al. 2013). The assembled contigs were subjected to BLASTX search against the non-redundant protein database in NCBI. Of the two asymptomatic cultivars, the transcriptome of asymptomatic plum cv. Gadam contained five contigs specific to CVF. Two and three contigs were specific to CVF RNA1 (2,571 reads, coverage 42.15%) and RNA2 (2,025 reads, coverage 53.04%), respectively. The size of these five contigs ranged from 241 to 5,986 bp. Contigs of 5,986 and 3,867 bp in length, referred to as CVF isolate Gadam RNA1 (GenBank MN896996) and RNA2 (GenBank MN896995), respectively, were subjected to BLASTP search against NCBI’s non-redundant protein database. The results showed that the polyprotein sequences of RNA1 and RNA2 shared 95.3% and 93.11% amino acid identities with isolates SwC-H_1a from the Czech Republic (GenBank acc. no. AWB36326) and Stac-3B_c8 from Canada (AZZ10055), respectively. To confirm the infection of CVF in cv. Gadam, RT-PCR was conducted using CVF RNA1-specific primers designed based on the CVF reference genome sequences (MH998210 and MH998216), including 5’-CCACCAAATAGGCAAGAGGTCAC-3’ (position 3190–3212) and 5’-CACAATCACCATCAATGGTCTCTGC-3’ (position 3742–3766), and CVF RNA2-specific primers, including 5’-CTGCTTTATGATGCTAGACATCAAGATG-3’ (position 1015–1042) and 5’-ACAATAGGCATGCTCATCTCAACCTC-3’ (position 1594–1619). We amplified 577-bp RNA1-specific and 605-bp RNA2-specific amplicons that were cloned and then performed Sanger sequencing. Sequencing of the cloned amplicons for isolate Gadam RNA1 (GenBank MN896993) and RNA2 (GenBank MN896994) revealed values of 99.48% and 99.17% nucleotide identity to that of RNA1 and RNA2 determined by high-throughput sequencing, respectively. Additionally, we tested five plants for each of the six plum cultivars grown in the same orchard. The detection of CVF was carried out through PCR using the primers and protocol described above. Of the 30 trees, CVF was detected in three trees of cv. Gadam by both primer pairs. To our knowledge, this is the first report of CVF infecting Japanese plum and the first report of the virus in Korea. However, its prevalence in other Prunus species, including apricot, European plum, and peach, should be further elucidated.

Download Full-text

First Report of Cucurbit yellow stunting disorder virus in Morocco

Plant Disease ◽

10.1094/pdis.2000.84.5.596c ◽

2000 ◽

Vol 84 (5) ◽

pp. 596-596 ◽

Cited By ~ 24

Author(s):

C. Desbiez ◽

H. Lecoq ◽

S. Aboulama ◽

M. Peterschmitt

Keyword(s):

Important Change ◽

Enzyme Linked Immunosorbent Assay ◽

Yellow Leaf ◽

Vegetable Crops ◽

Specific Primers ◽

First Report ◽

Large Populations ◽

Healthy Control ◽

Symptomless Plant ◽

Beet Pseudo Yellows Virus

In October, 1999, severe yellowing symptoms were observed in a melon (Cucumis melo L.) crop grown under plastic tunnels in the region of Agadir, Morocco. Large populations of whiteflies (Bemisia tabaci) were noticed during the early stages of the crop. At harvest, leaf samples were collected from two symptomatic plants and one symptomless plant. A mature yellow leaf was assayed from each symptomatic plant and for one of these two plants a younger leaf exhibiting only yellow spots. Cucurbit aphid-borne yellows virus, which causes similar symptoms in melons, was not detected by double-antibody sandwich enzyme-linked immunosorbent assay tests. Total RNA was extracted from fresh leaf tissues and submitted to reverse transcription and polymerase chain reaction with primers specific to two whitefly-transmissible viruses: Beet pseudo-yellows virus (BPYV) and Cucurbit yellow stunting disorder virus (CYSDV) (2). No amplification was obtained with BPYV-specific primers. In contrast, an expected 465-bp product was amplified in all samples from symptomatic plants with CYSDV-specific primers. No amplification was detected in samples from the symptomless plant nor from healthy control plants. B. tabaci-transmitted CYSDV has been reported in the Middle East, southwestern Europe, and North America (1,4). This is the first report of CYSDV in Morocco, and it follows the first report of another B. tabaci-transmitted virus, Tomato yellow leaf curl virus, in tomato (3), suggesting an important change in the viral pathosystem affecting vegetable crops in Morocco. References: (1) Kao et al. Plant Dis. 84:101, 2000. (2) Livieratos et al. Plant Pathol. 47:362, 1998. (3) Peterschmitt et al. Plant Dis. 83:1074, 1999. (4) Wisler et al. Plant Dis. 82:270, 1998.

Download Full-text

Severe Outbreak of Bacterial Blight Caused by Xanthomonas arboricola pv. corylina on Hazelnut cv. Tonda di Giffoni in Central Italy

Plant Disease ◽

10.1094/pdis-04-12-0375-pdn ◽

2012 ◽

Vol 96 (10) ◽

pp. 1577-1577 ◽

Cited By ~ 6

Author(s):

J. R. Lamichhane ◽

A. Fabi ◽

L. Varvaro

Keyword(s):

16S Rdna ◽

Bacterial Blight ◽

Central Italy ◽

Positive Control ◽

Negative Control ◽

Early Summer ◽

Nutrient Broth ◽

Universal Primers ◽

Bacterial Suspension ◽

Xanthomonas Arboricola

Hazelnut (Corylus avellana L.) is one of the most economically important tree crops in Italy. Xanthomonas arboricola pv. corylina (Xac) causes bacterial blight of hazelnut (4). During early summer 2010, a survey of three orchards (5 ha total) containing 4-year-old hazelnut trees (cv. Tonda di Giffoni) in Viterbo Province, Latium region, Italy, showed an 80 to 100% incidence of bacterial blight. Initially, water-soaked, necrotic spots were visible on leaves, fruit involucres, and shells, followed by lateral shoot dieback and development of cankers as longitudinal bark cracks on twigs, branches, and main trunks. Brown necrosis of the cambium was observed when bark tissue was removed. By late summer, necrosis had extended down main branches to the trunk, causing complete girdling of branches. Symptomatic tissues were collected from leaves, branches, and trunks, sections were surface-sterilized in 1% NaOCl for 1 min followed by two rinses in sterile distilled water (SDW, each for 1 min), and each section was then crushed in SDW. A loopful of the suspension was streaked onto yeast extract-dextrose-calcium carbonate agar medium (YDCA). Thirty six (12 from each type of tissue) yellow-mucoid, shiny, round bacterial colonies, each approximately 2 mm in diameter, were subcultured on YDCA. All strains were gram-negative and aerobic; negative for indole, lecithinase, urease, tyrosinase, and nitrate reduction; and positive for catalase, growth in 2% NaCl in nutrient broth, and growth at 35°C. All strains produced dark green pigment on succinate-quinate (SQ) medium. Inoculum of each of 15 isolates was prepared in nutrient broth, and washed cells from late log-phase cultures used to prepare a bacterial suspension of each isolate for inoculation of 2-year-old potted hazelnut plants cv. Tonda di Giffoni. A suspension of 106 CFU/ml for each isolate was sprayed onto leaves (10 ml/plant), and drops of inoculum were placed on wounds made on twigs with a sterile scalpel (0.10 μl/wound). For each isolate, three plants were inoculated per inoculation method. Inoculations with two reference strains of Xac (Xaco 1 from central Italy (3) and NCPPB 2896 from England) and SDW were performed on the same number of plants for positive and negative control treatments, respectively. Inoculated plants were maintained at 26 ± 1°C in a greenhouse. After 21 days, all inoculated plants had developed symptoms on leaves, while cankers developed on twigs after 40 days. Positive control plants developed the same symptoms, while negative control plants remained asymptomatic. Bacteria recovered from lesions on plants inoculated with the test strains or positive control strains had the same morphological and physiological characteristics as the original strains. No bacteria were recovered from negative control plants. Total DNA was extracted from bacterial suspensions and 16S rDNA amplified using universal primers (2). Sequences (GenBank Accession Nos. JQ861273, JQ861274, and JQ861275 for strains Xaco VT3 to VT5) had 99 to 100% identity with 16S rDNA sequences of Xac strains in GenBank. In Italy, Xac was reported by Petri in 1932 in Latium, and later in other regions on several hazelnut cultivars (1). However, to our knowledge, this is the first report of the disease causing severe damage in Italy. References: (1) M. Fiori et al. Petria 16:71, 2006. (2) J. R. Lamichhane et al. Plant Dis. 95:221, 2011. (3) J. R. Lamichhane et al. Acta Horticol.:In press. 2012. (4) OEPP/EPPO Bull. 179:179, 2004.

Download Full-text

First Report of Colletotrichum acutatum on Tomato and Apple Fruits in the Czech Republic

Plant Disease ◽

10.1094/pdis-10-11-0849-pdn ◽

2012 ◽

Vol 96 (5) ◽

pp. 769-769 ◽

Cited By ~ 4

Author(s):

J. Víchová ◽

B. Staňková ◽

R. Pokorný

Keyword(s):

Czech Republic ◽

Tomato Fruit ◽

Colletotrichum Acutatum ◽

Distilled Water ◽

Species Determination ◽

Specific Primers ◽

The Czech Republic ◽

First Report ◽

Pcr Products ◽

Apple Fruits

Apple (Malus domestica Borkh.) is a fruit traditionally grown in the Czech Republic, and tomatoes (Solanum lycopersicum Mill.), too, are widely raised in this region. Colletotrichum acutatum J. H. Simmonds is a polyphagous fungal plant pathogen. Earlier, this pathogen caused disease on strawberry in the Czech Republic (2), and now it has become an important pathogen on safflower (4). During the 2010 harvest, anthracnose symptoms were noticed on the fruits of apple and tomato. Infected apples fruits (localities Velká Bíteš and Znojmo) and tomatoes (localities Velká Bíteš and Žabčice) were collected. Typical symptoms on fruit surfaces were round, brown, shriveled and sunken spots, 1.2 to 2.0 cm, with orange conidial masses appearing on the spots. A fungus was isolated from each host on potato dextrose agar and cultured at 25 ± 2°C for 10 days. Mycelium was superficial, partly immersed, and white to gray with occurrence of orange conidial masses. Conidia of the tomato and apple isolates were colorless and fusiform. The size of conidia from the apple and tomato isolates, respectively, ranged from 11 to 15 × 2.5 to 3.5 μm and 11 to 16 × 2.5 to 4 μm. Morphological characteristics suggested that the isolated fungi was a Colletotrichum sp. To fulfill Koch's postulates, healthy tomato and apple fruits were disinfected with 3% sodium hypochlorite for 2 min and rinsed in sterile distilled water. Fruits were pinpricked with a sterile needle and 10 μl of a spore suspension (1 × 105 conidia ml–1) was inoculated by pipetting into the wound. Control fruits were treated with sterile distilled water. The fruits were transferred to a growth cabinet and maintained at a temperature of 25 ± 2°C, relative humidity of 70 ± 5%, and a photoperiod of 12 h. Similar disease symptoms as in the collected fruits were observed on tomato fruits at 7 days and apple fruits at 20 days after inoculation, while no symptoms appeared on control fruits. The pathogen was reisolated from infected fruits. Species determination of the isolates was confirmed by PCR. Specific primers designed in region ITS1, the 5.8S RNA gene, and region ITS2 of the pathogen DNA were selected. Specific primers CaInt2 and ITS4 were used to identify C. acutatum (3), and primers CgInt and ITS4 were used to determine C. gloeosporioides isolate CCM 177 (1), which was used as a control. Our isolates yielded PCR products (490 bp) only with primers designed for C. acutatum. The C. gloeosporioides isolate yielded a PCR product (450 bp) only with CgInt and ITS4 primers. PCR products were sequenced and identified with the BLAST program. The sequence of the tomato fruit isolate (Accession No. JN676199) and apple fruit isolate (Accession No. JN676198) matched with 100% similarity to the C. acutatum sequences in GenBank. The control isolate of C. gloeosporioides matched 100% to sequences AJ749682 and AJ749692. To our knowledge, this is the first report of C. acutatum on tomato and apple fruits in the Czech Republic. This pathogen can endanger the production and storage of apples and tomatoes in this region. References: (1) P. R. Mills et al. FEMS Microbiol. Lett. 98:137, 1992. (2) D. Novotný et al. Plant Dis. 91:1516, 2007. (3) S. Sreenivasaprasad et al. Plant Pathol. 45:650, 1996. (4) J. Víchová et al. Plant Dis. 95:79, 2011.

Download Full-text

First Report of Guignardia citricarpa Associated with Citrus Black Spot on Sweet Orange (Citrus sinensis) in North America

Plant Disease ◽

10.1094/pdis-01-12-0101-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1225-1225 ◽

Cited By ~ 31

Author(s):

T. S. Schubert ◽

M. M. Dewdney ◽

N. A. Peres ◽

M. E. Palm ◽

A. Jeyaprakash ◽

...

Keyword(s):

North America ◽

Sweet Orange ◽

Black Spot ◽

The United States ◽

Yield Reduction ◽

Rrna Gene ◽

Specific Primers ◽

Oatmeal Agar ◽

First Report ◽

Citrus Black Spot

In March 2010, citrus black spot symptoms were observed on sweet orange trees in a grove near Immokalee, FL. Symptoms observed on fruit included hard spot, cracked spot, and early virulent spot. Hard spot lesions were up to 5 mm, depressed with a chocolate margin and a necrotic, tan center, often with black pycnidia (140 to 200 μm) present. Cracked spot lesions were large (15 mm), dark brown, with diffuse margins and raised cracks. In some cases, hard spots formed in the center of lesions. Early virulent spot lesions were small (up to 7 mm long), bright red, irregular, indented, and often with many pycnidia. In addition, small (2 to 3 mm), elliptical, reddish brown leaf lesions with depressed tan centers were observed on some trees with symptomatic fruit. Chlorotic halos appeared as they aged. Most leaves had single lesions, occasionally up to four per leaf. Tissue pieces from hard spots and early virulent spots were placed aseptically on potato dextrose agar (PDA), oatmeal agar, or carrot agar and incubated with 12 h of light and dark at 24°C. Cultures that grew colonies within a week were discarded. Fourteen single-spore cultures were obtained from the isolates that grew slower than the Guignardia mangiferae reference cultures, although pycnidia formed more rapidly in the G. mangiferae cultures (1). No sexual structures were observed. Cultures on half-PDA were black and cordlike with irregular margins with numerous pycnidia, often bearing white cirrhi after 14 days. Conidia (7.1 to 7.8 × 10.3 to 11.8 μm) were hyaline, aseptate, multiguttulate, ovoid with a flattened base surrounded by a hyaline matrix (0.4 to 0.6 μm) and a hyaline appendage on the rounded apex, corresponding to published descriptions of G. citricarpa (anomorph Phyllosticta citricarpa) (1). A yellow pigment was seen in oatmeal agar surrounding G. citricarpa, but not G. mangiferae colonies as previously reported (1,2). DNA was extracted from lesions and cultures and amplified with species-specific primers (2). DNA was also extracted from G. mangiferae and healthy citrus fruit. The G. citricarpa-specific primers produced a 300-bp band from fruit lesions and pure cultures. G. mangiferae-specific primers produced 290-bp bands with DNA from G. mangiferae cultures. The internally transcribed spacer (ITS) of the rRNA gene, translation-elongation factor (TEF), and actin gene regions were sequenced from G. citricarpa isolates and deposited in GenBank. These sequences had 100% homology with G. citricarpa ITS sequences from South Africa and Brazil, 100% homology with TEF, and 99% homology with actin of a Brazilian isolate. Pathogenicity tests with G. citricarpa were not done because the organism infects immature fruit and has an incubation period of at least 6 months (3). In addition, quarantine restrictions limit work with the organism outside a contained facility. To our knowledge, this is the first report of black spot in North America. The initial infested area was ~57 km2. The disease is of great importance to the Florida citrus industry because it causes serious blemishes and significant yield reduction, especially on the most commonly grown ‘Valencia’ sweet orange. Also, the presence of the disease in Florida may affect market access because G. citricarpa is considered a quarantine pathogen by the United States and internationally. References: (1) R. P. Baayen et al. Phytopathology 92:464, 2002. (2) N. A. Peres et al. Plant Dis. 91:525, 2007 (3) R. F. Reis et al. Fitopath Bras. 31:29, 2006.

Download Full-text

New Records of Antarctic Tardigrada with Comments on Interpopulation Variability of the Paramacrobiotus fairbanksi Schill, Förster, Dandekar and Wolf, 2010

Diversity ◽

10.3390/d12030108 ◽

2020 ◽

Vol 12 (3) ◽

pp. 108 ◽

Cited By ~ 4

Author(s):

Łukasz Kaczmarek ◽

Monika Mioduchowska ◽

Uroš Kačarević ◽

Katarzyna Kubska ◽

Ivan Parnikoza ◽

...

Keyword(s):

Twentieth Century ◽

Southern Hemisphere ◽

Genetic Markers ◽

New Records ◽

Specific Primers ◽

First Report ◽

Interpopulation Variability ◽

Different Populations

Studies on Antarctic tardigrades started at the beginning of the twentieth century and have progressed very slowly and ca. 75 tardigrade species are known from this region. Paramacrobiotus fairbanksi was described from USA based on genetic markers and later reported from Italy, Poland, and Spain. The “everything is everywhere” hypothesis suggests that microscopic organisms have specific features which help them to inhabit most of environments and due to this they can be considered cosmopolitan. In the present paper, we report eight tardigrade taxa from Antarctic, including the first report of Pam. fairbanksi from Southern Hemisphere, which could suggest that the “everything is everywhere” hypothesis could be true, at least for some tardigrade species. Moreover, we also genetically and morphologically compare a few different populations of Pam. fairbanksi. The p-distances between COI haplotypes of all sequenced Pam. fairbanksi populations from Antarctica, Italy, Spain, USA and Poland ranged from 0.002% to 0.005%. In the case of COI polymorphism analyses, only one haplotype was observed in populations from Antarctica, USA and Poland, two haplotypes were found in population from Spain, and six haplotypes were observed in population from Italy. We also found some statistically significant morphometrical differences between the populations of Pam. fairbanksi from different regions and designed a new specific primers for Paramacrobiotus taxa.

Download Full-text