SURVEY OF PARASITIC WEEDS (OROBANCHE SPP.) ASSOCIATED WITH BRINJAL (Solanum melongena) IN BANDA DISTRICT OF UTTAR PRADESH INDIA

2020 ◽  
Vol 27 (2) ◽  
pp. 93-101
Author(s):  
GULWAIZ AKHTER ◽  
TABREIZ AHMAD KHAN
Keyword(s):  
Disease Incidence ◽  
Solanum Melongena ◽  
Uttar Pradesh ◽  
Frequency Of Occurrence ◽  
Maximum Frequency ◽  
Minimum Frequency ◽  
Parasitic Weeds

Three Orobanche spp. viz., O. aegyptiaca, O. cernua and O. ramosa were found to be associated with S. melongena in Banda district. However, the concomitant infestation of O. aegyptiaca with O. cernua and/ or O. ramosa in brinjal plants was not noticed. Moreover some of brinjal fields showed the infestation of O. aegyptiaca with either O. cernua or O. ramose. The infestation of O. aegyptiaca in brinjal plant was recorded in all the twenty examined localities. The highest and lowest disease incidence in brinjal plants was found in Chilla and Gazipur, respectively. Whereas, the maximum and minimum frequency of occurrence of O. aegyptiaca was found in Kurrahi and Palhari. Out of twenty localities, the infestation of O. cernua in brinjal was observed in fourteen localities. The greatest disease incidence and frequency of occurrence of O. cernua were recorded Jakhni and Gazipur. Whereas, the lowest disease incidence and frequency of occurrence of O. cernua were noticed in Hardauli and Jamwara, respectively. Moreover, the infestation of O. ramosa in brinjal plants was found in only nine localities of Banda district. The highest and lowest disease incidence due to O. ramosa in brinjal was recorded in Gazipur and Lakhanpur, respectively. However, maximum frequency of occurrence of O. ramosa was found in Jaspura and the minimum in Mahua. In entire Banda district, 68.10% of the surveyed fields were infested with broomrapes. The highest disease incidence and frequency of occurrence of O. aegyptiaca were recorded in brinjal followed by O. cernua and O. ramosa.

scholarly journals Molecular characterization of chickpea chlorotic dwarf virus and peanut witches’ broom phytoplasma associated with chickpea stunt disease and identification of new host crops and leafhopper vectors in India

3 Biotech ◽  
2021 ◽  
Vol 11 (3) ◽  
Author(s):  
Madem Gurivi Reddy ◽  
Virendra Kumar Baranwal ◽  
Doddachowdappa Sagar ◽  
Govind Pratap Rao
Keyword(s):  
Sequence Comparison ◽  
Disease Incidence ◽  
Uttar Pradesh ◽  
Rflp Analysis ◽  
Dwarf Virus ◽  
Rrna Gene ◽  
New Delhi ◽  
New Host ◽  
Severe Stunting ◽  
Virtual Rflp

AbstractAn investigation was carried out to identify and characterize the phytoplasma and viruses associated with the chickpea varieties showing severe stunting, leaf reddening, yellowing and phyllody symptoms during the summer season of 2018–2019 and 2019–2020 in eight states of India. The average disease incidence was recorded from 3 to 32% in different states. The presence of chickpea chlorotic dwarf virus (CpCDV) was confirmed in thirty-seven chickpea samples by amplification of CpCDV coat protein gene and sequence comparison analysis. No record of association of luteovirus, polerovirus and cucumovirus could be detected in any of the symptomatic chickpea samples by RT-PCR assay. Brassica nigra, B. juncea, Lens culinaris, two weeds (Heteropogan contartus, Aeschynomene virginica) and one leafhopper (Amarasca biguttula) were identified as new putative hosts for CpCDV. Association of peanut witches’ broom phytoplasma was confirmed in twenty-eight chickpea samples, Sesamum indicum, five weeds hosts and two leafhopper species (Exitianus indicus, Empoasca motti) using nested PCR assays with primer pairs P1/P7 and R16F2n/R16Rn. The results of phytoplasma association in plants and leafhopper samples were further validated by using five multilocus genes (secA, rp, imp, tuf and secY) specific primers. Sequence comparison, phylogenetic and virtual RFLP analysis of 16S rRNA gene and five multilocus genes confirmed the identity of association of 16SrII-C and 16SrII-D subgroups of phytoplasmas strain with chickpea samples collected from Andhra Pradesh (AP), Telangana, Karnataka, Madhya Pradesh, Uttar Pradesh and New Delhi. Mixed infection of phytoplasma (16SrII-D) and CpCDV was also detected in symptomatic chickpea samples from AP and Telangana. The reports of association of 16SrII-C subgroup phytoplasma in chickpea and 16SrII-D subgroup phytoplasma in C. sparsiflora and C. roseus are the new host records in world and from India, respectively.

Hishimonus phycitis. [Distribution map].

2015 ◽  
Author(s):  
Keyword(s):  
United Arab Emirates ◽  
Tamil Nadu ◽  
Andhra Pradesh ◽  
West Bengal ◽  
Solanum Melongena ◽  
Uttar Pradesh ◽  
Distribution Map ◽  
Jammu And Kashmir ◽  
New Distribution ◽  
Hishimonus Phycitis

Abstract A new distribution map is provided for Hishimonus phycitis (Distant). Hemiptera: Cicadellidae. Hosts: Citrus spp. and aubergine (Solanum melongena). Information is given on the geographical distribution in Asia (China, Hainan, India, Andhra Pradesh, Bihar, Delhi, Gujarat, Haryana, Jammu and Kashmir, Karnataka, Kerala, Maharashtra, Meghalaya, Indian Punjab, Tamil Nadu, Uttar Pradesh, West Bengal, Iran, Oman, Pakistan, Philippines, Sri Lanka, Taiwan, Thailand and United Arab Emirates).

Tinnitus as a Source of Internal Noise

1986 ◽  
Vol 29 (3) ◽  
pp. 400-406 ◽  
Author(s):  
M. J. Penner
Keyword(s):  
Hearing Loss ◽  
Sensorineural Hearing Loss ◽  
Psychometric Function ◽  
Correct Response ◽  
Internal Noise ◽  
Average Frequency ◽  
Maximum Frequency ◽  
Minimum Frequency ◽  
Frequency Matching ◽  
Pure Tones

For 7 patients with sensorineural hearing loss and tinnitus, pitch and loudness matches were made to the tinnitus. These matches were followed by measurement of three psychometric functions (probability of a correct response as a function of signal level) for pure tones, one in the presumed tinnitus region (i.e., at the average frequency matching the pitch of the tinnitus), one below the minimum frequency of the matches, and one above the maximum frequency of the matches. The data reveal (a) that pitch-loudness matches are usually quite variable and (b) that the slope of the psychometric function is flattest in the presumed tinnitus region. The first result is consistent with the idea that tinnitus is an unstable signal. The second result is consistent with the notion that the unstable tinnitus acts as a source of "internal" noise.

scholarly journals Incidence of Root-Knot Nematode (Meloidogyne graminicola) and Resulting Crop Losses in Paddy Rice in Northern India

Plant Disease ◽  
2020 ◽  
Vol 104 (1) ◽  
pp. 186-193 ◽  
Author(s):  
Mujeebur Rahman Khan ◽  
Faheem Ahamad
Keyword(s):  
Yield Loss ◽  
Disease Incidence ◽  
Uttar Pradesh ◽  
Rice Paddy ◽  
Paddy Fields ◽  
Root Knot Nematode ◽  
Meloidogyne Graminicola ◽  
Northern India ◽  
Soil Population ◽  
Rice Paddy Fields

Surveys of major rice growing districts in the state of Uttar Pradesh in Northern India were conducted for 3 consecutive years during 2013 to 2015 under a government-funded major research project to determine the frequency of occurrence and disease incidence of the rice root-knot nematode, Meloidogyne graminicola, in rice paddy fields. More than 800 paddy fields from 88 Tehsils (divisions within a district) in 18 major rice growing districts in Uttar Pradesh were surveyed, where M. graminicola was associated with root-knot disease in rice paddy fields based on morphological and molecular characterization of juveniles and adults. The highest frequency of disease in rice fields was observed in Aligarh (44.6%), followed by Muzaffarnagar, Shahjahanpur, and Kheri Lakhimpur (29.3, 28.0, and 27.4%, respectively). Maximum disease incidence was also recorded in Aligarh (44.6%), followed by Sultanpur, Mainpuri, and Muzaffarnagar (5.7, 5.2, and 4.5, respectively). Gall index and egg mass index values (on a 0 to 10 scale) were highest in Aligarh (3.5 and 2.1, respectively), followed by Muzaffarnagar (2.6 and 2.0) and Mainpuri (2.3 and 1.8). The average soil population of M. graminicola was highest in Aligarh (3,851 ± 297 second-stage juveniles [J2]/kg of soil), followed by Muzaffarnagar (2,855 ± 602 J2/kg of soil), whereas the lowest population was recorded in Barabanki (695 ± 400 J2/kg of soil) at the time of harvesting. Relative yield losses were also determined, and the highest yield loss attributed to M. graminicola infestation was recorded in Aligarh (47%). The yield loss was linearly correlated with the soil population density of M. graminicola and disease incidence.

scholarly journals Emerging scenario of important mite pests in north India*

Zoosymposia ◽  
2011 ◽  
Vol 6 (1) ◽  
pp. 170-179 ◽  
Author(s):  
JANARDAN SINGH ◽  
MAHADEVAN RAGHURAMAN
Keyword(s):  
Solanum Melongena ◽  
Uttar Pradesh ◽  
Panonychus Ulmi ◽  
North India ◽  
Ziziphus Mauritiana ◽  
Polyphagotarsonemus Latus ◽  
Northern India ◽  
Pyrethroid Pesticides ◽  
Eastern Uttar Pradesh ◽  
Network Project

The results generated by theMulti Locational Project onAgriculturalAcarology,All India Coordinated Project onAgriculturalAcarology, Network Project onAgriculturalAcarology and the Network Project on Insect Biosystematics since 1983 are described, highlighting the most important mite pests of north India. The following species are considered major pests in that region: Tetranychidae - Eutetranychus orientalis (Klein), Oligonychus coffeae (Nietner), Tetranychus ludeni Zacher, Tetranychus neocaledonicus André and Tetranychus urticae Koch; Eriophyidae - Aceria litchii (Keifer) and Aceria mangiferae (Sayed); Tarsonemidae - Polyphagotarsonemus latus (Banks). Other 16 species in those families as well as in the Tenuipalpidae are also considered important as plant pests in this area of India.Among the tetranychids, T. ludeni was identified as an alarming problem in 1987. Many outbreaks of this pest were recorded from 1988 to 1990 on cowpea [Vigna unguiculata (L.)Walp], an important summer vegetable of eastern Uttar Pradesh. Okra (Abelmoschus esculentus Moench) and eggplant (Solanum melongena L.), particularly when grown in the summer, have serious problems with T. urticae and Tetranychus macfarlanei Baker & Pritchard. Panonychus ulmi (Koch) has emerged as a serious problem on the expanding cultivation of apple in Himachal Pradesh, whereas Petrobia latens (Muller) populations are increasing in dryland cultivation of Rajasthan, attaining serious pest status mainly on wheat and coriander. Among the tarsonemids, a serious increase in P. latus on chilli has coincided with the growing cultivation of this crop, whereas increasing population levels of Steneotarsonemus spinki Smiley have caused severe damage to rice since its recent discovery in northern India. Serious problems have also been caused to tomato by the eriophyid Aceria lycopersici (Wolf) and to ber (Ziziphus mauritiana Lam.) by the tenuipalpid Larvacarus transitans (Ewing), an emerging serious pest of in Rajasthan area. The reason attributed to the increasing mite infestations is the widespread and continuous use of synthetic pyrethroid pesticides, which negatively affect the predatory mite fauna. The paper focuses on problems of mite outbreak and suggests future thrust for use of predatory mites as bio-agents for integrated mite control.

scholarly journals First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Fujian Province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jinjie Hu ◽  
Qian Zhou ◽  
Chaohui Shi ◽  
Yexin Ke ◽  
Shun Xiao ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Solanum Melongena ◽  
Stem Canker ◽  
Morphological Characters ◽  
Single Spore ◽  
Specific Primers ◽  
Fujian Province ◽  
Phomopsis Longicolla ◽  
Fungal Isolation ◽  
First Report

Eggplant (Solanum melongena L.) is one of the most popular vegetable in China. In July 2019, a serious stem canker disease of eggplant cv. Hangqieyiha has been found in commercial fields in Pingnan County, Fujian Province. The disease incidence ranged from 38% to 72%. The symptoms were found on stems but not on fruits. At first the lesions are small, more or less circular, later becoming elongated, blackish-brown lesions, eventually containing pycnidia. When stem girdling occurs, the shoot above the infected area wilts and dries up. The teleomorph of the fungus has not been encountered in sympotomatic stem. Single-conidial isolate has been obtained by using routine fungal-isolation methods and single-spore purification technique. The fungus was cultivated on potato dextrose agar (PDA), incubated under 12h/12h cycles of light and darkness until sporulation to determine. The fungus initially produced white fluffy aerial hyphae, forming relatively dense concentric pattern colony, which subsequently exhibited yellow-green pigmentation. Pycnidias had globose locules and prominent beaks, which immersed in medium, black, solitary, discoid or irregular. Conidiophores were colorless, separated, branched, 10.0 to 20.0 × 1.0 to 2.5 μm. Alpha-conidia were single-celled, ellipsoidal to fusiform, guttulate, 5.4 to 8.7 × 1.5 to 3.2 μm. Beta-conidia were found occasionally in older stock cultures, hyaline, filiform, hamate, and 17.0 to 26.9 × 0.86 to 1.23 μm. Based on these morphological characters, the fungus was identified as Phomopsis longicolla (Hobbs et al., 1985). The rDNA－ITS of the isolate FAFU01 was amplified with primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al., 1990)，and A 578 bp sequence obtained (GenBank Accession No. MW380387 ) was 96% to 98.3% identical to the known sequence of P. longicolla or Diaporthe longicolla in GenBank. For further confirmation, P. longicolla specific primers Phom.I /Phom.II (GAGCTCGCCACTAGATTTCAGGG/GGCGGCCAACCAAACTCTTGT) (Zhang et al., 1997) were used and a 337-bp amplification product was obtained which was previously reported only for P. longicolla, whereas no product was amplified from control. Based on these morphological and molecular characters, the fungus was identified as P. longicolla. In greenhouse tests, each of 35-day-old plants of eggplant cv. Hangqieyihao was maintained in 30-cm-diameter pot. Healthy stem on the plants was wounded by pinpricking. Both wounded and non-wounded stems were inoculated respectively with mycelial plugs (4 mm in diameter) from a 7-day-old PDA culture or PDA medium plugs as controls, with six replicates. The plants were covered with plastic bags to maintain high relative humidity for two days. Four days after inoculation, the plugs were washed from the stems. Thirty-five days after inoculation, canker lesions and small, black pycnidias, which were similar to those in the field, were observed on the surface of non-wounded and wounded healthy stems inoculated with pathogen, whereas all the control stems remained healthy. The fungi was re-isolated from the infected stems of plants and was further confirmed with the species-specific primers. These results confirmed the fungus’s pathogenicity. This is the first report of P. longicolla causing stem canker in eggplant in Fujian Province, China.

scholarly journals Stress signals of water scavenger beetles Berosus frontifoveatus Kuwert, 1888 and Berosus spinosus Steven, 1808 (Coleoptera: Hydrophilidae)

2021 ◽  
Vol 21 (3) ◽  
pp. 309-316
Author(s):  
Elena Yu. Rodionova ◽  
◽  
Alexey S. Sazhnev ◽  
Semen Yu. Kustov ◽  
Alexey A. Miroliubov ◽  
...  
Keyword(s):  
Acoustic Signals ◽  
Dominant Frequency ◽  
Russian Language ◽  
Frequency Of Occurrence ◽  
Maximum Frequency ◽  
Ecological Studies ◽  
The Family ◽  
Stress Signals ◽  
The Russian Language ◽  
Language Literature

The study of acoustic signals from various representatives of insects, and in particular coleopterans, has a long history. In the Russian-language literature, systematic, faunistic and ecological studies on aquatic beetles, including those on the family Hydrophilidae, are widely known; however, studies on the bioacoustics of the coleopteran group are quite rare. The aim of our study was to study stress signals of two species of Hydrophilidae – Berosus frontifoveatus Kuwert, 1888 and Berosus spinosus Steven, 1808. The sounds of adults were recorded using a Behringer ECM8000 measuring condenser microphone. The sounds of B. spinosus males have a maximum frequency of occurrence in the range of 3729.31–4013.75 Hz, sounds of B. frontifoveatus is 4895.42–5842.76 Hz. The sounds of B. spinosus females have a maximum frequency of occurrence between 2585.98 and 2807.82 Hz. The sounds of B. frontifoveatus females have a maximum performance of the dominant frequency in the range of 2745.21–3476.23 Hz.

scholarly journals Investigations on annual spreading of viruses infecting cucurbit crops in Uttar Pradesh State, India

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Shweta Kumari ◽  
Nagendran Krishnan ◽  
Vikas Dubey ◽  
Bappa Das ◽  
Koshlendra Kumar Pandey ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Virus Disease ◽  
Integrated Management ◽  
Disease Incidence ◽  
Management Strategies ◽  
Evolutionary Relationship ◽  
Central Zone ◽  
Uttar Pradesh ◽  
Virus Infections ◽  
Potyvirus Species

AbstractDuring 2018 an intensive study was conducted to determine the viruses associated with cucurbitaceous crops in nine agroclimatic zones of the state of Uttar Pradesh, India. Total of 563 samples collected and analysed across 14 different cucurbitaceous crops. The results showed the dominance of Begomovirus (93%) followed by Potyvirus (46%), cucumber green mottle mosaic virus (CGMMV-39%), Polerovirus (9%), cucumber mosaic virus (CMV-2%) and Orthotospovirus (2%). Nearly 65% of samples were co-infected with more than one virus. Additionally, host range expansion of CMV, CGMMV and polerovirus was also observed on cucurbit crops. A new potyvirus species, zucchini tigre mosaic virus, earlier not documented from India has also been identified on five crops during the study. Risk map generated using ArcGIS for virus disease incidence predicted the virus severity in unexplored areas. The distribution pattern of different cucurbit viruses throughout Uttar Pradesh will help identify the hot spots for viruses and will facilitate to devise efficient and eco-friendly integrated management strategies for the mitigation of viruses infecting cucurbit crops. Molecular diversity and evolutionary relationship of the virus isolates infecting cucurbits in Uttar Pradesh with previously reported strains were understood from the phylogenetic analysis. Diverse virus infections observed in the Eastern Plain zone, Central zone and North-Eastern Plain zone indicate an alarming situation for the cultivation of cucurbits in the foreseeable future.

Diaporthe vexans. [Distribution map].

2008 ◽  
Author(s):  
Keyword(s):  
New Caledonia ◽  
Solanum Melongena ◽  
Uttar Pradesh ◽  
French Polynesia ◽  
Virgin Islands ◽  
Peninsular Malaysia ◽  
Distribution Map ◽  
Jammu And Kashmir ◽  
Brunei Darussalam ◽  
Main Host

Abstract A new distribution map is provided for Diaporthe vexans Gratz. Fungi: Ascomycota: Diaporthales. Main host: aubergine (Solanum melongena). Information is given on the geographical distribution in Europe (Romania), Asia (Bangladesh, Brunei Darussalam, China, Fujian, Gansu, Guangdong, Hebei, Heilongjiang, Hong Kong, Hubei, Hunan, Jiangsu, Jiangxi, Jilin, Liaoning, Nei Menggu, Shaanxi, Shandong, Shanxi, Sichuan, Xinjiang, Yunnan, Zhejiang, India, Andaman and Nicobar Islands, Andhra Pradesh, Assam, Chandigarh, Delhi, Haryana, Himachal Pradesh, Jammu and Kashmir, Karnataka, Kerala, Madhya Pradesh, Maharashtra, Orissa, Punjab, Uttar Pradesh, Uttarakhand, West Bengal, Iran, Iraq, Japan, Korea Republic, Laos, Malaysia, Peninsular Malaysia, Sabah, Sarawak, Maldives, Myanmar, Pakistan, Philippines, Saudi Arabia, Taiwan), Africa (Algeria, Kenya, Mauritius, Senegal, Seychelles, South Africa, Tanzania, Zambia, Zimbabwe), North America (Canada, British Columbia, Ontario, Quebec, Mexico, USA, Alabama, Delaware, Florida, Hawaii, Iowa, Louisiana, Mississippi, New Jersey, North Carolina, Oklahoma, Texas, Virginia, Washington, West Virginia), Central America and Caribbean (Antigua and Barbuda, Barbados, Bermuda, Costa Rica, Cuba, Dominican Republic, El Salvador, Guadeloupe, Guatemala, Haiti, Jamaica, Panama, Puerto Rico, United States Virgin Islands), South America (Argentina, Brazil, Ceara, Parana, Pernambuco, Sao Paulo, Colombia, Venezuela), Oceania (Australia, Queensland, Fiji, French Polynesia, Guam, New Caledonia).

Ralstonia solanacearum race 1. [Distribution map].

1999 ◽  
Author(s):  
Keyword(s):  
Ralstonia Solanacearum ◽  
Russian Far East ◽  
Far East ◽  
Solanum Melongena ◽  
South Australia ◽  
Uttar Pradesh ◽  
Peninsular Malaysia ◽  
Distribution Map ◽  
Arachis Hypogea ◽  
Race 1

Abstract A new distribution map is provided for Ralstonia solanacearum (Smith) Yabuuchi et al. race 1 Bacteria Hosts: Tobacco (Nicotiana tabacum), potato (Solanum tuberosum), tomato (Lycopersicon esculentum), Capsicum, aubergine (Solanum melongena), other solanaceous crops, groundnut (Arachis hypogea), diploid banana (Musa spp.). Information is given on the geographical distribution in EUROPE, Bulgaria, Moldova, Netherlands, Poland, Romania, Russian Far East, Southern Russia, Ukraine, ASIA, Bangladesh, China, Anhui, Fujian, Guangdong, Guangxi, Hebei, Henan, Hong Kong, Hubei, Hunan, Jiangsu, Jiangxi, Shandong, Sichuan, Yunnan, Zhejiang, Republic of Georgia, India, Andhra Pradesh, Assam, Himachal Pradesh, Karnataka, Kerala, Maharashtra, Nagaland, Orissa, Punjab, Uttar Pradesh, West Bengal, Indonesia, Irian Jaya, Java, Sulawesi, Sumatra, Iran, Japan, Honshu, North Korea, Korea Republic, Lebanon, Malaysia, Peninsular Malaysia, Sabah, Sarawak, Myanmar, Nepal, Pakistan, Philippines, Singapore, Sri Lanka, Taiwan, Thailand, Turkey, Vietnam, AFRICA, Angola, Burundi, Congo Democratic Republic, Ethiopia, Gambia, Kenya, Libya, Madagascar, Malawi, Mauritius, Morocco, Nigeria, Rwanda, Senegal, Sierra Leone, Somalia, South Africa, Tanzania, Uganda, Zambia, Zimbabwe, NORTH AMERICA, Mexico, USA, Alabama, Florida, Georgia, Hawaii, North Carolina, CENTRAL AMERICA & CARIBBEAN, Belize, Costa Rica, Cuba, Dominican Republic, Guadeloupe, Guatemala, Martinique, Panama, SOUTH AMERICA, Brazil, Goias, Colombia, Guyana, Peru, Uruguay, OCEANIA, Australia, New South Wales, Northern Territory, Queensland, South Australia, Western Australia, Fiji, Papua New Guinea.

Sign in / Sign up

Export Citation Format

Share Document