scholarly journals Polymorphism of monogenic scab resistance loci in apple varieties

2020 ◽  
Vol 181 (1) ◽  
pp. 64-72 ◽  
Author(s):  
A. S. Lyzhin ◽  
N. N. Savel’eva
Keyword(s):  
Geographical Origin ◽  
Scar Marker ◽  
High Reliability ◽  
Molecular Genetic ◽  
Molecular Genetic Analysis ◽  
Scab Resistance ◽  
Individual Resistance ◽  
Apple Varieties ◽  
Apple Cultivars ◽  
Important Trait

Background. Monogenic scab resistance is an important trait of apple, useful to plant breeders. DNA markers provide a possibility to differentiate apple cultivars according to individual resistance determinants with high reliability and identify promising genotypes. The present study shows the results of the molecular genetic analysis of apple varieties, targeted at the Rvi2, Rvi4, Rvi6 and Rvi8 monogenic scab resistance loci.Materials and methods. Biological material was represented by apple cultivars of different environmental and geographical origin. Total genomic DNA was extracted from fresh leaves using CTAB methods according to the DArT protocols. The Rvi6 gene was identified with two markers, VfC (STS) and AL07 (SCAR). The presence of the Rvi4 gene was detected with the multiallelic SCAR marker AD13. The Rvi2 and Rvi8 genes were diagnosed with the SCAR marker OPL19.Results and conclusion. The Rvi6 gene was identified in 54.4% of genotypes, of which 91.9% were heterozygous, and 8.1% (cvs. ‘Svezhest’, ‘Freedom’ and ‘GoldRush’) homozygous dominant for this locus. The marker AD13-SCAR was detected in 25.0% of the studied forms (the putative genotype for the resistance gene is Rvi4Rvi4 or Rvi4rvi4). The marker OPL19-SCAR (Rvi2 and Rvi8 genes) was present in 73.5% of the analyzed forms. At least one of the studied molecular markers was present in the genome of 86.8% of genotypes. The appletree cultivars ‘Kandil Orlovsky’, ‘Krasulya’, ‘Sozvezdiye’, ‘Galarina’, ‘Priam’, ‘Redfree’ and ‘Witos’ are characterized by the combination of markers VfC, AL07-SCAR, AD13-SCAR and OPL19-SCAR in one genotype (the putative genotype for the resistance genes is Rvi2(Rvi8)Rvi4Rvi6rvi6). Cvs. ‘Antonovka zimnyaya’, ‘Antonovka krasnaya’, ‘Berkutovskoye’, ‘Geyzer’, ‘Pamyati Nesterova’, ‘Renet Simirenko’, ‘Terentyevka’, ‘Golden Delicious’, and ‘Telemon’ presumably have a homozygous recessive genotype for the studied resistance loci.

Identification of Сf-9 gene alleles of resistance to leaf mold in F1 tomato hybrids bred by Poisk Agrofirm

2021 ◽  
pp. 35-37
Author(s):  
А.С. Ерошевская ◽  
А.А. Егорова ◽  
Н.А. Милюкова ◽  
А.С. Пырсиков
Keyword(s):  
Genetic Analysis ◽  
Scar Marker ◽  
Molecular Genetic ◽  
Molecular Genetic Analysis ◽  
F1 Hybrids ◽  
Agarose Gel ◽  
Breeding Programs ◽  
Taq Polymerase ◽  
Leaf Mold ◽  
C 30

В статье представлены результаты молекулярно-генетического анализа F1 гибридов томата разных товарных групп на наличие аллелей гена устойчивости Cf-9 к кладоспориозу. Молекулярно-генетический анализ проводили в лаборатории маркерной и геномной селекции растений ФГБНУ ВНИИСБ в 2019 году. В качестве объекта исследования использованы 16 F1 гибридов томата, в том числе 10 крупноплодных, 1 кистевой, 1 коктейль и 4 черри. Повторность исследований двухкратная (одна повторность – одно растение). Для идентификации аллелей гена Cf-9 устойчивости к кладоспориозу применяли SCAR-маркер со следующими праймерами: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). Реакционная смесь для ПЦР объемом 25 мкл содержала 50–100 нг ДНК, 2,5 мМ dNTP, 3 мМ MgSO4, 10 пМ каждого праймера, 2 ед. Taq-полимеразы (ООО «НПФ Синтол») и 2х стандартный ПЦР буфер. Реакцию проводили в амплификаторе Termal Cycler Bio-Rad T 100 по программе 95 °C – 5 мин, 35 циклов 95 °C – 20 с, 60 °C – 30 с, 72 °C – 30 с, финальная элонгация в течение 5 мин при 72 °C. Визуализацию результатов ПЦР проводили путем электрофореза в 1,7%-ном агарозном геле с 1х ТАЕ буфером, результаты анализировали с помощью системы Gel Doc 2000 (Bio-Rad Laboratories, Inc., США). При идентификации гена устойчивости Cf-9 к кладоспориозу у изучаемых гибридов томата F1 были выявлены фрагменты размером 378 п. н. (аллель Cf-9) и 507 п. н. (аллель 9DC), что указывает на их устойчивость к этому заболеванию. Согласно результатам исследований, из 16 F1 гибридов томата 13 устойчивы к кладоспориозу, причем у 12 из них выявлено наличие только аллелей Cf-9, 1 гибрид имеет в генотипе оба аллеля устойчивости – Cf-9 и 9DС. Доминантные гомозиготы по гену Cf-9 будут использованы в селекционных программах Агрофирмы «Поиск» для создания линий-доноров устойчивости к кладоспориозу. The article presents the results of molecular genetic analysis of F1 tomato hybrids of different commodity groups for presence of Cf-9 gene alleles of resistance to leaf mold. The molecular genetic analysis was carried out in the laboratory of marker and genomic plant breeding of FSBSI VNIISB in 2019. 16 F1 tomato hybrids were used as the object of the study, including 10 large-fruited, 1 brush, 1 cocktail and 4 cherry. The repetition of studies is two-fold (one frequency – one plant). To identify alleles of the Cf-9gene for cladosporiosis resistance, a SCAR marker with the following primers was used: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). The reaction mixture for PCR with a volume of 25 µl contained 50–100 ng of DNA, 2.5 mM dNTP, 3 mM MgSO4, 10 pM of each primer, 2 units. Taq-polymerase (LLC NPF Synthol) and 2x standard PCR buffer. The reaction was carried out in the Termal Cycler Bio-Rad T 100 amplifier according to the program 95 °C – 5 min, 35 cycles 95 °C – 20 s, 60 °C – 30 s, 72 °C – 30 s, the final elongation for 5 minutes at 72 °C. The PCR results were visualized by electrophoresis in a 1.7% agarose gel with 1x TAE buffer, the results were analyzed using the Gel Doc 2000 system (Bio-Rad Laboratories, Inc., USA). The identification of the Cf-9resistance gene to cladosporiosis in the studied tomato F1 hybrids revealed fragments of 378 bp (Cf-9 allele) and 507 bp (9DC allele), which indicates their resistance to this disease. According to the research results, 13 out of 16 tomato F1 hybrids are resistant to cladosporiosis, and 12 of them have only Cf-9 alleles, 1 hybrid has both Cf-9 and 9DC resistance alleles in the genotype. Dominant homozygotes for the Cf-9 gene will be used in breeding programs of Poisk Agrofirm to create donor lines for resistance to cladosporiosis.

scholarly journals Biochemical composition of fruits of new apple varieties of Belarusian breeding

2019 ◽  
pp. 5-12
Author(s):  
Z. A. Kazlouskaya ◽  
S. A. Yarmolich
Keyword(s):  
Biochemical Composition ◽  
Geographical Origin ◽  
Soluble Solids ◽  
Scab Resistance ◽  
Biological Research ◽  
Direct Extraction ◽  
Genetic Origin ◽  
Apple Varieties ◽  
New Varieties ◽  
Pectin Substances

The object of the research was new Belarusian apple varieties Zorka, Krasavіta, Navavіta and Sakavіta, selected from the hybrid fund, obtained as result of many-stage crossing of apple varieties (Malus domestica Borkh.) of various geographical origin (local, American, Western European) with the fourth and fifth generations of profusely blossoming wild apple (M. × floribunda Sieb.), which is carrier of scab resistance Rvi6 gene. The aim of these studies was to study the chemical and technological composition of fruits of new Belarusian apple varieties that are resistant to scab, released during agro biological research. The biochemical composition of the fruit depends mainly on the complex genetic origin of new varieties. New apple varieties differ by a higher content of soluble solids (12.6-13.7 %), titrated acidity (0.70-0.94 %), they exceed the standard variety Vesyalina (0.56 %), as well as the amount of sugars (9.85-11.40 %). The content of pectic substances in the fruits of the studied varieties ranged from 0.76 (Zorka) to 1.31 % (Navavіta). The highest content of pectin substances are the varieties Sakavіta and Navavіta — 1.30 and 1.31 %, respectively. The varieties Krasavіta (7.1 mg / 100 g) and Vesyalina (15.17 mg/ 100 g) are characterized by highest content of ascorbic acid, and the variety Navavita (211.1 mg / 100 g) is characterized by highest content of phenolic compounds. It established that the fruits of the new apple varieties Zorka, Krasavіta, Navavіta and Sakavіta are suitable for producing juice of natural direct extraction, nectar without pulp, nectar with pulp, sterilized fruits rubbed with sugar, frozen.

scholarly journals Application of DNA markers for detection of scab resistant apple cultivars and selections

2005 ◽  
Vol 11 (3) ◽  
Author(s):  
H. Mattisson ◽  
H. Nybom
Keyword(s):  
Resistance Genes ◽  
Dna Markers ◽  
Dna Marker ◽  
Scar Marker ◽  
Scab Resistance ◽  
Gene Marker ◽  
Caps Marker ◽  
Vf Gene ◽  
Apple Breeding ◽  
Apple Cultivars

A DNA marker-based study was undertaken to identify the occurrence of major scab resistance genes in some apple cultivars and selections of importance for apple breeding. Unfortunately none of the RAPD-based markers previously reported to detect the Va, Vb, Vr and Vx genes produced unambiguous results. By contrast, the CAPS marker MI8 produced the expected three bands in all cultivars and selections already known or suspected to have the Vf gene, as well as in the Russian cultivar 'Antonovka Polotora Funtovaja' suspected to have Va resistance which however may be allelic to Vf. Vf-carrying selections and newly named cultivars 'Frida' and 'Fredrik' are grown successfully in Sweden without fungicides, suggesting that the Vr resistance breaking scab races 6 and 7 have not yet become a problem. The SCAR marker B12 detected the Vm gene in 'Prairifire', 'Rouville', clones 'OR45T132' and 'OR48T70', and selection '16-36-193'. The SSR locus 0102b10 detected one band at 118 by in 'Reka'. This is presumed to be identical to the Vr gene marker previously reported.

Molecular Characterization and Genetic Diversity Study in F3 Population of Rice

2013 ◽  
Vol 20 (1-2) ◽  
pp. 1-8
Author(s):  
MM Rahman ◽  
L Rahman ◽  
SN Begum ◽  
F Nur
Keyword(s):  
Genetic Distance ◽  
Gene Diversity ◽  
Random Amplified Polymorphic Dna ◽  
Molecular Genetic ◽  
Molecular Genetic Analysis ◽  
Polymorphic Loci ◽  
Rice Genotypes ◽  
High Level ◽  
Genetic Diversity Study ◽  
Diversity Study

Random Amplified Polymorphic DNA (RAPD) assay was initiated for molecular genetic analysis among 13 F3 rice lines and their parents. Four out of 15 decamer random primers were used to amplify genomic DNA and the primers yielded a total of 41 RAPD markers of which 37 were considered as polymorphic with a mean of 9.25 bands per primer. The percentage of polymorphic loci was 90.24. The highest percentage of polymorphic loci (14.63) and gene diversity (0.0714) was observed in 05-6 F3 line and the lowest polymorphic loci (0.00) and gene diversity (0.00) was found in 05-12 and 05-15 F3 lines. So, relatively high level of genetic variation was found in 05-6 F3 line and it was genetically more diverse compared to others. The average co-efficient of gene differentiation (GST) and gene flow (Nm) values across all the loci were 0.8689 and 0.0755, respectively. The UPGMA dendrogram based on the Nei’s genetic distance differentiated the rice genotypes into two main clusters: PNR-519, 05-19, 05-14, 05-12 and 05-17 grouped in cluster 1. On the other hand, Baradhan, 05-9, 05-13, 05-11, 05-5, 05-6, 05-1, 05-4, 05-15 and 05-25 were grouped in cluster 2. The highest genetic distance (0.586) was found between 05-4 and 05-17 F3 lines and they remain in different cluster.DOI: http://dx.doi.org/10.3329/pa.v20i1-2.16839 Progress. Agric. 20(1 & 2): 1 – 8, 2009

Diagnosis and Management of Cardiomyopathies – A Focus on Genetics, Cardiac Magnetic Resonance and Clinical Features

2011 ◽  
Vol 7 (3) ◽  
pp. 225
Author(s):  
Gianfranco Sinagra ◽  
Michele Moretti ◽  
Giancarlo Vitrella ◽  
Marco Merlo ◽  
Rossana Bussani ◽  
...  
Keyword(s):  
Clinical Practice ◽  
Cardiac Magnetic Resonance ◽  
Magnetic Resonance ◽  
Imaging Techniques ◽  
Molecular Genetic ◽  
Molecular Genetic Analysis ◽  
Routine Clinical Practice ◽  
Clinical Approach ◽  
Diagnosis And Management ◽  
Made In

In recent years, outstanding progress has been made in the diagnosis and treatment of cardiomyopathies. Genetics is emerging as a primary point in the diagnosis and management of these diseases. However, molecular genetic analyses are not yet included in routine clinical practice, mainly because of their elevated costs and execution time. A patient-based and patient-oriented clinical approach, coupled with new imaging techniques such as cardiac magnetic resonance, can be of great help in selecting patients for molecular genetic analysis and is crucial for a better characterisation of these diseases. This article will specifically address clinical, magnetic resonance and genetic aspects of the diagnosis and management of cardiomyopathies.

scholarly journals MOLECULAR GENETIC ANALYSIS OF THE DILUTE-SHORT EAR (d-se) REGION OF THE MOUSE

Genetics ◽  
1986 ◽  
Vol 112 (2) ◽  
pp. 321-342
Author(s):  
Eugene M Rinchik ◽  
Liane B Russell ◽  
Neal G Copeland ◽  
Nancy A Jenkins
Keyword(s):  
Physical Map ◽  
Leukemia Virus ◽  
Molecular Genetic ◽  
Break Point ◽  
Virus Genome ◽  
Molecular Genetic Analysis ◽  
Chromosome 9 ◽  
Genetic Complementation ◽  
Induced Mutations ◽  
Radiation Induced

ABSTRACT Genes of the dilute-short ear (d-se) region of mouse chromosome 9 comprise an array of loci important to the normal development of the animal. Over 200 spontaneous, chemically induced and radiation-induced mutations at these loci have been identified, making it one of the most genetically well-characterized regions of the mouse. Molecular analysis of this region has recently become feasible by the identification of a dilute mutation that was induced by integration of an ecotropic murine leukemia virus genome. Several unique sequence cellular DNA probes flanking this provirus have now been identified and used to investigate the organization of wild-type chromosomes and chromosomes with radiation-induced d-se region mutations. As expected, several of these mutations are associated with deletions, and, in general, the molecular and genetic complementation maps of these mutants are concordant. Furthermore, a deletion break-point fusion fragment has been identified and has been used to orient the physical map of the d-se region with respect to the genetic complementation map. These experiments provide important initial steps for analyzing this developmentally important region at the molecular level, as well as for studying in detail how a diverse group of mutagens acts on the mammalian germline.

Sign in / Sign up

Export Citation Format

Share Document