scholarly journals Microbial control of white grubs with entomopathogenic fungi and its value in integrated pest management (IPM) in Nepal

1970 ◽  
Vol 24 (1) ◽  
pp. 31-36
Author(s):  
Yubak Dhoj G. C. ◽  
Siegried Keller ◽  
Peter Nagel
Keyword(s):  
Pest Management ◽  
Entomopathogenic Fungi ◽  
Metarhizium Anisopliae ◽  
Entomopathogenic Fungus ◽  
Fungal Pathogens ◽  
Microbial Control ◽  
White Grubs ◽  
First Results ◽  
Crop Disease ◽  
Future Work

With an objective to explore the possibility of biocontrol of white grubs using entomopathogenic fungi, an exploratory tudy was conducted in the Syangja and Parbat districts in nepal in the winter of 2001/2002. In order to explore the occurrence of indigenous fungal pathogens of white grubs, field and laboratory experiments were carried out and information were collected from all available sources. Upon collection of the white grubs the entomopathogenic fungus Metarhizium anisopliae was found to be associated with white grubs in fields with arable crop. Disease prevalence was between ) and 2% depending on host origin and species. Bioassays revealed that the Nepalese isolates of this fungus species were as pathogenic as a Swiss isolate used for comparison purposes. Therefore, Future work will be done exclusively with Nepalese isolates. Analysis of soils from three different regions showed that M. anisopliae is common and was present in about 50% of the samples irrespective of their origin. However, the fungus densities were low. Another entomopathogenic fungus, Beauveria bassiana, was isolated as well from a few soil samples. Based on these first results, the possibilities to develop mycoinsecticides and to integrate them into existing pest management (IMP) systems are considered as very promising. In the meantime a project funded by Helvetas has been initiated at Tribhuvan University (TU), Institute of Agriculture and Animal Sciences (IAAS), Rampur, Chitwan, Nepal. Key words: Biological control, entomopathogenic fungi, Metarhizium anisopliae, Scarabaeidae, white grubs, Nepal.

scholarly journals Activity of strains of Metarhizium anisopliae (Metsch) Sorokin against white grub (Chiloloba acuta, Scarabaeidae, Coleoptera) under laboratory condition in Nepal

2018 ◽  
Vol 17 ◽  
pp. 82-91 ◽  
Author(s):  
Dipak Khanal
Keyword(s):  
Entomopathogenic Fungi ◽  
Metarhizium Anisopliae ◽  
Insect Pests ◽  
Microbial Control ◽  
White Grub ◽  
White Grubs ◽  
Larval Stages ◽  
Commercial Strain ◽  
Randomized Design ◽  
Completely Randomized Design

Soil insect pests are the major productivity constrains of different crops among which white grubs (Coleoptera: Scarabaeidae), both adult and larval stages, are extremely destructive in nature. Laboratory studies were conducted to evaluate the virulence of an indigenous and a commercial strain of the entomopathogenic fungi, Metarhizium anisopliae (Metsch.) Sorokin, against white grubs species Chiloloba acuta by applying the dipping method at Entomology Division, NARC, Nepal. Third instars larvae of C. acuta were dipped in suspensions of indigenous and commercial strains (Pacer) of M. anisopliae at different concentrations ranging from 3.33×104 to 1.04×108 spores/ml for 3-5 seconds which resulted in 97.8% and 89% mortalities with the highest dose of 1.04×108 spores/ml 40 days after inoculation (DAI), respectively. The LC50 values for indigenous and commercial strain were 3.5×105 and 1.88×106 spores/ml, respectively, with the potency of 1:0.28 at 40 DAI. Bioassays were conducted in completely randomized design. From results it is concluded that the tested strains of entomopathogenic fungi have potential as microbial control agents in managing white grubs in laboratory and it is suggested to be tested under farmers field condition.

Mass multiplication of Metarhizium anisopliae on different media

2020 ◽  
Vol 5 (01) ◽  
pp. 138-144
Author(s):  
Ankush Taliyan ◽  
Ajay Kumar ◽  
Rajendra Singh ◽  
Rohit Rana ◽  
Shekhar Rana
Keyword(s):  
Pest Management ◽  
Entomopathogenic Fungi ◽  
Mass Production ◽  
Metarhizium Anisopliae ◽  
Fungal Species ◽  
Mass Multiplication

Entomopathogenic fungi (EPF) Metarhizium anisopliae are fungal species that is the frequently occurring and destructive pest management to the pathogenic soil and insects. The effect of different substrates for the mass production of Metarhizium anisopliae spore/ml was significantly higher recorded The results revealed that all the treatments were significantly producing spore per ml and thus increasing the yield significantly as compared to other substrates. The results revealed that all the treatments were significantly higher effective in producing spore/ml as compared to other substrates overall finding showed that substrate tested, for Metarhizium anisopliae spore/ml production was significantly higher recorded 240.53 and 195.26 spore/ml were recorded on substrate irrespective of the temperature.

scholarly journals Biological insect control using Metarhizium anisopliae: morphological, molecular, and ecological aspects

2014 ◽  
Vol 44 (4) ◽  
pp. 645-651 ◽  
Author(s):  
Patricia Vieira Tiago ◽  
Neiva Tinti de Oliveira ◽  
Elza Áurea de Luna Alves Lima
Keyword(s):  
Entomopathogenic Fungi ◽  
Metarhizium Anisopliae ◽  
Microbial Control ◽  
Intraspecific Variability ◽  
Fungal Species ◽  
Insect Control ◽  
Pest Population ◽  
Ecological Aspects ◽  
Population Structures ◽  
Biological Insect Control

Microbial control of insects is based on the rational use of pathogens to maintain environmentally balanced pest population levels, and Metarhizium anisopliae has been the most studied and most utilized fungal species for that purpose. The natural genetic variability of entomopathogenic fungi is considered one of the principal advantages of microbial insect control. The inter- and intraspecific variability and the genetic diversity and population structures of Metarhizium and other entomopathogenic fungi have been examined using ITS-RFLP, ISSR, and ISSP molecular markers. The persistence of M. anisopliae in the soil and its possible effects on the structures of resident microbial communities must be considered when selecting isolates for biological insect control.

scholarly journals Pathogenicity of entomopathogenic fungi Metarhizium anisopliae to white grubs Holotrichia serrata

2021 ◽  
Vol 9 (1) ◽  
pp. 1207-1209
Author(s):  
Rinni Saharwat ◽  
Riazuddin . ◽  
Seema Rani ◽  
Jagpal Singh
Keyword(s):  
Entomopathogenic Fungi ◽  
Metarhizium Anisopliae ◽  
White Grubs ◽  
Holotrichia Serrata

scholarly journals Entomopathogenic fungi isolated in the vicinity of Szczecin

2014 ◽  
Vol 33 (1) ◽  
pp. 123-130 ◽  
Author(s):  
Ryszard Miętkiewicz ◽  
Magdalena Dzięgielewska ◽  
Krystyna Janowicz
Keyword(s):  
Forest Soil ◽  
Beauveria Bassiana ◽  
Entomopathogenic Fungi ◽  
Metarhizium Anisopliae ◽  
Entomopathogenic Fungus ◽  
Dominant Species ◽  
Beech Forest ◽  
Meadow Soil ◽  
Paecilomyces Farinosus ◽  
Opposite Tendency

The spectrum and occurrence of entomopathogenic fungi in litter beech forest. meadow soil and arable soil were evaluated using an "insect bait method". Soil and litter samples taken in autumn and spring from each stand were baited with <i>G. mellonella</i> larvae at 22°C. Six species of entomopathogenic fungi infected these larvae. In the litter <i>Beauveria bassiana</i> was the dominant species. Besides <i>B. bassiana</i>, 23% of <i>G. mellonella</i> larvae were infected by <i>Paecilomyces farinosus</i> in autumn. In the forest soil the dominant entomopathogenic fungus was not found. In this stand the number of infected larvae was the lowest. <i>Metarhizium anisopliae</i> was the dominant species in the meadow soil in both sampling periods. In the soil taken from a rye field<i> P. fumosoroseus</i> and <i>B. bassiana</i> infected <i>G. mellonella</i> larvae almost to the same degree. It was established that <i>B. bassiana</i> and <i>M. anisopliae</i> infected more <i>G. mellonella</i> larvae in spring than in autumn. In the case of <i>P. farinosus</i> and <i>P. fumosoroseus</i> an opposite tendency was observed.

scholarly journals Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

2011 ◽  
Vol 71 (1) ◽  
pp. 91-98 ◽  
Author(s):  
IJ. Bechara ◽  
RHR. Destéfano ◽  
C. Bresil ◽  
CL. Messias
Keyword(s):  
Metarhizium Anisopliae ◽  
Entomopathogenic Fungus ◽  
Large Scale ◽  
Microbial Control ◽  
Fruit Fly ◽  
Control Agent ◽  
Immature Stages ◽  
Disease Cycle ◽  
Anastrepha Fraterculus ◽  
Hyphal Bodies

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

scholarly journals UJI EFIKASI BIOINSEKTISIDA JAMUR ENTOMOPATOGEN BERFORMULASI CAIR TERHADAP Plutella xylostella (L.) DI LABORATORIUM

2013 ◽  
Vol 13 (1) ◽  
pp. 52-60
Author(s):  
Haperidah Nunilahwati ◽  
Siti Herlinda ◽  
Chandra Irsan ◽  
Yulia Pujiastuti ◽  
Khodijah Khodijah ◽  
...  
Keyword(s):  
Beauveria Bassiana ◽  
Entomopathogenic Fungi ◽  
Active Ingredient ◽  
Plutella Xylostella ◽  
Metarhizium Anisopliae ◽  
Entomopathogenic Fungus ◽  
Crop Production ◽  
Insect Pest ◽  
Larval Mortality ◽  
Third Instar Larvae

Efficacy test of liquid bio-insecticide of entomopathogenic fungi in control against Plutella xylostella in the laboratory.  The insect pest P. xylostella could reduce crop production of Brassicaceae. The aim of research was to test the efficacy liquid bio insecticide with active ingredient of Beauveria bassiana and Metarhizium anisopliae fungi to control P. xylostella. Bio-insecticide was applied by spraying  on mustard leaves infested with 50 individuals of third instar larvae of P. xylostella and a density of 1x106 conidia ml-1. Larval mortality was observed every 2 hours and LT50 of larvae was calculated. The study showed that the highest percentage of mortality found in Mt ES and Mt ES (cf) isolates was 99.6%, the lowest mortality at Mt NES isolate was 96.80%. LT50 and LT95 values   Bb ES were the lowest i.e. 2.04 days and 2.95 days. The highest LT50 and LT95 of Mt NES isolate were 2.24 days and 3.32 days. The liquid bio-insecticide of entomopathogenic fungus B. bassiana and M. anisopliae were effective to control the larvae of P. xylostella.

scholarly journals Effects of the Entomopathogenic Fungus Metarhizium anisopliae on the Mortality and Immune Response of Locusta migratoria

Insects ◽  
2019 ◽  
Vol 11 (1) ◽  
pp. 36 ◽  
Author(s):  
Wuji Jiang ◽  
Yifan Peng ◽  
Jiayi Ye ◽  
Yiyi Wen ◽  
Gexin Liu ◽  
...  
Keyword(s):  
Immune Response ◽  
Entomopathogenic Fungi ◽  
Metarhizium Anisopliae ◽  
Entomopathogenic Fungus ◽  
Insect Pests ◽  
Locusta Migratoria ◽  
Management Strategies ◽  
Sod Activity ◽  
Immune Related Genes ◽  
Locusta Migratoria Manilensis

Entomopathogenic fungi are the key regulators of insect populations and some of them are important biological agents used in integrated pest management strategies. Compared with their ability to become resistant to insecticides, insect pests do not easily become resistant to the infection by entomopathogenic fungi. In this study, we evaluated the mortality and immune response of the serious crop pest Locusta migratoria manilensis after exposure to a new entomopathogenic fungus strain, Metarhizium anisopliae CQMa421. M. anisopliae CQMa421 could effectively infect and kill the L. migratoria adults and nymphs. The locust LT50 under 1 × 108 conidia/mL concentration of M. anisopliae was much lower than that under conidial concentration 1 × 105 conidia/mL (i.e., 6.0 vs. 11.2 and 5.0 vs. 13.8 for adults and nymphs, respectively). The LC50 (log10) of M. anisopliae against locust adults and nymphs after 10 days was 5.2 and 5.6, respectively. Although the number of hemocytes in L. migratoria after exposure to M. anisopliae did not differ with that in the controls, the enzymatic activity of superoxide dismutase (SOD) and prophenoloxidase (ProPO) did differ between the two treatments. The activities of both SOD and ProPO under the M. anisopliae treatment were lower than that in the controls, except for the ProPO activity at 72 h and the SOD activity at 96 h. Further, the expression of the L. migratoria immune-related genes defensin, spaetzle, and attacin differed after exposure to M. anisopliae for 24 h to 96 h. Taken together, this study indicated that infection with M. anisopliae CQMa421 could cause the death of L. migratoria by interacting with the immune responses of the host, demonstrating that this fungal strain of M. anisopliae can be an efficient biocontrol agent against L. migratoria.

scholarly journals Application of Bait Treated with the Entomopathogenic FungusMetarhizium anisopliae(Metsch.) Sorokin for the Control ofMicrocerotermes diversusSilv.

2013 ◽  
Vol 2013 ◽  
pp. 1-5 ◽  
Author(s):  
Amir Cheraghi ◽  
Behzad Habibpour ◽  
Mohammad Saied Mossadegh
Keyword(s):  
Biological Control ◽  
Pest Management ◽  
Entomopathogenic Fungi ◽  
Metarhizium Anisopliae ◽  
Fungal Pathogen ◽  
Management Strategy ◽  
Khuzestan Province ◽  
Significant Difference ◽  
Strategy Performance ◽  
Bait System

Microcerotermes diversusSilvestri (Isoptera, Termitidae) is considered to be the most destructive termite in Khuzestan province (Iran), and its control by conventional methods is often difficult. Biological control using entomopathogenic fungi could be an alternative management strategy. Performance of a bait matrix treated with the entomopathogenic fungusMetarhizium anisopliae(Metsch.) Sorokin, Strain Saravan (DEMI 001), againstM. diversuswas evaluated in this paper. The highest rate of mortality occurred at concentrations of 3.7 × 107and 3.5 × 108(conidia per mL). There was no significant difference between treatments, in the rate of feeding on the bait. The fungal pathogen was not repellent to the target termite over the conidial concentrations used. The current results suggest potential of such bait system in controlling termite. However the effectiveness ofM. anisopliaeas a component of integrated pest management forM. diversusstill needs to be proven under field conditions.

Sign in / Sign up

Export Citation Format

Share Document