scholarly journals Bacillus cabrialesii BH5 Protects Tomato Plants Against Botrytis cinerea by Production of Specific Antifungal Compounds

2021 ◽  
Vol 12 ◽  
Author(s):  
Lu Zhou ◽  
Chunxu Song ◽  
Claudia Y. Muñoz ◽  
Oscar P. Kuipers
Keyword(s):  
Botrytis Cinerea ◽  
High Performance ◽  
Gray Mold ◽  
Plant Diseases ◽  
Systemic Resistance ◽  
Transcription Analysis ◽  
Tomato Plants ◽  
Global Food Security ◽  
Cyclic Lipopeptide

The gray mold caused by the phytopathogen Botrytis cinerea presents a threat to global food security. For the biological regulation of several plant diseases, Bacillus species have been extensively studied. In this work, we explore the ability of a bacterial strain, Bacillus cabrialesii BH5, that was isolated from tomato rhizosphere soil, to control the fungal pathogen B. cinerea. Strain B. cabrialesii BH5 showed a strong antifungal activity against B. cinerea. A compound was isolated and identified as a cyclic lipopeptide of the fengycin family by high-performance liquid chromatography and tandem mass spectrometry (ESI-MS/MS) that we named fengycin H. The fengycin H-treated hyphae of B. cinerea displayed stronger red fluorescence than the control, which is clearly indicating that fengycin H triggered the hyphal cell membrane defects. Moreover, root inoculation of tomato seedlings with BH5 effectively promoted the growth of tomato plants. Transcription analysis revealed that both BH5 and fengycin H stimulate induced systemic resistance of tomato plants via the jasmonic acid signaling pathway and provide a strong biocontrol effect in vivo. Therefore, the strain BH5 and fengycin H are very promising candidates for biological control of B. cinerea and the associated gray mold.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals Comparison of defence responses to Botrytis cinerea infection in tomato plants propagated in vitro and grown in vivo

2013 ◽  
Vol 49 (1-2) ◽  
pp. 115-121 ◽  
Author(s):  
Jacek Patykowski ◽  
Elżbieta Kuźniak ◽  
Henryk Urbaniak
Keyword(s):  
Superoxide Dismutase ◽  
Botrytis Cinerea ◽  
Ascorbate Peroxidase ◽  
Guaiacol Peroxidase ◽  
Activity Increase ◽  
Tomato Plants ◽  
Defence Responses ◽  
Defence Reactions

Defence reactions: O<sub>2<sub> - generation, superoxide dismutase, catalase, guaiacol peroxidase and ascorbate peroxidase activities after <em>B. cinerea</em> infection in tomato plants propagated <em>in vitro</em> and grown <em>in vivo</em> have been compared. Infection resulted in rapid O<sub>2<sub> - generation. Superoxide dismutase activity increase was slower than O<sub>2<sub> - response. In plants propagated <em>in vitro</em> catalase and guaiacol peroxidase activities after infection were induced less strongly than in plants grown <em>in vivo</em>. K<sub>2<sub>HPO<sub>4<sub> pretreatment of plants grown <em>in vitro</em> enhanced significantly the activities of catalase and guaiacol peroxidase after infection. Slight restriction of <em>B. cinerea</em> infection development in <em>in vitro</em> propagated plants pretreated with K<sub>2<sub>HP0<sub>4<sub> was observed.

scholarly journals Effectiveness of Dunaliella salina Extracts against Bacillus subtilis and Bacterial Plant Pathogens

Pathogens ◽  
2020 ◽  
Vol 9 (8) ◽  
pp. 613
Author(s):  
Alfredo Ambrico ◽  
Mario Trupo ◽  
Rosaria Magarelli ◽  
Roberto Balducchi ◽  
Angelo Ferraro ◽  
...  
Keyword(s):  
Antibacterial Activity ◽  
Pseudomonas Syringae ◽  
Dunaliella Salina ◽  
Plant Pathogens ◽  
Plant Diseases ◽  
Economic Losses ◽  
Tomato Plants ◽  
Hexane Extracts

Several bacteria pathogens are responsible for plant diseases causing significant economic losses. The antibacterial activity of Dunaliella salina microalgae extracts were investigated in vitro and in vivo. First, biomass composition was chemically characterized and subjected to extraction using polar/non-polar solvents. The highest extraction yield was obtained using chloroform:methanol (1:1 v/v) equal to 170 mg g−1 followed by ethanol (88 mg g−1) and hexane (61 mg g−1). In vitro examination of hexane extracts of Dunaliella salina demonstrated antibacterial activity against all tested bacteria. The hexane extract showed the highest amount of β-carotene with respect to the others, so it was selected for subsequent analyses. In vivo studies were also carried out using hexane extracts of D. salina against Pseudomonas syringae pv. tomato and Pectobacterium carotovorum subsp. carotovorum on young tomato plants and fruits of tomato and zucchini, respectively. The treated young tomato plants exhibited a reduction of 65.7% incidence and 77.0% severity of bacterial speck spot disease. Similarly, a reduction of soft rot symptoms was observed in treated tomato and zucchini fruits with a disease incidence of 5.3% and 12.6% with respect to 90.6% and 100%, respectively, for the positive control.

scholarly journals Biocontrol of Tomato Fusarium wilt by Trichoderma Species under in vitro and in vivo Conditions

2016 ◽  
Vol 49 (1) ◽  
pp. 91-98 ◽  
Author(s):  
H. Barari
Keyword(s):  
Plant Protection ◽  
Disease Incidence ◽  
Plant Diseases ◽  
Growth And Yield ◽  
Mazandaran Province ◽  
Trichoderma Species ◽  
Tomato Plants ◽  
Geographical Regions

AbstractTrichodermaspp. have long been used as biological control agents against plant fungal diseases, but the mechanisms by which the fungi confer protection are not well understood. Our goal in this study was to isolate species ofTrichoderma, that exhibit high levels of biocontrol efficacy from natural environments and to investigate the mechanisms by which these strains confer plant protection. In this study, efficacy of the native isolates ofTrichodermaspecies to promote the growth and yield parameters of tomato and to manageFusariumwilt disease underin vitroandin vivoconditions were investigated. The dominant pathogen, which causesFusariumwilt of tomato, was isolated and identified asFusarium oxysporumf. sp.lycopersici(FOL). Twenty eight nativeTrichodermaantagonists were isolated from healthy tomato rhizosphere soil in different geographical regions of Mazandaran province, Iran. Underin vitroconditions, the results revealed thatTrichoderma harzianum, isolate N-8, was found to inhibit effectively the radial mycelial growth of the pathogen (by 68.22%). Under greenhouse conditions, the application ofT. harzianum(N-8) exhibited the least disease incidence (by 14.75%). Also, tomato plants treated withT. harzianum(N-8) isolate showed a significant stimulatory effect on plant height (by 70.13 cm) and the dry weight (by 265.42 g) of tomato plants, in comparison to untreated control (54.6 cm and 195.5 g). Therefore, the antagonistT. harzianum(N-8) is chosen to be the most promising bio-control agent forF. oxysporumf. sp.lycopersici. On the base of present study, the biocontrol agents of plant diseases might be exploited for sustainable disease management programs to save environmental risk.

scholarly journals Expression of a Synthesized Gene Encoding Cationic Peptide Cecropin B in Transgenic Tomato Plants Protects against Bacterial Diseases

2009 ◽  
Vol 76 (3) ◽  
pp. 769-775 ◽  
Author(s):  
Pey-Shynan Jan ◽  
Hsu-Yuang Huang ◽  
Hueih-Min Chen
Keyword(s):  
Xanthomonas Campestris ◽  
Plant Pathogens ◽  
Transgenic Tomato ◽  
Plant Diseases ◽  
Gene Encoding ◽  
Tomato Plants ◽  
Cecropin B ◽  
Transgenic Tomato Plants

ABSTRACT The cationic lytic peptide cecropin B (CB), isolated from the giant silk moth (Hyalophora cecropia), has been shown to effectively eliminate Gram-negative and some Gram-positive bacteria. In this study, the effects of chemically synthesized CB on plant pathogens were investigated. The S50s (the peptide concentrations causing 50% survival of a pathogenic bacterium) of CB against two major pathogens of the tomato, Ralstonia solanacearum and Xanthomonas campestris pv. vesicatoria, were 529.6 μg/ml and 0.29 μg/ml, respectively. The CB gene was then fused to the secretory signal peptide (sp) sequence from the barley α-amylase gene, and the new construct, pBI121-spCB, was used for the transformation of tomato plants. Integration of the CB gene into the tomato genome was confirmed by PCR, and its expression was confirmed by Western blot analyses. In vivo studies of the transgenic tomato plant demonstrated significant resistance to bacterial wilt and bacterial spot. The levels of CB expressed in transgenic tomato plants (∼0.05 μg in 50 mg of leaves) were far lower than the S50 determined in vitro. CB transgenic tomatoes could therefore be a new mode of bioprotection against these two plant diseases with significant agricultural applications.

scholarly journals Effects of Origanum vulgare essential oil and its two main components, carvacrol and thymol, on the plant pathogen Botrytis cinerea

PeerJ ◽  
2020 ◽  
Vol 8 ◽  
pp. e9626
Author(s):  
Huiyu Hou ◽  
Xueying Zhang ◽  
Te Zhao ◽  
Lin Zhou
Keyword(s):  
Antifungal Activity ◽  
Essential Oil ◽  
Botrytis Cinerea ◽  
Spore Germination ◽  
Gray Mold ◽  
Origanum Vulgare ◽  
Mycelium Growth ◽  
Main Components

Background Botrytis cinerea causes serious gray mold disease in many plants. This pathogen has developed resistance to many fungicides. Thus, it has become necessary to look for new safe yet effective compounds against B. cinerea. Methods Essential oils (EOs) from 17 plant species were assayed against B. cinerea, of which Origanum vulgare essential oil (OVEO) showed strong antifungal activity, and accordingly its main components were detected by GC/MS. Further study was conducted on the effects of OVEO, carvacrol and thymol in vitro on mycelium growth and spore germination, mycelium morphology, leakages of cytoplasmic contents, mitochondrial injury and accumulation of reactive oxygen species (ROS) of B. cinerea. The control efficacies of OVEO, carvacrol and thymol on tomato gray mold were evaluated in vivo. Results Of all the 17 plant EOs tested, Cinnamomum cassia, Litsea cubeba var. formosana and O. vulgare EOs had the best inhibitory effect on B. cinerea, with 0.5 mg/mL completely inhibiting the mycelium growth of B. cinerea. Twenty-one different compounds of OVEO were identified by gas chromatography–mass spectrometry, and the main chemical components were carvacrol (89.98%), β-caryophyllene (3.34%), thymol (2.39%), α-humulene (1.38%) and 1-methyl-2-propan-2-ylbenzene isopropyl benzene (1.36%). In vitro experiment showed EC50 values of OVEO, carvacrol and thymol were 140.04, 9.09 and 21.32 μg/mL, respectively. Carvacrol and thymol completely inhibited the spore germination of B. cinerea at the concentration of 300 μg/mL while the inhibition rate of OVEO was 80.03%. EC50 of carvacrol and thymol have significantly (P < 0.05) reduced the fresh and dry weight of mycelia. The collapse and damage on B. cinerea mycelia treated with 40 μg/mL of carvacrol and thymol was examined by scanning electron microscope (SEM). Through extracellular conductivity test and fluorescence microscope observation, it was found that carvacrol and thymol led to increase the permeability of target cells, the destruction of mitochondrial membrane and ROS accumulation. In vivo conditions, 1000 μg/mL carvacrol had the best protective and therapeutic effects on tomato gray mold (77.98% and 28.04%, respectively), and the protective effect was significantly higher than that of 400 μg/mL pyrimethanil (43.15%). While the therapeutic and protective effects of 1,000 μg/mL OVEO and thymol were comparable to chemical control. Conclusions OVEO showed moderate antifungal activity, whereas its main components carvacrol and thymol have great application potential as natural fungicides or lead compounds for commercial fungicides in preventing and controlling plant diseases caused by B. cinerea.

scholarly journals Actinomycete as biocontrol agents against tomato gray mold disease caused by Botrytis cinerea

2021 ◽  
Vol 48 (3) ◽  
Author(s):  
Hind Lahmyed ◽  
◽  
Rachid Bouharroud ◽  
Redouan Qessaoui ◽  
Abdelhadi Ajerrar ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Extracellular Enzymes ◽  
Chitinase Activity ◽  
Gray Mold ◽  
Antagonistic Activity ◽  
Future Research ◽  
In Planta ◽  
Tomato Fruits

The present work aims to isolate actinomycete bacteria with antagonistic abilities towards Botrytis cinerea, the causal agent of gray mold, from a soil sample collected from the rhizosphere of a healthy tomato grove. In vitro confrontation led to the isolation of 104 actinomycete isolates; fifteen isolates have shown the most significant mortality rate of the mycelial growth of B. cinerea (>50%). Based on the results of this screening, representative strains were selected to verify their in vivo antagonistic activity on tomato fruits; the reduction of B. cinerea has a percentage ranging from 52.38% to 96.19%. Furthermore, the actinomycete isolates were evaluated for their plant growth-promoting (PGP) properties and their ability to produce biocontrol-related extracellular enzymes viz., amylase, protease, cellulase, chitinase, esterases, and lecithinase. Indeed, Ac70 showed high β-1,3-glucanase activity and siderophore production (17U/ml and 43% respectively), and the highest chitinase activity (39μmol/ml) was observed for Ac24. These results indicated that these actinomycetes might potentially control gray mold caused by B. cinerea on tomato fruits. Investigations on enhancing the efficacy and survival of the biocontrol agent in planta and finding out the best formulation are recommended for future research.

scholarly journals Control of Gray Mold on Tomato plants by Spraying Piper nigrum and Urtica dioica Extracts under Greenhouse Condition

2019 ◽  
Vol 60 (5) ◽  
pp. 961-971
Author(s):  
Hamed N. Ghazal ◽  
Ayyad W Al-Shahwany ◽  
Firas T. Al–Dulaimy
Keyword(s):  
Botrytis Cinerea ◽  
Gray Mold ◽  
Urtica Dioica ◽  
Nano Particles ◽  
Piper Nigrum ◽  
Total Phenolic ◽  
Total Phenolic Compounds ◽  
Greenhouse Condition ◽  
Tomato Plants ◽  
Inducing Resistance

Field experimented were examined the effects of Piper nigrum and Urtica dioica extracts on the gray mold disease in tomato that caused by Botrytis cinerea. To evaluate the inducing resistance of these extracts, many treatments were sprayed on tomato leaves, including methanolic and aquatic extracts, Silver nano particles biosynthesis (AgNPs) and water as (control). The results indicated that the resistance of tomato plants was increased when tomato plant sprayed first with Methanolic P. nigrum extracts and after 4 hours sprayed with B. cinerea. Also, spraying with methanolic and aquatic AgNPs P. nigrum extract were reduced gray mold disease. These results were showed that P. nigrum AgNPs treatment reduced the gray mold of tomato leaves because of the activities of total phenolic compounds which was infected with Botrytis cinerea.

Tetrandrine, a potent antifungal agent: inhibits mycelial growth and virulence of Botrytis cinerea

2020 ◽  
Author(s):  
Pingliang Li ◽  
jian zou ◽  
Yanhan Dong ◽  
jintao Jiang ◽  
Wenxing Liang ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Antifungal Agent ◽  
Plant Pathogens ◽  
Efflux Pump ◽  
Hyphal Growth ◽  
Tomato Plants ◽  
Low Concentrations ◽  
Grey Mold

Tetrandrine (TET) is a potent calcium channel blocker used for the treatment of hypertension and inflammation. Currently, TET is predominantly used to treat a variety of human diseases, and there is little information regarding the use of TET against plant pathogens. In this study, we explored the antifungal activity of TET on a plant pathogen, Botrytis cinerea. We show that administration of low concentrations of TET effectively inhibited hyphal growth of fungus grown on potato dextrose agarose, and decreased the virulence of B. cinerea in tomato plants. Real-time PCR revealed that the expression of drug efflux pump related genes (alcohol dehydrogenase 1, multi-drug/pheromone exporter, pleiotropic drug resistance protein 1, and synaptic vesicle transporter) were down-regulated in the presence of TET. Finally, we show that TET acts synergistically with iprodione, resulting in increased inhibition of B. cinerea both in vitro and in vivo. These results indicate that TET might act as an effective antifungal agent in reducing grey mold disease.

Sign in / Sign up

Export Citation Format

Share Document