scholarly journals Multiple Compact Camera Fluorescence Detector for Real-Time PCR Devices

Sensors ◽  
2021 ◽  
Vol 21 (21) ◽  
pp. 7013
Author(s):  
Seul-Bit-Na Koo ◽  
Hyeon-Gyu Chi ◽  
Jong-Dae Kim ◽  
Yu-Seop Kim ◽  
Ji-Sung Park ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
High Performance ◽  
Signal To Noise Ratio ◽  
Low Cost ◽  
Optical Element ◽  
Dna Amplification ◽  
Biological Research ◽  
Fluorescence Detector ◽  
Fluorescence Excitation

The polymerase chain reaction is an important technique in biological research because it tests for diseases with a small amount of DNA. However, this process is time consuming and can lead to sample contamination. Recently, real-time PCR techniques have emerged which make it possible to monitor the amplification process for each cycle in real time. Existing camera-based systems that measure fluorescence after DNA amplification simultaneously process fluorescence excitation and emission for dozens of tubes. Therefore, there is a limit to the size, cost, and assembly of the optical element. In recent years, imaging devices for high-performance, open platforms have benefitted from significant innovations. In this paper, we propose a fluorescence detector for real-time PCR devices using an open platform camera. This system can reduce the cost, and can be miniaturized. To simplify the optical system, four low-cost, compact cameras were used. In addition, the field of view of the entire tube was minimized by dividing it into quadrants. An effective image processing method was used to compensate for the reduction in the signal-to-noise ratio. Using a reference fluorescence material, it was confirmed that the proposed system enables stable fluorescence detection according to the amount of DNA.

scholarly journals Multiple Camera Fluorescence Detection for Real-Time PCR

2021 ◽  
Vol 6 (1) ◽  
pp. 71
Author(s):  
Seul-Bit-Na Koo ◽  
Hyeon-Gyu Chi ◽  
Ji-Sung Park ◽  
Jong-Dae Kim ◽  
Chan-Young Park ◽  
...  
Keyword(s):  
Real Time ◽  
Fluorescence Detection ◽  
Real Time Pcr ◽  
Detection System ◽  
Low Cost ◽  
Dna Amplification ◽  
Multiple Camera ◽  
Open Platform ◽  
Polymerase Chain ◽  
Fluorescence Detection System

The general polymerase chain reaction (PCR) amplifies DNA and analyzes the amplification results of the quantified DNA. Recently, real-time PCR has been developed to detect DNA amplification in various ways. The conventional camera-based system is too expensive and difficult to reduce device size. In this paper, we propose a low-cost, compact fluorescence detection system for real-time PCR systems using an open platform camera. To simplify the optics, four low-cost small cameras were fixedly placed, and the entire tube was divided into four quadrants to minimize the field of view. In addition, an effective image processing method was used to compensate. The proposed system measured the fluorescence detection performance on the basis of the amount of DNA using various fluorescent substances.

scholarly journals Quantitative Analysis of Fluorescence Detection Using a Smartphone Camera for a PCR Chip

Sensors ◽  
2021 ◽  
Vol 21 (11) ◽  
pp. 3917
Author(s):  
Jong-Dae Kim ◽  
Chan-Young Park ◽  
Yu-Seop Kim ◽  
Ji-Soo Hwang
Keyword(s):  
Quantitative Analysis ◽  
Fluorescence Detection ◽  
High Performance ◽  
Low Cost ◽  
Dna Amplification ◽  
Fluorescent Detection ◽  
Rt Pcr ◽  
Commercial System ◽  
Intensity Changes ◽  
The Difference

Most existing commercial real-time polymerase chain reaction (RT-PCR) instruments are bulky because they contain expensive fluorescent detection sensors or complex optical structures. In this paper, we propose an RT-PCR system using a camera module for smartphones that is an ultra small, high-performance and low-cost sensor for fluorescence detection. The proposed system provides stable DNA amplification. A quantitative analysis of fluorescence intensity changes shows the camera’s performance compared with that of commercial instruments. Changes in the performance between the experiments and the sets were also observed based on the threshold cycle values in a commercial RT-PCR system. The overall difference in the measured threshold cycles between the commercial system and the proposed camera was only 0.76 cycles, verifying the performance of the proposed system. The set calibration even reduced the difference to 0.41 cycles, which was less than the experimental variation in the commercial system, and there was no difference in performance.

Complement C3 Genotyping of Slow and Fast Variants by Real Time PCR-High Resolution Melting

2012 ◽  
Vol 10 (3) ◽  
pp. 329-334 ◽  
Author(s):  
D.M. Valero-Hervás ◽  
P. Morales ◽  
M.J. Castro ◽  
P. Varela ◽  
M. Castillo-Rama ◽  
...  
Keyword(s):  
High Resolution ◽  
Real Time ◽  
Real Time Pcr ◽  
High Resolution Melting ◽  
Low Cost ◽  
Complement C3 ◽  
Amplification Refractory Mutation System ◽  
Rt Pcr ◽  
Dna Amount ◽  
Mutation System

“Slow” and “Fast” C3 complement variants (C3S and C3F) result from a g.304C>G polymorphism that changes arginine to glycine at position 102. C3 variants are associated with complement-mediated diseases and outcome in transplantation. In this work C3 genotyping is achieved by a Real Time PCR - High Resolution Melting (RT-PCR-HRM) optimized method. In an analysis of 49 subjects, 10.2% were C3FF, 36.7% were C3SF and 53.1% were C3SS. Allelic frequencies (70% for C3S and 30% for C3F) were in Hardy-Weinberg equilibrium and similar to those published previously. When comparing RT-PCR-HRM with the currently used Tetraprimer-Amplification Refractory Mutation System PCR (T-ARMS-PCR), coincidence was 93.8%. The procedure shown here includes a single primer pair and low DNA amount per reaction. Detection of C3 variants by RT-PCR-HRM is accurate, easy, fast and low cost, and it may be the method of choice for C3 genotyping.

Ultrafast real-time PCR with integrated melting curve analysis and duplex capacities using a low-cost polymer lab-on-a-chip system

2015 ◽  
Author(s):  
Rainer Gransee ◽  
Tristan Schneider ◽  
Deniz Elyorgun ◽  
Xenia Strobach ◽  
Tobias Schunck ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Low Cost ◽  
Melting Curve ◽  
Lab On A Chip ◽  
Curve Analysis ◽  
Melting Curve Analysis

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

scholarly journals Primers designed for the detection of grapevine pathogens spreading with propagating material by quantitative real-time PCR

2015 ◽  
Vol 21 (1-2) ◽  
Author(s):  
N. Czotter ◽  
E. Manduláné Farkas ◽  
R. Lózsa ◽  
I. Ember ◽  
G. Szûcsné Varga ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Molecular Techniques ◽  
Latent Infections ◽  
Quantitative Real Time Pcr ◽  
Detection And Identification

Several grapevine pathogens are disseminated by propagating material as systemic, but latent infections. Their detection and identification have a basic importance in the production and handling of propagating stocks. Thus several sensitive and reliable diagnostic protocols mostly based on molecular techniques have been developed. Of these methods quantitative real-time PCR (q-PCR) has recently got an emerging importance. Here we collected primer data for the detection and identification of grapevine pathogens which are important in the production of propagating stocks by q-PCR. Additional novel techniques that use DNA amplification, hybridization and  sequencing are also briefly reviewed.

scholarly journals Use of Ethidium Monoazide and PCR in Combination for Quantification of Viable and Dead Cells in Complex Samples

2005 ◽  
Vol 71 (2) ◽  
pp. 1018-1024 ◽  
Author(s):  
Knut Rudi ◽  
Birgitte Moen ◽  
Signe Marie Drømtorp ◽  
Askild L. Holck
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dynamic Range ◽  
Covalent Binding ◽  
Biological Research ◽  
Complex Samples ◽  
Ethidium Monoazide ◽  
Food Borne ◽  
Pcr Method ◽  
Membrane Cell

ABSTRACT The distinction between viable and dead cells is a major issue in many aspects of biological research. The current technologies for determining viable versus dead cells cannot readily be used for quantitative differentiation of specific cells in mixed populations. This is a serious limitation. We have solved this problem by developing a new concept with the viable/dead stain ethidium monoazide (EMA) in combination with real-time PCR (EMA-PCR). A dynamic range of approximately 4 log10 was obtained for the EMA-PCR viable/dead assay. Viable/dead differentiation is obtained by covalent binding of EMA to DNA in dead cells by photoactivation. EMA penetrates only dead cells with compromised membrane/cell wall systems. DNA covalently bound to EMA cannot be PCR amplified. Thus, only DNA from viable cells can be detected. We evaluated EMA-PCR with the major food-borne bacterium Campylobacter jejuni as an example. Traditional diagnosis of this bacterium is very difficult due to its specific growth requirements and because it may enter a state where it is viable but not cultivable. The conditions analyzed included detection in mixed and natural samples, survival in food, and survival after disinfection or antibiotic treatment. We obtained reliable viable/dead quantifications for all conditions tested. Comparison with standard fluorescence-based viable/dead techniques showed that the EMA-PCR has a broader dynamic range and enables quantification in mixed and complex samples. In conclusion, EMA-PCR offers a novel real-time PCR method for quantitative distinction between viable and dead cells with potentially very wide application.

Using AI at the Edge and Incremental Machine Learning to Process Onboard Instrument Data

2021 ◽  
Author(s):  
Nicholas Parkyn
Keyword(s):  
Machine Learning ◽  
Neural Networks ◽  
Real Time ◽  
Data Storage ◽  
High Performance ◽  
Heterogeneous Computing ◽  
Low Cost ◽  
Machine Intelligence ◽  
Edge Computing ◽  
Continual Learning

Emerging heterogeneous computing, computing at the edge, machine learning and AI at the edge technology drives approaches and techniques for processing and analysing onboard instrument data in near real-time. The author has used edge computing and neural networks combined with high performance heterogeneous computing platforms to accelerate AI workloads. Heterogeneous computing hardware used is readily available, low cost, delivers impressive AI performance and can run multiple neural networks in parallel. Collecting, processing and machine learning from onboard instruments data in near real-time is not a trivial problem due to data volumes, complexities of data filtering, data storage and continual learning. Little research has been done on continual machine learning which aims at a higher level of machine intelligence through providing the artificial agents with the ability to learn from a non-stationary and never-ending stream of data. The author has applied the concept of continual learning to building a system that continually learns from actual boat performance and refines predictions previously done using static VPP data. The neural networks used are initially trained using the output from traditional VPP software and continue to learn from actual data collected under real sailing conditions. The author will present the system design, AI, and edge computing techniques used and the approaches he has researched for incremental training to realise continual learning.

Low-Cost Receiver and Network Real-Time Kinematic Positioning for use in Connected and Autonomous Vehicles

2019 ◽  
Vol 72 (04) ◽  
pp. 917-930
Author(s):  
Fang-Shii Ning ◽  
Xiaolin Meng ◽  
Yi-Ting Wang
Keyword(s):  
Real Time ◽  
Autonomous Vehicles ◽  
High Performance ◽  
Low Cost ◽  
Satellite System ◽  
High Accuracy ◽  
Future Trend ◽  
Intelligent Transport System ◽  
Positioning System ◽  
Gnss Receiver

Connected and Autonomous Vehicles (CAVs) have been researched extensively for solving traffic issues and for realising the concept of an intelligent transport system. A well-developed positioning system is critical for CAVs to achieve these aims. The system should provide high accuracy, mobility, continuity, flexibility and scalability. However, high-performance equipment is too expensive for the commercial use of CAVs; therefore, the use of a low-cost Global Navigation Satellite System (GNSS) receiver to achieve real-time, high-accuracy and ubiquitous positioning performance will be a future trend. This research used RTKLIB software to develop a low-cost GNSS receiver positioning system and assessed the developed positioning system according to the requirements of CAV applications. Kinematic tests were conducted to evaluate the positioning performance of the low-cost receiver in a CAV driving environment based on the accuracy requirements of CAVs. The results showed that the low-cost receiver satisfied the “Where in Lane” accuracy level (0·5 m) and achieved a similar positioning performance in rural, interurban, urban and motorway areas.

Sign in / Sign up

Export Citation Format

Share Document