First report of the non-native webspinner Embia cf. savignyi Westwood, 1837 (Embioptera: Embiidae) in the Canary Islands with descriptions of its cytogenetic and morphological characteristics
Sweet persimmon (Diospyros kaki L.), a fruit tree in the Ebenaceae, is cultivated widely in Korea and Japan, the leading producers worldwide (2). Sweet persimmon fruit with flyspeck symptoms were collected from orchards in the Jinju area of Korea in November 2010. The fruit had fungal clusters of black, round to ovoid, sclerotium-like fungal bodies with no visible evidence of a mycelial mat. Orchard inspections revealed that disease incidence ranged from 10 to 20% in the surveyed area (approximately 10 ha) in 2010. Flyspeck symptoms were observed on immature and mature fruit. Sweet persimmon fruit peels with flyspeck symptoms were removed, dried, and individual speck lesions transferred to potato dextrose agar (PDA) and cultured at 22°C in the dark. Fungal isolates were obtained from flyspeck colonies on 10 sweet persimmon fruit harvested from each of three orchards. Fungal isolates that grew from the lesions were identified based on a previous description (1). To confirm identity of the causal fungus, the complete internal transcribed spacer (ITS) rDNA sequence of a representative isolate was amplified and sequenced using primers ITS1 and ITS4 (4). The resulting 552-bp sequence was deposited in GenBank (Accession No. HQ698923). Comparison with ITS rDNA sequences showed 100% similarity with a sequence of Zygophiala wisconsinensis Batzer & Crous (GenBank Accession No. AY598855), which infects apple. To fulfill Koch's postulates, mature, intact sweet persimmon fruit were surface sterilized with 70% ethanol and dried. Three fungal isolates from this study were grown on PDA for 1 month. A colonized agar disc (5 mm in diameter) of each isolate was cut from the advancing margin of a colony with a sterilized cork borer, transferred to a 1.5-ml Eppendorf tube, and ground into a suspension of mycelial fragments and conidia in a blender with 1 ml of sterile, distilled water. The inoculum of each isolate was applied by swabbing a sweet persimmon fruit with the suspension. Three sweet persimmon fruit were inoculated per isolate. Three fruit were inoculated similarly with sterile, distilled water as the control treatment. After 1 month of incubation in a moist chamber at 22°C, the same fungal fruiting symptoms were reproduced as observed in the orchards, and the fungus was reisolated from these symptoms, but not from the control fruit, which were asymptomatic. On the basis of morphological characteristics of the fungal colonies, ITS sequence, and pathogenicity to persimmon fruit, the fungus was identified as Z. wisconsinensis (1). Flyspeck is readily isolated from sweet persimmon fruit in Korea and other sweet persimmon growing regions (3). The exposure of fruit to unusual weather conditions in Korea in recent years, including drought, and low-temperature and low-light situations in late spring, which are favorable for flyspeck, might be associated with an increase in occurrence of flyspeck on sweet persimmon fruit in Korea. To our knowledge, this is the first report of Z. wisconsinensis causing flyspeck on sweet persimmon in Korea. References: (1) J. C. Batzer et al. Mycologia 100:246, 2008. (2) FAOSTAT Database. Retrieved from http://faostat.fao.org/ , 2008. (3) H. Nasu and H. Kunoh. Plant Dis. 71:361, 1987. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, Inc., New York, 1990.
Knowledge of pathogens in switchgrass, a potential biofuels crop, is limited. In December 2007, dark brown to black irregularly shaped foliar spots were observed on ‘Alamo’ switchgrass (Panicum virgatum L.) on the campus of the University of Tennessee. Symptomatic leaf samples were surface-sterilized (95% ethanol, 1 min; 20% commercial bleach, 3 min; 95% ethanol, 1 min), rinsed in sterile water, air-dried, and plated on 2% water agar amended with 3.45 mg fenpropathrin/liter (Danitol 2.4 EC, Valent Chemical, Walnut Creek, CA) and 10 mg/liter rifampicin (Sigma-Aldrich, St. Louis, MO). A sparsely sporulating, dematiaceous mitosporic fungus was observed. Fungal plugs were transferred to surface-sterilized detached ‘Alamo’ leaves on sterile filter paper in a moist chamber to increase spore production. Conidia were ovate, oblong, mostly straight to slightly curved, and light to olive-brown with 3 to 10 septa. Conidial dimensions were 12.5 to 17 × 27.5 to 95 (average 14.5 × 72) μm. Conidiophores were light brown, single, multiseptate, and geniculate. Conidial production was polytretic. Morphological characteristics and disease symptoms were similar to those described for Bipolaris oryzae (Breda de Haan) Shoemaker (2). Disease assays were done with 6-week-old ‘Alamo’ switchgrass grown from seed scarified with 60% sulfuric acid and surface-sterilized in 50% bleach. Nine 9 × 9-cm square pots with approximately 20 plants per pot were inoculated with a mycelial slurry (due to low spore production) prepared from cultures grown on potato dextrose agar for 7 days. Cultures were flooded with sterile water and rubbed gently to loosen mycelium. Two additional pots were inoculated with sterile water and subjected to the same conditions to serve as controls. Plants were exposed to high humidity by enclosure in a plastic bag for 72 h. Bags were removed, and plants were incubated at 25/20°C with 50 to 60% relative humidity. During the disease assay, plants were kept in a growth chamber with a 12-h photoperiod of fluorescent and incandescent lighting. Foliar leaf spot symptoms appeared 5 to 14 days post-inoculation for eight of nine replicates. Control plants had no symptoms. Symptomatic leaf tissue was processed and plated as described above. The original fungal isolate and the pathogen recovered in the disease assay were identified using internal transcribed spacer (ITS) region sequences. The ITS region of rDNA was amplified with PCR and primer pairs ITS4 and ITS5 (4). PCR amplicons of 553 bp were sequenced, and sequences from the original isolate and the reisolated pathogen were identical (GenBank Accession No. JQ237248). The sequence had 100% nucleotide identity to B. oryzae from switchgrass in Mississippi (GU222690, GU222691, GU222692, and GU222693) and New York (JF693908). Leaf spot caused by B. oryzae on switchgrass has also been described in North Dakota (1) and was seedborne in Mississippi (3). To our knowledge, this is the first report of B. oryzae from switchgrass in Tennessee. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/, 28 June 2012. (2) J. M. Krupinsky et al. Can. J. Plant Pathol. 26:371, 2004. (3) M. Tomaso-Peterson and C. J. Balbalian. Plant Dis. 94:643, 2010. (4) T. J. White et al. Pages 315-322 in: PCR Protocols: a Guide to Methods and Applications. M. A. Innis et al. (eds), Acad. Press, San Diego, 1990.
Worldwide, Japanese yew (Taxus cuspidata Sieb. & Zucc.) is a popular garden tree, with large trees also being used for timber. In July 2012, leaf blight was observed on 10% of Japanese yew seedling leaves planted in a 500-m2 field in Andong, Gyeongsangbuk-do Province, South Korea. Typical symptoms included small, brown lesions that were first visible on the leaf margin, which enlarged and coalesced into the leaf becoming brown and blighted. To isolate potential pathogens from infected leaves, small sections of leaf tissue (5 to 10 mm2) were excised from lesion margins. Eight fungi were isolated from eight symptomatic trees, respectively. These fungi were hyphal tipped twice and transferred to potato dextrose agar (PDA) plates for incubation at 25°C. After 7 days, the fungi produced circular mats of white aerial mycelia. After 12 days, black acervuli containing slimy spore masses formed over the mycelial mats. Two representative isolates were further characterized. Their conidia were straight or slightly curved, fusiform to clavate, five-celled with constrictions at the septa, and 17.4 to 28.5 × 5.8 to 7.1 μm. Two to four 19.8- to 30.7-μm-long hyaline filamentous appendages (mostly three appendages) were attached to each apical cell, whereas one 3.7- to 7.1-μm-long hyaline appendage was attached to each basal cell, matching the description for Pestalotiopsis microspora (2). The pathogenicity of the two isolates was tested using 2-year-old plants (T. cuspidata var. nana Rehder; three plants per isolate) in 30-cm-diameter pots filled with soil under greenhouse conditions. The plants were inoculated by spraying the leaves with an atomizer with a conidial suspension (105 conidia/ml; ~50 ml on each plant) cultured for 10 days on PDA. As a control, three plants were inoculated with sterilized water. The plants were covered with plastic bags for 72 h to maintain high relative humidity (24 to 28°C). At 20 days after inoculation, small dark lesions enlarged into brown blight similar to that observed on naturally infected leaves. P. microspora was isolated from all inoculated plants, but not the controls. The fungus was confirmed by molecular analysis of the 5.8S subunit and flanking internal transcribed spaces (ITS1 and ITS2) of rDNA amplified from DNA extracted from single-spore cultures, and amplified with the ITS1/ITS4 primers and sequenced as previously described (4). Sequences were compared with other DNA sequences in GenBank using a BLASTN search. The P. microspora isolates were 99% homologous to other P. microspora (DQ456865, EU279435, FJ459951, and FJ459950). The morphological characteristics, pathogenicity, and molecular data assimilated in this study corresponded with the fungus P. microspora (2). This fungus has been previously reported as the causal agent of scab disease of Psidium guajava in Hawaii, the decline of Torreya taxifolia in Florida, and the leaf blight of Reineckea carnea in China (1,3). Therefore, this study presents the first report of P. microspora as a pathogen on T. cuspidata in Korea. The degree of pathogenicity of P. microspora to the Korean garden evergreen T. cuspidata requires quantification to determine its potential economic damage and to establish effective management practices. References: (1) D. F. Farr and A. Y. Rossman, Fungal Databases, Syst. Mycol. Microbiol. Lab. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ (2) L. M. Keith et al. Plant Dis. 90:16, 2006. (3) S. S. N. Maharachchikumbura. Fungal Diversity 50:167, 2011. (4) T. J. White et al. PCR Protocols. Academic Press, San Diego, CA, 1990.
Chrysanthemum (Chrysanthemum × morifolium) plants exhibiting stem and foliage blight were observed in a commercial nursery in eastern Oklahoma in June 2019. Disease symptoms were observed on ~10% of plants during a period of frequent rain and high temperatures (26-36°C). Dark brown lesions girdled the stems of symptomatic plants and leaves were wilted and necrotic. The crown and roots were asymptomatic and not discolored. A species of Phytophthora was consistently isolated from the stems of diseased plants on selective V8 agar (Lamour and Hausbeck 2000). The Phytophthora sp. produced ellipsoid to obpyriform sporangia that were non-papillate and persistent on V8 agar plugs submerged in distilled water for 8 h. Sporangia formed on long sporangiophores and measured 50.5 (45-60) × 29.8 (25-35) µm. Oospores and chlamydospores were not formed by individual isolates. Mycelium growth was present at 35°C. Isolates were tentatively identified as P. drechsleri using morphological characteristics and growth at 35°C (Erwin and Ribeiro 1996). DNA was extracted from mycelium of four isolates, and the internal transcribed spacer (ITS) region was amplified using universal primers ITS 4 and ITS 6. The PCR product was sequenced and a BLASTn search showed 100% sequence similarity to P. drechsleri (GenBank Accession Nos. KJ755118 and GU111625), a common species of Phytophthora that has been observed on ornamental and vegetable crops in the U.S. (Erwin and Ribeiro 1996). The gene sequences for each isolate were deposited in GenBank (accession Nos. MW315961, MW315962, MW315963, and MW315964). These four isolates were paired with known A1 and A2 isolates on super clarified V8 agar (Jeffers 2015), and all four were mating type A1. They also were sensitive to the fungicide mefenoxam at 100 ppm (Olson et al. 2013). To confirm pathogenicity, 4-week-old ‘Brandi Burgundy’ chrysanthemum plants were grown in 10-cm pots containing a peat potting medium. Plants (n = 7) were atomized with 1 ml of zoospore suspension containing 5 × 103 zoospores of each isolate. Control plants received sterile water. Plants were maintained at 100% RH for 24 h and then placed in a protected shade-structure where temperatures ranged from 19-32°C. All plants displayed symptoms of stem and foliage blight in 2-3 days. Symptoms that developed on infected plants were similar to those observed in the nursery. Several inoculated plants died, but stem blight, dieback, and foliar wilt were primarily observed. Disease severity averaged 50-60% on inoculated plants 15 days after inoculation. Control plants did not develop symptoms. The pathogen was consistently isolated from stems of symptomatic plants and verified as P. drechsleri based on morphology. The pathogenicity test was repeated with similar results. P. drechsleri has a broad host range (Erwin and Ribeiro 1996; Farr et al. 2021), including green beans (Phaseolus vulgaris), which are susceptible to seedling blight and pod rot in eastern Oklahoma. Previously, P. drechsleri has been reported on chrysanthemums in Argentina (Frezzi 1950), Pennsylvania (Molnar et al. 2020), and South Carolina (Camacho 2009). Chrysanthemums are widely grown in nurseries in the Midwest and other regions of the USA for local and national markets. This is the first report of P. drechsleri causing stem and foliage blight on chrysanthemum species in the United States. Identifying sources of primary inoculum may be necessary to limit economic loss from P. drechsleri.
First report of Coniella castaneicola causing leaf blight on blueberry (Vaccinium virgatum) in China
Blueberry (Vaccinium virgatum), an economically important small fruit crop, is characterized by its highly nutritive compounds and high content and wide diversity of bioactive compounds (Miller et al. 2019). In September 2020, an unknown leaf blight disease was observed on Rabbiteye blueberry at the Agricultural Science and Technology Park of Jiangxi Agricultural University in Nanchang, China (28°45'51"N, 115°50'52"E). Disease surveys were conducted at that time, the results showed that disease incidence was 90% from a sampled population of 100 plants in the field, and this disease had not been found at other cultivation fields in Nanchang. Leaf blight disease on blueberry caused the leaves to shrivel and curl, or even fall off, which hindered floral bud development and subsequent yield potential. Symptoms of the disease initially appeared as irregular brown spots (1 to 7 mm in diameter) on the leaves, subsequently coalescing to form large irregular taupe lesions (4 to 15 mm in diameter) which became curly. As the disease progressed, irregular grey-brown and blighted lesion ran throughout the leaf lamina from leaf tip to entire leaf sheath and finally caused dieback and even shoot blight. To identify the causal agent, 15 small pieces (5 mm2) of symptomatic leaves were excised from the junction of diseased and healthy tissue, surface-sterilized in 75% ethanol solution for 30 sec and 0.1% mercuric chloride solution for 2 min, rinsed three times with sterile distilled water, and then incubated on potato dextrose agar (PDA) at 28°C for 5-7 days in darkness. Five fungal isolates showing similar morphological characteristics were obtained as pure cultures by single-spore isolation. All fungal colonies on PDA were white with sparse creeping hyphae. Pycnidia were spherical, light brown, and produced numerous conidia. Conidia were 10.60 to 20.12 × 1.98 to 3.11 µm (average 15.27 × 2.52 µm, n = 100), fusiform, sickle-shaped, light brown, without septa. Based on morphological characteristics, the fungal isolates were suspected to be Coniella castaneicola (Cui 2015). To further confirm the identity of this putative pathogen, two representative isolates LGZ2 and LGZ3 were selected for molecular identification. The internal transcribed spacer region (ITS) and large subunit (LSU) were amplified and sequenced using primers ITS1/ITS4 (Peever et al. 2004) and LROR/LR7 (Castlebury and Rossman 2002). The sequences of ITS region (GenBank accession nos. MW672530 and MW856809) showed 100% identity with accessions numbers KF564280 (576/576 bp), MW208111 (544/544 bp), MW208112 (544/544 bp) of C. castaneicola. LSU gene sequences (GenBank accession nos. MW856810 to 11) was 99.85% (1324/1326 bp, 1329/1331 bp) identical to the sequences of C. castaneicola (KY473971, KR232683 to 84). Pathogenicity was tested on three blueberry varieties (‘Rabbiteye’, ‘Double Peak’ and ‘Pink Lemonade’), and four healthy young leaves of a potted blueberry of each variety with and without injury were inoculated with 20 μl suspension of prepared spores (106 conidia/mL) derived from 7-day-old cultures of LGZ2, respectively. In addition, four leaves of each variety with and without injury were sprayed with sterile distilled water as a control, respectively. The experiment was repeated three times, and all plants were incubated in a growth chamber (a 12h light and 12h dark period, 25°C, RH greater than 80%). After 4 days, all the inoculated leaves started showing disease symptoms (large irregular grey-brown lesions) as those observed in the field and there was no difference in severity recorded between the blueberry varieties, whereas the control leaves showed no symptoms. The fungus was reisolated from the inoculated leaves and confirmed as C. castaneicola by morphological and molecular identification, fulfilling Koch’s postulates. To our knowledge, this is the first report of C. castaneicola causing leaf blight on blueberries in China. The discovery of this new disease and the identification of the pathogen will provide useful information for developing effective control strategies, reducing economic losses in blueberry production, and promoting the development of the blueberry industry.
Mediterranean fan palm (Chamaerops humilis L.), one of just two autochthonous European palms, is native to the western Mediterranean Region in southwestern Europe and northwestern Africa. It can be found growing wild in the Mediterranean area. In Europe, this species is very popular as an ornamental plant. In March 2009, a widespread damping-off was observed in a stock of approximately 30,000 potted 1-month-old plants of C. humilis cv. Vulcano in a nursery in eastern Sicily. Disease incidence was approximately 20%. Disease symptoms consisted of lesions at the seedling shoot (plumule). Stem lesions were initially orange, turned brown, and followed by death of the entire plumule or eophyll. A fungus with mycelial and morphological characteristics of Rhizoctonia solani Kühn was consistently isolated from lesions when plated on potato dextrose agar (PDA) amended with streptomycin sulfate at 100 μg/ml. Fungal colonies were initially white, turned brown with age, and produced irregularly shaped, brown sclerotia. Mycelium was branched at right angles with a septum near the branch and a slight constriction at the branch base. Hyphal cells removed from cultures grown at 25°C on 2% water agar were determined to be multinucleate when stained with 1% safranin O and 3% KOH solution (1) and examined at ×400. Anastomosis groups were determined by pairing isolates with tester strains AG-1 IA, AG-2-2-1, AG-2-2IIIB, AG-2-2IV, AG-3, AG-4, AG-5, AG-6, and AG-11 on 2% water agar in petri plates (3). Anastomosis was observed only with tester isolates of AG-4, giving both C2 and C3 reactions (2). One representative isolate obtained from symptomatic tissues was deposited at the Fungal Biodiversity Centre, Centraalbureau voor Schimmelcultures (CBS No. 125095). Pathogenicity tests were performed on container-grown, healthy, 1-month-old seedlings. Twenty plants of C. humilis cv. Vulcano were inoculated near the base of the stem with two 1-cm2 PDA plugs from 5-day-old mycelial cultures. The same number of plants served as uninoculated controls. Plants were incubated in a growth chamber and maintained at 25°C and 95% relative humidity on a 12-h fluorescent light/dark regimen. Symptoms identical to those observed in the nursery appeared 5 days after inoculation and all plants died within 20 days. No disease was observed on control plants. A fungus identical in culture morphology to R. solani AG-4 was consistently reisolated from symptomatic tissues, confirming its pathogenicity. To our knowledge, this is the first report in the world of R. solani causing damping-off on Mediterranean fan palm. References: (1) R. J. Bandoni. Mycologia 71:873, 1979. (2) D. E. Carling. Page 37 in: Grouping in Rhizoctonia solani by Hyphal Anastomosis Reactions. Kluwer Academic Publishers, the Netherlands, 1996. (3) C. C. Tu and J. W. Kimbrough. Mycologia 65:941, 1973.
Lamb's lettuce or corn salad (Valerianella olitoria) is increasingly grown in Italy and used primarily in the preparation of mixed processed salad. In the fall of 2005, plants of lamb's lettuce, cv Trophy, exhibiting a basal rot were observed in some commercial greenhouses near Bergamo in northern Italy. The crown of diseased plants showed extensive necrosis, progressing to the basal leaves, with plants eventually dying. The first symptoms, consisting of water-soaked zonate lesions on basal leaves, were observed on 30-day-old plants during the month of October when temperatures ranged between 15 and 22°C. Disease was uniformly distributed in the greenhouses, progressed rapidly in circles, and 50% of the plants were affected. Diseased tissue was disinfested for 1 min in 1% NaOCl and plated on potato dextrose agar amended with 100 μg/liter of streptomycin sulfate. A fungus with the morphological characteristics of Rhizoctonia solani was consistently and readily isolated and maintained in pure culture after single-hyphal tipping (3). The five isolates of R. solani, obtained from affected plants successfully anastomosed with tester isolate AG 4, no. RT 31, received from R. Nicoletti of the Istituto Sperimentale per il Tabacco, Scafati, Italy (2). The hyphal diameter at the point of anastomosis was reduced, and cell death of adjacent cells occurred (1). Pairings were also made with AG 1, 2, 3, 5, 7, and 11 with no anastomoses observed between the five isolates and testers. For pathogenicity tests, the inoculum of R. solani (no. Rh. Vale 1) was grown on autoclaved wheat kernels at 25°C for 10 days. Plants of cv. Trophy were grown in 10-liter containers (20 × 50 cm, 15 plants per container) on a steam disinfested substrate (equal volume of peat and sand). Inoculations were made on 20-day-old plants by placing 2 g of infected wheat kernels at each corner of the container with 3 cm as the distance to the nearest plant. Plants inoculated with clean wheat kernels served as controls. Three replicates (containers) were used. Plants were maintained at 25°C in a growth chamber programmed for 12 h of irradiation at a relative humidity of 80%. The first symptoms, consisting of water-soaked lesions on the basal leaves, developed 5 days after inoculation with crown rot and plant kill in 2 weeks. Control plants remained healthy. R. solani was consistently reisolated from infected plants. The pathogenicity test was carried out twice with similar results. This is, to our knowledge, the first report of R. solani on lamb's lettuce in Italy as well as worldwide. The isolates were deposited at the AGROINNOVA fungal collection. The disease continues to spread in other greenhouses in northern Italy. References: (1) D. Carling. Rhizoctonia Species: Pages 37–47 in: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. B. Sneh et al., eds. Kluwer Academic Publishers, the Netherlands, 1996. (2) J. Parmeter et al. Phytopathology, 59:1270, 1969. (3) B. Sneh et al. Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN, 1996.
In Greece, kiwi (Actinidia deliciosa) is mostly found in the northern part of the country where approximately 440,000 ha are grown. In the summer of 2006, a Stemphylium sp. was frequently isolated from leaves of kiwi (cv. Hayward) grown in the province of Imathia. Symptomatic leaves were covered with irregular, necrotic, brown areas. Lesions had a distinct margin that, in some cases, covered a wide part of the diseased leaves. Intense symptoms were frequently observed and associated with defoliation. This Stemphylium sp. was consistently isolated from diseased leaves onto potato dextrose agar (PDA) after surface sterilization with 0.1% chlorine solution. On the basis of morphological characteristics of mycelia, dimensions (length 20 to 29 μm and width 14 to 21 μm) and mean length/width ratio (1.42 μm) of conidia, and width and apical cell width of condiophores, the fungus was identified as Stemphylium botryosum (Wallr.) (2,3) Koch's postulates were completed in the laboratory by inoculating leaves of kiwi (cv. Hayward) with an isolate of S. botryosum originated from a symptomatic leaf of a Hayward kiwi. Twenty leaves were surface sterilized by dipping them into 0.1% chlorine solution for 2 to 3 min, washing in sterile distilled water, and allowing them to dry in a laminar flow hood. A leaf was then placed into a petri plate containing a wet, sterilized paper towel. Inoculation was made by transferring a 5-mm-diameter mycelial disc from the margins of a 7-day-old culture onto the center of each leaf surface. Petri plates were closed and incubated at 25°C with 12 h of light for 6 days. Koch's postulates were satisfied when the same S. botryosum was reisolated from 100% of inoculated leaves that developed symptoms similar to those observed in the vineyards. Leaves inoculated with a PDA plug alone (with no S. botryosum) did not develop any symptoms. Previously, Alternaria alternata was reported as the causal agent of a leaf spot pathogen of kiwi (1,4). To our knowledge, this is the first report of the occurrence of S. botryosum causing leaf blight of kiwi in Greece and worldwide. This pathogen can cause a high level of defoliation in diseased plants. References: (1) L. Corazza et al. Plant Dis. 83:487, 1999. (2) M. B. Ellis. Dematiaceous Hyphomycetes. Mycology Institute. London, England, 1971. (3) E. G. Simmons. Mycologia 61:1, 1969. (4) C. Tsahouridou and C. C. Thanassoulopoulos. Plant Dis. 84:371, 2000
Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.
Avicennia marina is a pioneer species of mangroves, a woody plant community that periodically emerges in the intertidal zone of estuarine regions in tropical and subtropical regions. In February 2013, a new disease that caused the stems of A. marina to blacken and die was found in Techeng Island of Zhanjiang, Guangdong Province, China. Initial symptoms of the disease were water-soaked brown spots on the biennial stems that coalesced so whole stems browned, twigs and branches withered, leaves defoliated, and finally trees died. This disease has the potential to threaten the ecology of the local A. marina community. From February to May 2013, 11 symptomatic trees were collected in three locations on the island and the pathogen was isolated as followed: tissues were surface disinfected with 75% ethanol solution (v/v) for 20 s, soaked in 0.1% mercuric chloride solution for 45 s, rinsed with sterilized water three times, dried, placed on potato dextrose agar (PDA), and incubated for 3 to 5 days at 28°C without light. Five isolates (KW1 to KW5) with different morphological characteristics were obtained, and pathogenic tests were done according Koch's postulates. Fresh wounds were made with a sterile needle on healthy biennial stems of A. marina, and mycelial plugs of each isolate were applied and covered with a piece of wet cotton to maintain moisture. All treated plants were incubated at room temperature. Similar symptoms of black stem were observed only on the stems inoculated the isolate KW5 after 35 days, while the control and all stems inoculated with the other isolates remained symptomless. An isolate similar to KW5 was re-isolated from the affected materials. The pathogenic test was repeated three times with the same conditions and it was confirmed that KW5 was the pathogen causing the black stem of A. marina. Hyphal tips of KW5 were transferred to PDA medium in petri dishes for morphological observation. After 48 to 72 h, white, orange, or brown flocculence patches of KW5 mycelium, 5.0 to 6.0 cm in diameter, grew. Tapering and spindle falciform macroconidia (11 to 17.3 μm long × 1.5 to 2.5 μm wide) with an obviously swelled central cell and narrow strips of apical cells and distinctive foot cells were visible under the optical microscope. The conidiogenous cells were intertwined with mycelia and the chlamydospores were globose and formed in clusters. These morphological characteristics of the isolate KW5 are characteristic of Fusarium equiseti (1). For molecular identification, the ITS of ribosomal DNA, β-tubulin, and EF-1α genes were amplified using the ITS4/ITS5 (5), T1/T2 (2), and EF1/EF2 (3) primer pairs. These sequences were deposited in GenBank (KF515650 for the ITS region; KF747330 for β-tubulin region, and KF747331 for EF-1α region) and showed 98 to 99% identity to F. equiseti strains (HQ332532 for ITS region, JX241676 for β-tubulin gene, and GQ505666 for EF-1α region). According to both morphological and sequences analysis, the pathogen of the black stem of A. marina was identified as F. equiseti. Similar symptoms on absorbing rootlets and trunks of A. marina had been reported in central coastal Queensland, but the pathogen was identified as Phytophthora sp. (4). Therefore, the disease reported in this paper differs from that reported in central coastal Queensland. To our knowledge, this is the first report of black stems of A. marina caused by F. equiseti in China. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, 1st ed. Wiley-Blackwell, Hoboken, NJ, 2006. (2) K. O'Donnell and E. Cigelnik. Mol. Phylogenet. Evol. 7:103, 1997. (3) K. O'Donnell et al. Proc. Natl. Acad. Sci. USA. 95:2044, 1998. (4) K. G. Pegg. Aust et al. Plant Pathol. 3:6, 1980. (5) A. W. Zhang et al. Plant Dis. 81:1143, 1997.
