scholarly journals Bacterial Shrimp Disease in Iraqi Marine Waters

2022 ◽  
Vol 6 (1) ◽  
pp. 51-57
Author(s):  
Abdul Amer Jassim
Keyword(s):  
Bacterial Infection ◽  
Severe Infection ◽  
First Record ◽  
Identification System ◽  
Marine Waters ◽  
Aeromonas Sobria ◽  
Biochemical Identification ◽  
Southern Iraq ◽  
Biochemical Examination

A sample of 116 shrimps Metapenaeus affinis (H. Milne-Edwards, 1837) were collected from local fish markets in Basrah Province, Southern Iraq. Height, weight, and pathological signs of the shrimps were recorded. Both morphological and biochemical examination by VITEK identification system were undertaken. Pathological infections were seen on the cuticle of abdominal segments in addition to a severe infection in uropod (tail segment), rostrum and pleopods (walking legs). Results of biochemical identification showed the presence of Aeromonas sobria and A. salmonicida from the infected organs and this study is considered as the first record of this bacterial infection in shrimps in Iraq.

scholarly journals Continuous elevation of procalcitonin in cirrhosis combined with hepatic carcinoma: a case report

2021 ◽  
Vol 21 (1) ◽  
Author(s):  
Juan Lu ◽  
Chun-lei Chen ◽  
Jian-di Jin ◽  
Jun Chen ◽  
Cheng-bo Yu
Keyword(s):  
Liver Disease ◽  
Bacterial Infection ◽  
Severe Infection ◽  
Serum Levels ◽  
Decompensated Cirrhosis ◽  
Hepatic Carcinoma ◽  
Multiple Loci ◽  
Before And After ◽  
Severe Cirrhosis ◽  
End Stage

Abstract Background Serum levels of procalcitonin (PCT) are considered a useful biomarker for the diagnosis of bacterial infection or inflammation. There are few reports of high PCT levels in end-stage liver disease regardless of bacterial infection. Here, we present a case of extremely high PCT levels (> 100 ng/mL) in a patient with severe cirrhosis combined with hepatic carcinoma. Case presentation A 65-year-old man developed end-stage cirrhosis with hepatic carcinoma. Radiographic imaging showed a massive hepatocellular carcinoma with multiple loci lack of indications of resection. Hence, transcatheter hepatic arterial chemoembolization was performed three times over a period of 4 months. Before and after interventional therapies, the biochemistry laboratory results were only slightly abnormal except for persistently high PCT concentrations (> 100 ng/mL), irrespective of the evidence for bacterial infection or sepsis. Conclusions This case suggests that continuously high levels of PCT (> 100 ng/mL) may be present in advanced liver disease, particularly in complex situations such as decompensated cirrhosis and liver cancer, in the absence of severe infection or sepsis. This knowledge could expand the significance of PCT in liver disease.

First record of genus Gallardoneris (Polychaeta: Lumbrineridae) in Mediterranean marine waters

2014 ◽  
Vol 7 ◽  
Author(s):  
Fabio Bertasi ◽  
Serena Lomiri ◽  
Danilo Vani ◽  
Benedetta Trabucco ◽  
Claudia Virno Lamberti
Keyword(s):  
First Record ◽  
Marine Waters

scholarly journals First record of roving coral grouper Plectropomus pessuliferus (Fowler, 1904) from Saint Martin’s Island, Bangladesh based on Morphology and DNA Barcoding

2021 ◽  
Vol 32 (2) ◽  
pp. 293-301
Author(s):  
MD JAYEDUL ISLAM ◽  
SHARMIN AKTER ◽  
PROVAKOR SARKAR ◽  
MOHAMMAD RASHED ◽  
IREEN PARVIN ◽  
...  
Keyword(s):  
Dna Barcoding ◽  
Bay Of Bengal ◽  
New Record ◽  
First Record ◽  
Morphological Characters ◽  
Marine Waters ◽  
First Report ◽  
Saint Martin ◽  
Northern Bay Of Bengal

A new record of Plectropomus pessuliferus (Serranidae: Epinephelinae) wasdocumented based on morphological characters and DNA barcoding. The species was collectedduring a regular survey for making an inventory of reef associated fishes in Saint Martin`sIsland, Bangladesh. This is the first report of roving coral grouper from the marine waters ofBangladesh validated by morpho-meristic analysis and DNA barcoding. This is also the firstreport from the northern Bay of Bengal.

scholarly journals First Report of Meloidogyne enterolobii on Carrot in China

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1019-1019 ◽  
Author(s):  
Y. F. Wang ◽  
S. Xiao ◽  
Y. K. Huang ◽  
X. Zhou ◽  
S. S. Zhang ◽  
...  
Keyword(s):  
Morphological Characteristics ◽  
Severe Infection ◽  
Original Description ◽  
First Record ◽  
Vegetable Crops ◽  
Species Identity ◽  
Fujian Province ◽  
First Report ◽  
Lateral Lines ◽  
Meloidogyne Sp

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Philometroides acanthopagri sp. nov., a new philometrid (Nematoda, Philometridae) from the musculature of Acanthopagrus latus (Sparidae) from marine waters of Iraq

2012 ◽  
Vol 57 (4) ◽  
Author(s):  
František Moravec ◽  
Abdul Jassim ◽  
Nadrah Al-Salim
Keyword(s):  
New Species ◽  
Arabian Gulf ◽  
Nematode Species ◽  
Microscopical Examination ◽  
Marine Waters ◽  
Pectoral Fins ◽  
Electron Microscopical ◽  
Acanthopagrus Latus ◽  
Southern Iraq ◽  
Scanning Electron

AbstractA new nematode species, Philometroides acanthopagri sp. nov. (Philometridae), is described from gravid and subgravid specimens found in the musculature near pectoral fins and in nasal cavity of the yellowfin seabream Acanthopagrus latus (Houttuyn) (Sparidae, Perciformes) from marine waters off the coast of southern Iraq. Based on light and scanning electron microscopical examination, the new species differs from its congeners in a combination of morphological and biometrical features. It is the first species of Philometroides reported from a sparid fish and the first representative of this genus recorded from fishes in the Arabian Gulf. A key to Philometroides species parasitizing marine and brackish-water fishes is provided.

scholarly journals First record of the rare crab Asthenognathus atlanticus Monod, 1933 (Crustacea: Brachyura: Varunidae) in the North Sea

2021 ◽  
Vol 50 (3) ◽  
pp. 352-358
Author(s):  
Marco Faasse ◽  
Hendrik Gheerardyn ◽  
Rob Witbaard ◽  
Joël Cuperus
Keyword(s):  
North Sea ◽  
First Record ◽  
Western Mediterranean ◽  
Distribution Range ◽  
Marine Waters ◽  
The West ◽  
The North ◽  
The North Sea ◽  
Northward Expansion ◽  
First Time

Abstract Several species new to the area were collected while monitoring Dutch marine waters using a dredge. The varunid crab Asthenognathus atlanticus Monod, 1933 was recorded for the first time in the North Sea. Until 2008, this relatively rare crab was known from the west coast of Africa and the western Mediterranean to northern Brittany in the north. In recent years, its distribution range has expanded, as indicated by records from the Bay of the Seine and the area around Dieppe-Le Tréport. Our finding from Brown Bank (southern North Sea) indicates a further, northward expansion of its distribution range. We list the hosts with which the crab is associated. Earlier arguments for climate change as an explanation for the northward range expansion are supported.

scholarly journals The First Record of Alternaria triticina the Causative Agent of Alternaria Leaf Blight in Wheat and Barley in Iraq

2014 ◽  
Vol 3 (3) ◽  
pp. 133-138
Author(s):  
Mohammed W. Khudhair ◽  
Hadi M. Aboud ◽  
Naeem S. Dheyab ◽  
Ali K. Shbar ◽  
Hiatham S. Khalaf
Keyword(s):  
Severe Infection ◽  
First Record ◽  
Leaf Blight ◽  
High Yield ◽  
Plant Parts ◽  
Isolation Frequency ◽  
Alternaria Leaf Blight ◽  
Almost All ◽  
First Time ◽  
Investigation Process

Alternaria leaf blight caused by Alternaria triticina can cause high yield losses at the severe infection in wheat and barley. It is first time for this pathogen to be recorded in Iraq. The investigation process of this disease included 25 locations from 12 sites in 5 provinces that plant wheat and barley in the south and middle of Iraq. The results revealed that the fungus was isolated from almost all examined locations with different frequency. Shethaif- Al Garbie and Sheikh Saad showed higher number of isolates with 60 and 40 in wheat fields respectively; while; Shethaif- Al Garbie and Dabuni expressed the highest number of isolates in barley fields with 45 and 33 respectively. The highest isolation frequency in wheat fields was at Sheikh Saad and Ali Alsharqi with 100% followed by Ali Algharbie with 90% and the lowest was at Al- Kut and Al-Huria with 37.5 and 40% respectively. The highest isolation frequency in barley fields was recorded at Dabuni with 82.5% followed by Shethaif- Al Garbie and Babil / Al-Huria with 75% and the lowest was at Al-Basrah/ Shatt al-Arab with 20%. The fungus was isolated from all plant parts (stem, leaf, and spike); however, spikes recorded the highest isolation frequency reaching 100% in some locations.

scholarly journals First Record of the Lessepsian Migrant Smith's Cardinalfish Jaydia smithi Kotthaus, 1970 (Pisces: Apogonidae) from Syrian Marine Waters

2017 ◽  
Vol 30 (2) ◽  
pp. 45-49
Author(s):  
Firas A. Al-Shawy ◽  
Murhaf M. Lahlah ◽  
Chirine S. Hussein
Keyword(s):  
Mediterranean Sea ◽  
Marine Environment ◽  
Ballast Water ◽  
First Record ◽  
Eastern Coast ◽  
Marine Waters ◽  
Environment Changes ◽  
Lessepsian Species ◽  
The Mediterranean ◽  
First Time

Five individuals of Smith's cardinalfish Jaydia smithi were collected from Ibn-Hani area, Lattakia, Syria on the eastern coast of the Mediterranean Sea. Their morphometric and meristic characteristics are reported. There are several factors which assisted this specimen to reach this area of the Mediterranean; some of these factors might be the marine environment changes and the ballast water. This study reports that Smith's cardinalfish Jaydia smithi, a member of Lessepsian species was found in Syrian marine waters for the first time.

Sign in / Sign up

Export Citation Format

Share Document