Performance of Robust Regression Methods in Real-Time Polymerase Chain Reaction Calibration

2014 ◽  
Vol 29 (4) ◽  
pp. 317-327 ◽  
Author(s):  
Annalisa Orenti ◽  
Ettore Marubini
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Robust Regression ◽  
Control Program ◽  
Ordinary Least Squares ◽  
Quality Control Program ◽  
Absolute Deviation ◽  
Nominal Level ◽  
Regression Methods ◽  
Polymerase Chain

The ordinary least squares (OLS) method is routinely used to estimate the unknown concentration of nucleic acids in a given solution by means of calibration. However, when outliers are present it could appear sensible to resort to robust regression methods. We analyzed data from an External Quality Control program concerning quantitative real-time PCR and we found that 24 laboratories out of 40 presented outliers, which occurred most frequently at the lowest concentrations. In this article we investigated and compared the performance of the OLS method, the least absolute deviation (LAD) method, and the biweight MM-estimator in real-time PCR calibration via a Monte Carlo simulation. Outliers were introduced by replacement contamination. When contamination was absent the coverages of OLS and MM-estimator intervals were acceptable and their widths small, whereas LAD intervals had acceptable coverages at the expense of higher widths. In the presence of contamination we observed a trade-off between width and coverage: the OLS performance got worse, the MM-estimator intervals widths remained short (but this was associated with a reduction in coverages), while LAD intervals widths were constantly larger with acceptable coverages at the nominal level.

Robust regression methods for real-time polymerase chain reaction

2015 ◽  
Vol 480 ◽  
pp. 34-36 ◽  
Author(s):  
Wim Trypsteen ◽  
Jan De Neve ◽  
Kobus Bosman ◽  
Monique Nijhuis ◽  
Olivier Thas ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Robust Regression ◽  
Chain Reaction ◽  
Regression Methods ◽  
Polymerase Chain

Diagnosis and Causative Species of Visceral Leishmaniasis in Southwest Saudi Arabia

2021 ◽  
Author(s):  
Aymen Abdelhaleem ◽  
Nabil Dhayhi ◽  
Mohamed Salih Mahfouz ◽  
Ommer Daffalla ◽  
Mansour Mubarki ◽  
...  
Keyword(s):  
Saudi Arabia ◽  
Visceral Leishmaniasis ◽  
Real Time ◽  
Real Time Pcr ◽  
Leishmania Donovani ◽  
Target Genes ◽  
Sample Volume ◽  
Pcr Products ◽  
Polymerase Chain ◽  
Robust Evidence

Visceral leishmaniasis (VL) is the most severe clinical form of the disease and has been reported in the Jazan region of southwest Saudi Arabia. This study aimed to diagnose VL by real-time polymerase chain reaction (PCR) and the direct agglutination test (DAT) and to identify the causative Leishmania species. A total of 80 participants, including 30 suspected VL patients, 30 healthy endemic control individuals, and 20 malaria disease controls, were enrolled in this study. Blood samples were collected and tested for Leishmania DNA by real-time PCR and for antibody by the DAT. Sequencing of some amplified PCR products was used to identify the causative Leishmania species. The diagnosis of VL was successfully achieved by both real-time PCR and by DAT with 100% sensitivity. Leishmania donovani and Leishmania infantum species were detected by sequencing both by the kDNA and ITS1 target genes, followed a BLASTn search. The detection of VL antibody by the DAT followed by the confirmatory detection of Leishmania DNA in patient blood by PCR could promote the adoption of the much less invasive and more sensitive methods for the routine diagnosis of VL. Further study with high sample volume to evaluate the PCR and the DAT are needed, to generate more robust evidence. Based on the sequencing results, emerging studies on VL should focus on the causative Leishmania species, reservoirs, and vectors that are important in the study area.

scholarly journals DETEKSI CLOSTRIDIUM DIFFICILE TOKSIGENIK MENGGUNAKAN UJI CEPAT TOKSIN DAN REAL TIME POLYMERASE CHAIN REACTION (Toxigenic Clostridium Difficile Detection Using Toxin Rapid Test and Real Time Polymerase Chain Reaction)

2018 ◽  
Vol 22 (1) ◽  
pp. 22
Author(s):  
Ika Yasma Yanti ◽  
Dalima Ari Wahono Astrawinata
Keyword(s):  
Polymerase Chain Reaction ◽  
Clostridium Difficile ◽  
Antibiotic Therapy ◽  
Real Time ◽  
Real Time Pcr ◽  
Rapid Test ◽  
Chain Reaction ◽  
Chi Square ◽  
Polymerase Chain ◽  
Clostridium Difficile Associated Diarrhea

Toxigenic Clostridium difficile infection, causing a Pseudo Membrane Colitis (PMC) and Clostridium Difficile Associated Diarrhea(CDAD) has increased sharply. The largest risk factor is the use of antibiotics. The purpose of this study was to know how to determinethe prevalence and characteristics of subjects with Toxigenic Clostridium difficile and to assess the ability of the toxin rapid test comparedto real-time PCR. Ninety adult subjects with antibiotic therapy more than two (2) weeks were enrolled in this study. The results of toxinrapid test and real-time PCR were presented in a 2x2 table, statistical test used was Chi square. The prevalence of Toxigenic Clostridiumdifficile based on the toxin rapid test and by real-time PCR was 27.3% and 37.5%, respectively. There were significant differences betweenstool consistency and number of antibiotics used with the detection of Toxigenic Clostridium difficile. There was a relationship betweenthe duration of antibiotic therapy with the detection of Toxigenic Clostridium difficile using real-time PCR (p=0.010, RR=2.116). Thesensitivity, specificity, PPV, NPV, PLR and NLR rapid test against real-time PCR were 69.7%; 98.2%; 95.8%; 84.4%; 39.2 and 0.31,respectively. This study concluded that the prevalence of Clostridium difficile in RSCM was higher compared to that in Malaysia, Thailandand India; the subjects with antibiotic therapy for more than four (4) weeks had a double risk to have Toxigenic Clostridium difficilethan subjects with antibiotic therapy for less than that time (4 weeks). Thus, in this study, toxin rapid test could be used as a tool todetect Toxigenic Clostridium difficile.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Quantitative Real-Time Polymerase Chain Reaction Detection of BK Virus Using Labeled Primers

2010 ◽  
Vol 134 (3) ◽  
pp. 444-448 ◽  
Author(s):  
Zhengming Gu ◽  
Jianmin Pan ◽  
Matthew J. Bankowski ◽  
Randall T. Hayden
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Quantitative Polymerase Chain Reaction ◽  
Bk Virus ◽  
Clinical Samples ◽  
Quantitative Detection ◽  
Chain Reaction ◽  
Pcr Method ◽  
Polymerase Chain

Abstract Context.—BK virus infections among immunocompromised patients are associated with disease of the kidney or urinary bladder. High viral loads, determined by quantitative polymerase chain reaction (PCR), have been correlated with clinical disease. Objective.—To develop and evaluate a novel method for real-time PCR detection and quantification of BK virus using labeled primers. Design.—Patient specimens (n = 54) included 17 plasma, 12 whole blood, and 25 urine samples. DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Applied Science, Indianapolis, Indiana); sample eluate was PCR-amplified using the labeled primer PCR method. Results were compared with those of a user-developed quantitative real-time PCR method (fluorescence resonance energy transfer probe hybridization). Results.—Labeled primer PCR detected less than 10 copies per reaction and showed quantitative linearity from 101 to 107 copies per reaction. Analytical specificity of labeled primer PCR was 100%. With clinical samples, labeled primer PCR demonstrated a trend toward improved sensitivity compared with the reference method. Quantitative assay comparison showed an R2 value of 0.96 between the 2 assays. Conclusions.—Real-time PCR using labeled primers is highly sensitive and specific for the quantitative detection of BK virus from a variety of clinical specimens. These data demonstrate the applicability of labeled primer PCR for quantitative viral detection and offer a simplified method that removes the need for separate oligonucleotide probes.

Rapid, specific and quantitative polymerase chain reaction (PCR) detection of pathogenic protozoa Entamoeba histolytica for drinking water supply

2011 ◽  
Vol 11 (4) ◽  
pp. 418-425 ◽  
Author(s):  
S. W. Lam ◽  
H. B. Zhang ◽  
L. Yu ◽  
C. H. Woo ◽  
K. N. Tiew ◽  
...  
Keyword(s):  
Real Time ◽  
Water Samples ◽  
Real Time Pcr ◽  
Genomic Dna ◽  
Tap Water ◽  
Pcr Detection ◽  
Raw Water ◽  
Conventional Pcr ◽  
Polymerase Chain ◽  
Species Specific

In this study, a quantitative species-specific polymerase chain reaction (PCR) method to rapidly detect E. histolytica in water is developed. First, the specificity of E. histolytica PCR detection was verified by using species-specific primers of 16S-like rRNA genes to clearly differentiate it from the closely related amoebae species E. dispar and E. moshkovskii. The sensitivity of this method was subsequently determined using purified E. histolytica genomic DNA and culture cells as PCR reaction templates. Results indicated that conventional PCR visualized on 1% agarose gel was able to detect as low as 0.02 pg genomic DNA and 5 cells, while real-time PCR could detect 0.01 pg genomic DNA and 2 cells of E. histolytica. The protocols for E. histolytica PCR detection in real water samples were then optimized by spiking E. histolytica cells into tap water and reservoir raw water samples. A two-round centrifugation treatment to concentrate amoeba cells directly as a PCR template was the most effective way to detect E. histolytica in spiked tap water samples, while DNA extraction after concentrating amoeba cells was required for spiked reservoir raw water samples. The detection limit of 50 E. histolytica cells in 100 ml tap water was achieved in 2 h from sample collection to real-time PCR data readout. With these established protocols, 78 tap water samples, 11 reservoir raw water samples and 4 feed water samples from Singapore water supply systems were analyzed by both conventional PCR and real-time PCR methods. No E. histolytica cell was detected in tested samples.

scholarly journals In Planta Distribution of ‘Candidatus Liberibacter asiaticus’ as Revealed by Polymerase Chain Reaction (PCR) and Real-Time PCR

2008 ◽  
Vol 98 (5) ◽  
pp. 592-599 ◽  
Author(s):  
Satyanarayana Tatineni ◽  
Uma Shankar Sagaram ◽  
Siddarame Gowda ◽  
Cecile J. Robertson ◽  
William O. Dawson ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Citrus Tree ◽  
Candidatus Liberibacter Asiaticus ◽  
In Planta ◽  
Chain Reaction ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Polymerase Chain

Huanglongbing (HLB) is one of the most devastating diseases of citrus worldwide, and is caused by a phloem-limited fastidious prokaryotic α-proteobacterium that is yet to be cultured. In this study, a combination of traditional polymerase chain reaction (PCR) and real-time PCR targeting the putative DNA polymerase and 16S rDNA sequence of ‘Candidatus Liberibacter asiaticus,’ respectively, were used to examine the distribution and movement of the HLB pathogen in the infected citrus tree. We found that ‘Ca. Liberibacter asiaticus’ was distributed in bark tissue, leaf midrib, roots, and different floral and fruit parts, but not in endosperm and embryo, of infected citrus trees. Quantification analysis of the HLB bacterium indicated that it was distributed unevenly in planta and ranged from 14 to 137,031 cells/μg of total DNA in different tissues. A relatively high concentration of ‘Ca. Liberibacter asiaticus’ was observed in fruit peduncles. Our data from greenhouse-infected plants also indicated that ‘Ca. Liberibacter asiaticus’ was transmitted systemically from infection site to different parts of the plant. Understanding the distribution and movement of the HLB bacterium inside an individual citrus tree is critical for discerning its virulence mechanism and to develop management strategies for HLB.

Sign in / Sign up

Export Citation Format

Share Document