The RPMI-1640 vitamin mixture promotes bovine blastocyst development in vitro and downregulates gene expression of TXNIP with epigenetic modification of associated histones

2017 ◽  
Vol 9 (1) ◽  
pp. 87-94 ◽  
Author(s):  
S. Ikeda ◽  
M. Sugimoto ◽  
S. Kume

Diverse environmental conditions surrounding preimplantation embryos, including available nutrients, affect their metabolism and development in both short- and long-term manner. Thioredoxin-interacting protein (TXNIP) is a possible marker for preimplantation stress that is implicated in in vitro fertilization- (IVF) induced long-term DOHaD effects. B vitamins, as participants in one-carbon metabolism, may affect preimplantation embryos by epigenetic alterations of metabolically and developmentally important genes. In vitro-produced bovine embryos were cultured with or without Roswell Park Memorial Institute 1640 vitamin mixture, containing B vitamins and B vitamin-like substances, from day 3 after IVF and we evaluated blastocyst development and TXNIP messenger RNA (mRNA) expression in the blastocysts by reverse transcription-quantitative polymerase chain reaction. The degree of trimethylation of histone H3 lysine 27 (H3K27me3) at TXNIP promoter was examined semi-quantitatively by chromatin immunoprecipitation polymerase chain reaction. Total H3K27me3 were also compared between the groups by Western blot analysis. The vitamin treatment significantly increased the rates of blastocyst development (P<0.05) and their hatching (P<0.001) from the zona pellucida by day 8. The mRNA expression of TXNIP was lower (P<0.01) in blastocysts in the vitamin-mixture-treated group concomitant with higher (P<0.05) level of H3K27me3 of its promoter compared with the control group. The total H3K27me3 in the vitamin-mixture-treated group was also higher (P<0.01) than that in the control group. The epigenetic control of genes related to important metabolic processes during the periconceptional period by nutritional conditions in utero and/or in vitro may have possible implication for the developmental programming during this period that may impact the welfare and production traits of farm animals.

2008 ◽  
Vol 20 (8) ◽  
pp. 908 ◽  
Author(s):  
Daniela Bebbere ◽  
Luisa Bogliolo ◽  
Federica Ariu ◽  
Stefano Fois ◽  
Giovanni Giuseppe Leoni ◽  
...  

The expression patterns of four maternal effect genes (MEG), namely zygote arrest 1 (ZAR1), maternal antigen that embryo requires (MATER), growth differentiation factor 9 (GDF9) and bone morphogenetic protein 15 (BMP15), were determined in ovine oocytes and in vitro-produced preimplantation embryos. The existence of ZAR1 and MATER in ovine species has not been reported previously. Reverse transcription–polymerase chain reaction was performed on germinal vesicle and IVM MII oocytes, as well as in in vitro fertilised and cultured two-, four-, eight- and 12/16-cell embryos, morulae and blastocysts. Quantification of gene expression by real-time polymerase chain reaction showed the highest abundance of all transcripts analysed in the immature oocyte. During the following stages of preimplantation development, the mRNAs examined exhibited different patterns of expression, but often significant decreases were observed during maturation and maternal–embryonic transition. The transcription of the four genes did not resume with activation of the genome.


Author(s):  
Sepideh Gholami Yarahmadi ◽  
Saeid Morovvati ◽  
Monireh Raam ◽  
Ziba Morovvati

Background and Aims: Azoospermia factor (AZF) region of the Ychromosome has several genes which are responsible for normal spermatogenesis. Microdeletions of these genes are associated with azoospermia and oligospermia. These microdeletions are too small to be detected by karyotyping. They can be easily identified using polymerase chain reaction. The aim of this study is to determine the frequencies of Ychromosome microdeletions in azoospermic and oligospermic Iranian infertile men and compare them with other studies in different ethnic groups. Materials and Methods: At first, karyotype analysis was performed in 80 infertile men and 30 healthy age-matched counterparts as control group using standard cytogenetic methods. Second, genomic DNA was extracted from all cases and genetic screening was conducted for Y chromosome microdeletions by multiplex polymerase chain reaction for AZF genes on both infertile and control men using 6 STS markers on the long arm of the Y chromosome. Results: Totally, 49 infertile men were azoospermic and 31 were oligospermic. Y-chromosome microdeletions in the AZFc region were detected in 4 of azoospermic patients. Y-chromosome microdeletions was not detected in any of the oligospermic patients and the control group. Conclusions: This finding recommends that genetic counseling and screening before starting assisted reproductive techniques such as in vitro fertilisation and intracytoplasmic sperm injection can prevent unnecessary treatment and transmission of genetic defects to offspring


2013 ◽  
Author(s):  
Γεωργία Κόκκαλη

IntroductionOne of the most difficult aspects in assisted reproductive technology (ART) is the selection of asuitable embryo for transfer to the patient’s uterus, in order to achieve implantation anddevelopment to term. This study was based on the hypothesis that preimplantation embryosmay have different gene expression profiles that characterize their ability to implant in theuterus and develop to a healthy baby at term.The main aim of this study was to investigate molecular markers associated with developmentalcompetence and successful implantation in ART. The primary aim of the study was to developand optimize a blastocyst biopsy method, suitable for application in clinical practice. Thesecondary aim of the study was to investigate the gene expression of beta Human ChorionicGonadotropin (CGβ) in blastocysts and correlate it with their morphology. Previously to thecurrent study, blastocyst biopsy was not implemented in clinical practice and no prior researchon the existence, quantification and standardization of transcripts of CGβ has been performedin blastocysts.MethodologyThe methodology for trophectoderm cell biopsy from blastocysts was developed and optimizedprimary to be a safe technique for the embryo and secondary to ensure biopsy of a sufficientnumber of cells, in order to allow the application of multiple molecular analyses. The blastocystbiopsy method involved three steps: A., opening of a hole in the zona pellucida using lowfrequency laser, B., blastocyst culture to allow trophectoderm cells to herniate from the holeand C., trophectoderm cell dissection of the blastocyst mass by laser ablation.The methodology for the investigation of CGβ gene expression in blastocysts, included RNAisolation, cDNA synthesis, amplification and quantification of CGβ transcripts. Because CGβ isencoded by a cluster of homologous genes (CGβ1, CGβ2, CGβ3, CGβ5, CGβ7, CGβ8),methodology was designed considering the homology between them into groups (A: CGβ1,CGβ2 and B: CGβ3, CGβ5, CGβ7, CGβ8). For group A, real time polymerase chain reaction (RealTime PCR, RT-PCR) was applied and then transcripts were identified using restriction enzymedigestion. For group B, nested polymerase chain reaction (Nested-PCR) was used incombination with polymerase chain reaction temperature decreasing hybridization (Touch-downPCR). Following amplification, the products were sequenced (DNA sequencing) for theiridentification.ResultsThe biopsy technique did not appear to impact on the blastocyst’s ability to reform a blastocoelecavity and continue to grow and hatch from the zona pellucida, as it was shown followingfurther in vitro culture. No blastocyst showed signs of morphological damage at the lightmicroscopic level. Blastocyst biopsy was applied in clinical practice in two steps: A., 49 couples undergoing IVF had a biopsy in 153 blastocysts. The implantation rate per blastocysttransferred was 34.3% and lead to 23 full-term pregnancies (46.9%) with 37 babies born. B.,24 couples undergoing IVF for PGD of monogenic diseases had biopsy in 144 blastocysts. Thediagnosis success rate was 93%, the implantation rate per blastocyst transferred was 40% andlead to 11 full-term pregnancies (50%) with 15 term newborns. Then, a randomized pilot studywas conducted with the aim to evaluate and compare the diagnosis and implantation successrates between patients undergoing blastomere biopsy and blastocyst transfer and those havingtrophectoderm biopsy and blastocyst transfer for the diagnosis of monogenic diseases. Theresults showed that the diagnosis success rate was superior in the blastocyst biopsy group,while implantation and pregnancy rates were not statistically significant between the twogroups.For the study of CGβ expression profiles 45 blastocysts were donated to research, of which 39generated trophectoderm cells cDNA libraries. RT-PCR revealed the presence of CGB3, CGB5,CGB7, CGB8 transcripts in 5 blastocysts. The transcripts CGB5, CGB7, CGB8 were expressed inone hatched and one hatching blastocysts (fair morphology on day 7 post insemination) and thetranscript CGβ3 was expressed in three hatched blastocysts (excellent morphology on day 5/6post insemination). The transcript CGβ1 was identified in one only blastocyst. Four blastocystswere biopsied in order to investigate whether CGβ expression can be detected at the minimallevel of few trophectoderm cells. No transcript was found in trophectoderm cell samples orbiopsied blastocyst proper.DiscussionIn recent years, many new technologies have been introduced in clinical practice of ART.Blastocyst biopsy since its first announcement in 2005, until today, has been adopted andintegrated into the application of preimplantation genetic diagnosis (Kokkali et al., 2005). Asblastocyst biopsy has the advantage of providing adequate number of cells for multipleanalyses, it has been lately used for the PGD for monogenic diseases in combination withhistocompatibility screening (HLA matching) or PGD for monogenic diseases screening forstructural or numerical chromosomal abnormalities. Besides its clinical application, blastocystbiopsy offers great opportunities for research, such as the study for the expression ofpreimplantation genetic profiles for the identification of the single most viable blastocyst amongthe cohort developing in vitro that will enable single blastocyst transfers without a concomitantreduction in pregnancy rates.In this study, we investigated whether the β HCG may be used as a predictive marker ofdevelopmental competence for human embryos. This study showed that CGβ gene expressionwas diverse and heterogeneous between blastocysts. Further studies need to be accomplishedto investigate this further.ConclusionsBlastocyst biopsy was developed and optimized to serve as powerful tool for diagnostics ofhuman diseases or to identify diagnostic markers of competence to develop to term for humanembryos.


2009 ◽  
Vol 27 (36) ◽  
pp. 6094-6100 ◽  
Author(s):  
Lindsey Goff ◽  
Karin Summers ◽  
Sameena Iqbal ◽  
Jens Kuhlmann ◽  
Michael Kunz ◽  
...  

Purpose The randomized First-Line Indolent Trial (FIT) was conducted in patients with advanced follicular lymphoma (FL), to evaluate the safety and efficacy of yttrium-90 (90Y) ibritumomab tiuxetan given as consolidation of complete or partial remission. This study of minimal residual disease was undertaken in parallel, to determine the rate of conversion from bcl-2 polymerase chain reaction (PCR) –detectable to –undetectable status and the corresponding effect on progression-free survival (PFS). Patients and Methods Blood samples from 414 patients (90Y-ibritumomab, n = 208; control, n = 206) were evaluated using real-time quantitative polymerase chain reaction (RQ-PCR); 186 were found to have the bcl-2 rearrangement and were thus eligible for inclusion in the RQ-PCR analysis. Results Overall, 90% of treated patients converted from bcl-2 PCR–detectable to –undetectable disease status, compared with 36% in the control group. Treatment significantly prolonged median PFS in patients converting to bcl-2 PCR-undetectable status (40.8 v 24.0 months in the control group; P < .01, hazard ratio [HR], 0.399). In patients who had bcl-2 PCR-detectable disease at random assignment, treatment significantly prolonged median PFS (38.4 v 8.2 months in the control group; P < .01, HR, 0.293). Conclusion Eradication of PCR-detectable disease occurred more frequently after treatment with 90Y-ibritumomab tiuxetan and was associated with prolongation of PFS.


2018 ◽  
Author(s):  
Νικόλαος Αρμακόλας

Το πεπτίδιο Ec (PEc) του IGF-1Ec (IGF-1Ec) επάγει την κινητοποίηση των ανθρωπίνων μεσεγχυματικών βλαστικών κυττάρων (hMSC) και ενεργοποιεί την εξωκυτταρική κινάση 1 και 2 (ERK 1/2) διαφόρων κυττάρων. Σκοπός της παρούσας μελέτης ήταν η διερεύνηση της επιδρασης του PEc στην κινητοποίηση και τη διαφοροποίηση των hMSCs, καθώς και η δυνατότητα εφαρμογής του σε συνδυασμό με τον TGF-β1 (TGF-β1) στην επιδιόρθωση του αρθρικού χόνδρου. Τα αποτελέσματα της εξωγενούς χορήγησης του ΡΕc και του ΤGF-β1, ξεχωριστά και σε συνδυασμό, σε hMSCs εκτιμήθηκαν χρησιμοποιώντας trypan blue assay, reverse transcription-quantitative polymerase chain reaction, western blot analysis, Alcian blue staining, wound healing assays και migration/invasion assays. Προσδιορίστηκε ότι το PEc εμπλέκεται στη διαδικασία διαφοροποίησης των hMSCs προς υαλώδη χόνδρο. Η χορήγηση PEc ή / και TGF-β1 σε hMSCs έδειξε συγκρίσιμη εναπόθεση χονδρικής θεμέλειας ουσίας. Ακόμα, η χορήγηση του ΡΕc σε συνδυασμό με τον ΤGF-β1 συσχετίστηκε με μια σημαντική αύξηση στην κινητοποίηση των hMSC σε σύγκριση με την χορήγηση μόνο του TGF-β1 ή του ΡEc (Ρ <0,05). Επομένως, το ΡΕc φαίνεται να διευκολύνει in vitro την κινητοποίηση των hMSC και την διαφοροποίηση τους προς χονδροκύτταρα, ενισχύοντας το ρόλο του ΤGF-β1.


2015 ◽  
Vol 53 (4) ◽  
pp. 345-352
Author(s):  
Y.B. Zheng ◽  
Y. Zhao ◽  
L.Y. Yue ◽  
P. Lin ◽  
Y.F. Liu ◽  
...  

Background: DNA methylation has been implicated in the pathogenesis of allergy and atopy. This study aimed to identify whether DNA methylation also plays an important role in the pathogenesis of nasal polyps (NP). Methodology: NP tissues were obtained from 32 patients with chronic rhinosinusitis with bilateral NP. Biopsies of inferior turbinate mucosa (ITM) were taken from 18 patients who underwent rhinoseptoplasty (control group). The methylated genes, which were detected by DNA methylation microarray, were validated by methylation-specific polymerase chain reaction, bisulphite sequencing, real-time polymerase chain reaction and immunohistochemistry. Results: DNA methylation microarray identified 8,008 CpG islands in 2,848 genes. One hundred and ninety-eight genes were found to have a methylated signal in the promoter region in NP samples compared with ITM samples. The four top genes that changed, COL18A1, EP300, GNAS and SMURF1, were selected for further study. The methylation frequency of COL18A1 was significantly higher in NP samples than in ITM samples. Conclusions: DNA methylation might play an important role in the pathogenesis of NP. Promoter methylation of COL18A1 was found to be significantly increased in NP tissues, further studies are necessary to confirm the significance of these epigenetic factors in the mechanisms underlying the development or persistence of NP.


2021 ◽  
Vol 8 (3) ◽  
pp. 316
Author(s):  
Taufik Muhammad Fakih ◽  
Salsabilla Wijaya ◽  
Sani Ega Priani

Beberapa produk seperti obat, makanan, dan kosmetika khususnya kolagen dapat berpotensi mengandung turunan babi sehingga diperlukan adanya analisis kehalalan. . Polymerase Chain Reaction (PCR) merupakan metode yang dapat digunakan untuk melakukan analisis sampel secara molekuler. Tujuan dari penelitian ini adalah mendesain kandidat primer dari gen 12S rRNA babi secara in silico. . Metode yang digunakan adalah penelusuran data gen 12S rRNA melalui situs National Center for Biotechnology Information (NCBI), kemudian sekuen gen 12S rRNA dianalisis menggunakan server web Integrated DNA Technologies (IDT) dan MFEprimer-3.1 untuk dilakukan pemilihan kandidat primer terbaik. Kandidat primer terpilih kemudian diidentifikasi menggunakan server web SnapGene Viewer untuk mengamati kemampuan penempelan kandidat primer pada sekuen target. Pada tahap terakhir dilakukan evaluasi kandidat primer menggunakan server web OligoAnalyzer™ Tool agar diperoleh pasangan kandidat primer terbaik yang memenuhi kriteria primer yang baik. Kandidat primer yang terbaik adalah primer forward rRNA-5 (5’ GTACTACTCGCAACTGCCTAAA 3’) dan primer reverse rRNA-6 (5’GCAAGGGTTGGTAAGGTCTATC 3’) karena memenuhi persyaratan primer ideal. . Dengan demikian, kandidat primer tersebut dapat digunakan untuk karakterisasi sampel secara in vitro menggunakan teknik PCR.


Sign in / Sign up

Export Citation Format

Share Document