Tandem repeats in plant mitochondrial genomes: application to the analysis of population differentiation in the conifer Norway spruce

AbstractEfficient use of any breeding resources requires a good understanding of the genetic value of the founder breeding materials for predicting the gain and diversity in future generations. This study evaluates the distribution of genetic variation and level of relatedness among and within nine breeding populations of Norway spruce for Northern Sweden using nuclear microsatellite markers. A sample set of 456 individuals selected from 140 stands were genotyped with 15 SSR loci. Over all loci each individual was identified with unique multilocus genotype. High genetic diversity (average He=0.820) and low population differentiation (FST=0.0087) characterized this material. Although low in FST, the two northernmost populations were clustered as a distinct group diverged from the central populations. The population differentiation pattern corresponds well with the post glacial migration history of Norway spruce and the current gene flow and human activity in the region. The average inbreeding coefficient was 0.084 after removal loci with high frequency of null alleles. The estimated relatedness of the trees gathered in the breeding populations was very low (average kinship coefficient 0.0077) and not structured. The high genetic variation and low and not structured relatedness between individuals found in the breeding populations confirm that the Norway spruce breeding stock for northern Sweden represent valuable genetic resources for both long-term breeding and conservation programs.

Download Full-text

Using high-resolution annotation of insect mitochondrial DNA to decipher tandem repeats in the control region

10.1101/500330 ◽

2018 ◽

Author(s):

Ji Haishuo ◽

Xu Xiaofeng ◽

Jin Xiufeng ◽

Cheng Zhi ◽

jin Hong ◽

...

Keyword(s):

Steady State ◽

High Resolution ◽

Mitochondrial Genome ◽

Control Region ◽

Transcription Initiation ◽

Tandem Repeats ◽

Mitochondrial Gene ◽

Mitochondrial Genomes ◽

Small Rna Sequencing ◽

Antisense Gene

In this study, we used a small RNA sequencing (sRNA-seq) based method to annotate the mitochondrial genome of the insect Erthesina fullo Thunberg at 1 bp resolution. Most of the new annotations were consistent with the previous annotations which were obtained using PacBio full-length transcripts. Two important findings are that animals transcribe both entire strands of mitochondrial genomes and the tandem repeat in the control region of the E. fullo mitochondrial genome contains the repeated Transcription Initiation Sites (TISs) of the H-strand. In addition, we found that the copy numbers of tandem repeats showed a great diversity within an individual, enriching the fundamental knowledge of mitochondrial biology. This sRNA-seq based method uses 5′ and 3′ end small RNAs to annotate nuclear non-coding and mitochondrial genes at 1 bp resolution and can also be used to identify new steady-state RNAs, particularly long non-coding RNAs (lncRNAs). Animal mitochondrial genomes containing one control region only encode two steady-state lncRNAs, which are the Mitochondrial D-loop 1 (MDL1) and its antisense gene (MDL1AS), while all other reported mitochondrial lncRNAs could be degraded fragments of transient RNAs or random breaks during experimental processing. The high-resolution annotations of mitochondrial genomes can be used to study the phylogenetics and molecular evolution of animals or to investigate mitochondrial gene transcription, RNA processing, RNA maturation and several other related topics.

Download Full-text

The complete mitochondrial genome of the grooved carpet shell,Ruditapes decussatus(Bivalvia, Veneridae)

PeerJ ◽

10.7717/peerj.3692 ◽

2017 ◽

Vol 5 ◽

pp. e3692 ◽

Cited By ~ 9

Author(s):

Fabrizio Ghiselli ◽

Liliana Milani ◽

Mariangela Iannello ◽

Emanuele Procopio ◽

Peter L. Chang ◽

...

Keyword(s):

Mitochondrial Genome ◽

Genetic Variability ◽

Tandem Repeats ◽

Complete Mitochondrial Genome ◽

Ruditapes Philippinarum ◽

Mitochondrial Genomes ◽

Uniparental Inheritance ◽

Ruditapes Decussatus ◽

Important Species ◽

Two Samples

Despite the large number of animal complete mitochondrial genomes currently available in public databases, knowledge about mitochondrial genomics in invertebrates is uneven. This paper reports, for the first time, the complete mitochondrial genome of the grooved carpet shell,Ruditapes decussatus, also known as the European clam.Ruditapes decussatusis morphologically and ecologically similar to the Manila clamRuditapes philippinarum, which has been recently introduced for aquaculture in the very same habitats ofRuditapes decussatus, and that is replacing the native species. Currently the production of the European clam is almost insignificant, nonetheless it is considered a high value product, and therefore it is an economically important species, especially in Portugal, Spain and Italy. In this work we: (i) assembledRuditapes decussatusmitochondrial genome from RNA-Seq data, and validated it by Sanger sequencing; (ii) analyzed and characterized theRuditapes decussatusmitochondrial genome, comparing its features with those of other venerid bivalves; (iii) assessed mitochondrial sequence polymorphism (SP) and copy number variation (CNV) of tandem repeats across 26 samples. Despite using high-throughput approaches we did not find evidence for the presence of two sex-linked mitochondrial genomes, typical of the doubly uniparental inheritance of mitochondria, a phenomenon known in ∼100 bivalve species. According to our analyses,Ruditapes decussatusis more genetically similar to species of the Genus Paphia than to the congenericRuditapes philippinarum, a finding that bolsters the already-proposed need of a taxonomic revision. We also found a quite low genetic variability across the examined samples, with few SPs and little variability of the sequences flanking the control region (Largest Unassigned Regions (LURs). Strikingly, although we found low nucleotide variability along the entire mitochondrial genome, we observed high levels of length polymorphism in the LUR due to CNV of tandem repeats, and even a LUR length heteroplasmy in two samples. It is not clear if the lack of genetic variability in the mitochondrial genome ofRuditapes decussatusis a cause or an effect of the ongoing replacement ofRuditapes decussatuswith the invasiveRuditapes philippinarum, and more analyses, especially on nuclear sequences, are required to assess this point.

Download Full-text

Precise annotation of tick mitochondrial genomes reveals multiple copy number variation of short tandem repeats and one transposon-like element

10.21203/rs.2.19332/v2 ◽

2020 ◽

Author(s):

Ze Chen ◽

Yibo Xuan ◽

Guangcai Liang ◽

Xiaolong Yang ◽

Zhijun Yu ◽

...

Keyword(s):

Copy Number Variation ◽

Copy Number ◽

Short Tandem Repeats ◽

Tandem Repeats ◽

Pcr Amplification ◽

Mitochondrial Genomes ◽

Mt Dna ◽

Dna Variation ◽

Number Variation ◽

Short Tandem

Abstract Background: In the present study, we used long-PCR amplification coupled with Next-Generation Sequencing (NGS) to obtain complete mitochondrial (mt) genomes of individual ticks and unprecedently performed precise annotation of these mt genomes. We aimed to: (1) to develop a simple, cost-effective and accurate method for the study of extremely high AT-content mt genomes within an individual animal containing miniscule DNA (e.g. Dermacentor silvarum); (2) to provide a high-quality reference genome for D. silvarum with precise annotation and also for future studies of other tick mt genomes; and (3) to detect and analyze mt DNA variation within an individual tick.Results: These annotations were confirmed by the PacBio full-length transcriptome data to cover both entire strands of the mitochondrial genomes without any gaps or overlaps. Moreover, two new and important findings were reported for the first time, contributing fundamental knowledge to mt biology. The first was the discovery of a transposon-like element that may eventually reveal much about mechanisms of gene rearrangements in mt genomes. Another finding was that Copy Number Variation (CNV) of Short Tandem Repeats (STRs) account for mitochondrial sequence diversity (heterogeneity) within an individual tick, insect, mouse or human, whereas SNPs were not detected. The CNV of STRs in the protein-coding genes resulted in frameshift mutations in the proteins, which can cause deleterious effects. Mitochondria containing these deleterious STR mutations accumulate in cells and can produce deleterious proteins. Conclusions: We proposed that the accumulation of CNV of STRs in mitochondria may cause aging or diseases. Future tests of the CNV of STRs hypothesis help to ultimately reveal the genetic basis of mitochondrial DNA variation and its consequences (e.g., aging and diseases) in animals. Our study will lead to the reconsideration of the importance of STRs and a unified study of CNV of STRs with longer and shorter repeat units (particularly polynucleotides) in both nuclear and mt genomes.

Download Full-text

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

Indian Journal of Animal Research ◽

10.18805/ijar.b-1394 ◽

2021 ◽

Author(s):

Handong Wang ◽

Ye Chen ◽

Wei Shi ◽

Yongyao Guo ◽

Jinghong He ◽

...

Keyword(s):

Tandem Repeats ◽

Complete Mitochondrial Genome ◽

Sister Group ◽

Recent Common Ancestor ◽

Phylogenetic Study ◽

Mitochondrial Genomes ◽

Evolutionary Analysis ◽

Habitat Distribution ◽

Remarkable Feature ◽

Most Recent Common Ancestor

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

Download Full-text

Microhomologies Are Associated with Tandem Duplications and Structural Variation in Plant Mitochondrial Genomes

Genome Biology and Evolution ◽

10.1093/gbe/evaa172 ◽

2020 ◽

Vol 12 (11) ◽

pp. 1965-1974

Author(s):

Hanhan Xia ◽

Wei Zhao ◽

Yong Shi ◽

Xiao-Ru Wang ◽

Baosheng Wang

Keyword(s):

Tandem Repeat ◽

Structural Variation ◽

Tandem Repeats ◽

Repeat Unit ◽

Mitochondrial Genomes ◽

Repeat Array ◽

Mitochondrial Genome Evolution ◽

Tandem Duplications ◽

Short Tandem

Abstract Short tandem repeats (STRs) contribute to structural variation in plant mitochondrial genomes, but the mechanisms underlying their formation and expansion are unclear. In this study, we detected high polymorphism in the nad7-1 region of the Pinus tabuliformis mitogenome caused by the rapid accumulation of STRs and rearrangements over a few million years ago. The STRs in nad7-1 have a 7-bp microhomology (TAG7) flanking the repeat array. We then scanned the mitogenomes of 136 seed plants to understand the role of microhomology in the formation of STR and mitogenome evolution. A total of 13,170 STRs were identified, and almost half of them were associated with microhomologies. A substantial amount (1,197) of microhomologies was long enough to mediate structural variation, and the length of microhomology is positively correlated with the length of tandem repeat unit. These results suggest that microhomology may be involved in the formation of tandem repeat via microhomology-mediated pathway, and the formation of longer duplicates required greater length of microhomology. We examined the abundance of these 1,197 microhomologies, and found 75% of them were enriched in the plant mitogenomes. Further analyses of the 400 prevalent microhomologies revealed that 175 of them showed differential enrichment between angiosperms and gymnosperms and 186 differed between angiosperms and conifers, indicating lineage-specific usage and expansion of microhomologies. Our study sheds light on the sources of structural variation in plant mitochondrial genomes and highlights the importance of microhomology in mitochondrial genome evolution.

Download Full-text

Characterization of Two Complete Mitochondrial Genomes of Ledrinae (Hemiptera: Cicadellidae) and Phylogenetic Analysis

Insects ◽

10.3390/insects11090609 ◽

2020 ◽

Vol 11 (9) ◽

pp. 609 ◽

Cited By ~ 1

Author(s):

Weijian Huang ◽

Yalin Zhang

Keyword(s):

Nucleotide Diversity ◽

Tandem Repeats ◽

Sliding Window ◽

Nonsynonymous Substitution ◽

Synonymous Substitution ◽

Mitochondrial Genomes ◽

Protein Coding ◽

Gene Data ◽

Complete Mitochondrial Genomes

Mitochondrial genomes are widely used for investigations into phylogeny, phylogeography, and population genetics. More than 70 mitogenomes have been sequenced for the diverse hemipteran superfamily Membracoidea, but only one partial and two complete mtgenomes mitochondrial genomes have been sequenced for the included subfamily Ledrinae. Here, the complete mitochondrial genomes (mitogenomes) of two additional Ledrinae species are newly sequenced and comparatively analyzed. Results show both mitogenomes are circular, double-stranded molecules, with lengths of 14,927 bp (Tituria sagittata) and 14,918 bp (Petalocephala chlorophana). The gene order of these two newly sequenced Ledrinae is highly conserved and typical of members of Membracoidea. Similar tandem repeats in the control region were discovered in Ledrinae. Among 13 protein-coding genes (PCGs) of reported Ledrinae mitogenomes, analyses of the sliding window, nucleotide diversity, and nonsynonymous substitution (Ka)/synonymous substitution (Ks) indicate atp8 is a comparatively fast-evolving gene, while cox1 is the slowest. Phylogenetic relationships were also reconstructed for the superfamily Membracoidea based on expanded sampling and gene data from GenBank. This study shows that all subfamilies (sensu lato) are recovered as monophyletic. In agreement with previous studies, these results indicate that leafhoppers (Cicadellidae) are paraphyletic with respect to the two recognized families of treehoppers (Aetalionidae and Membracidae). Relationships within Ledrinae were recovered as (Ledra + (Petalocephala + Tituria)).

Download Full-text

Characterization of the Complete Mitochondrial Genomes from Two Nitidulid Pests with Phylogenetic Implications

Insects ◽

10.3390/insects11110779 ◽

2020 ◽

Vol 11 (11) ◽

pp. 779

Author(s):

Xiaoxiao Chen ◽

Qing Song ◽

Min Huang

Keyword(s):

Tandem Repeats ◽

Stop Codon ◽

Phylogenetic Analyses ◽

Sister Group ◽

Start Codon ◽

Mitochondrial Genomes ◽

Sister Group Relationship ◽

Rich Region ◽

Phylogenetic Implications ◽

Complete Mitochondrial Genomes

The complete mitochondrial genomes of Xenostrongylusvariegatus and Epuraea sp. were sequenced and analyzed. The total genome lengths are 17,657 and 16,641 bp, with an A+T content of 77.2% and 76.4%, respectively. Each mitochondrial genome consists of 37 coding genes and a non-coding (AT-rich) region. All protein-coding genes (PCGs) start with the standard start codon, ATN, and end with complete stop codons, TAA and TAG, or an incomplete stop codon, T. All tRNAs can be folded into the typical clover-leaf secondary structure, with the exception of trnS1 in both species with a reduced dihydrouridine (DHU) arm. The AT-rich region has tandem repeats differing in both number and length. Genetic distance and Ka/Ks analyses show that nad6 has a higher variability and more rapid evolutionary rate than other PCGs. Both maximum likelihood and Bayesian inference phylogenetic analyses based on 13 PCGs and 2 ribosome DNAs (rDNAs) agree with the previous phylogenies in supporting the Nitidulidae monophyly and the sister-group relationship of Kateretidae + (Monotomidae + Nitidulidae).

Download Full-text

Molecular phylogeny inferred from the mitochondrial genomes of Plecoptera with Oyamia nigribasis (Plecoptera: Perlidae)

Scientific Reports ◽

10.1038/s41598-020-78082-y ◽

2020 ◽

Vol 10 (1) ◽

Author(s):

Meng-Yuan Zhao ◽

Qing-Bo Huo ◽

Yu-Zhou Du

Keyword(s):

Ribosomal Rna ◽

Tandem Repeats ◽

Phylogenetic Analyses ◽

The Other ◽

Mitochondrial Genomes ◽

Stem Loop ◽

Protein Coding ◽

Protein Coding Genes ◽

Noncoding Control Region ◽

Rna Genes

AbstractIn this study, the mitochondrial genome of the stonefly, Oyamia nigribasis Banks, 1920 (Plecoptera: Perlidae), was sequenced and compared with the mtDNA genomes of 38 other stoneflies and two Ephemerae. The O. nigribasis mitogenome is a circular 15,923 bp molecule that encodes a large, noncoding control region (CR) and 37 typical mtDNA genes; these include 13 protein-coding genes (PCGs), 22 transfer RNA genes (tRNAs), and two ribosomal RNA genes (rRNAs), respectively. Most of the PCGs initiated with ATN and terminated with TAN. The dihydrouridine (DHU) arm of tRNASer (AGN) was missing, whereas the other 21 tRNAs all exhibited the typical cloverleaf secondary structure. Stem-loop (SL) structures and tandem repeats were identified in the CR. Phylogenetic analyses using Bayesian inference and maximum likelihood were undertaken to determine relationships between stoneflies. Results indicated that the Antarctoperlaria, which contains Gripopterygidae, was absolutely separated from Arctoperlaria; this finding agrees with morphology. Finally, the overall relationships could be summarized as follows ((((Notonemouridae + Nemouridae) + Leuctridae) + (Scopuridae + (Capniidae + Taeniopterygidae))) + (((Perlodidae + Chloroperlidae) + Perlidae) + (Pteronarcyidae + (Peltoperlidae + Styloperlidae))) + ((Diamphipnoidae + Eustheniidae) + Gripopterygidae)).

Download Full-text