Treatment patterns, economic burden, and overall survival in US Medicare Advantage beneficiaries newly diagnosed with acute myeloid leukemia (AML) in 2015–2020

2021 ◽  
pp. 1-11
Author(s):  
Scott F. Huntington ◽  
Michael P. Ingham ◽  
Linda Okonkwo ◽  
Ajaybir Singh ◽  
Ruibin Wang ◽  
...  
Keyword(s):  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Economic Burden ◽  
Myeloid Leukemia ◽  
Treatment Patterns ◽  
Newly Diagnosed ◽  
Medicare Advantage ◽  
Acute Myeloid

Phase 3 VERONA study of venetoclax with azacitidine to assess change in complete remission and overall survival in treatment-naïve higher-risk myelodysplastic syndromes.

2021 ◽  
Vol 39 (15_suppl) ◽  
pp. TPS7054-TPS7054
Author(s):  
Amer Methqal Zeidan ◽  
Jacqueline Suen Garcia ◽  
Pierre Fenaux ◽  
Uwe Platzbecker ◽  
Yasushi Miyazaki ◽  
...  
Keyword(s):  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Hypomethylating Agents ◽  
Newly Diagnosed ◽  
Phase 3 ◽  
Transfusion Independence ◽  
Treatment Naïve ◽  
The U.S ◽  
Acute Myeloid

TPS7054 Background: Patients with higher-risk myelodysplastic syndromes (HR-MDS) experience peripheral cytopenias, disease progression to acute myeloid leukemia, and high mortality with expected median overall survival of less than 2 years. Allogeneic hematopoietic cell transplantation (allo-HCT) is the only potentially curative treatment. Patients ineligible for transplantation are treated with hypomethylating agents such as azacitidine (Aza), which is not curative and provides limited improvement in clinical benefit. Venetoclax (Ven) is a selective, potent, oral B-cell lymphoma-2 (BCL-2) inhibitor that is approved in the U.S. in combination with hypomethylating agents for treating older or co-morbid patients with newly diagnosed acute myeloid leukemia ineligible for intensive chemotherapy. Ven is approved in the U.S. as first-line treatment for chronic lymphocytic leukemia or small lymphocytic lymphoma. For patients with treatment-naïve HR-MDS, Ven + Aza demonstrated manageable safety and a combined complete remission (CR)/marrow CR (mCR) rate of 79% in a single arm phase 1b study (NCT02942290). To confirm these benefits, the VERONA study, a randomized, double-blind, phase 3 study (NCT04401748) of patients with treatment-naïve HR-MDS, will assess the safety and efficacy of Ven combined with Aza including CR rate and overall survival. Methods: Patients (≥18 years) with newly diagnosed HR-MDS per WHO 2016 classification with = 20% bone marrow blasts per marrow biopsy/aspirate at screening will be enrolled at ̃200 sites globally (̃500 patients). Patients must have intermediate risk or higher IPSS-R (score > 3), ECOG ≤2, and be hematopoietic stem cell transplant (HSCT) eligible without any pre-arranged donor, or HSCT ineligible without a plan for HSCT at Study Day 1. De novo patients without prior hypomethylating agents, chemotherapy for MDS, or allogenic stem cell transplantation are eligible. Patients will be randomized 1:1 to receive placebo or Ven 400 mg oral tablet once daily on Days 1-14, both in combination with Aza 75 mg/m2 (intravenous or subcutaneous) on Days 7-0-0 or Days 5-2-2 per 28-days. Patients will receive study treatment until disease progression, unacceptable toxicity, HCT, withdrawal of consent, or discontinuation. The primary endpoints are CR rate (as adjudicated by investigator) per IWG 2006 criteria and overall survival. Secondary outcomes are red blood cell transfusion independence, platelet transfusion independence, change in fatigue as measured by Patient-Reported Outcomes Measurement Information System (PROMIS)-fatigue SF 7a scale score, time to deterioration in physical functioning domain of EORTC QLC-C30 scale, overall response (CR + partial response), and modified overall response (CR + mCR + partial response). Exploratory objectives are predictive biomarkers and pharmacokinetics. Clinical trial information: NCT04401748.

scholarly journals CPX-351 (cytarabine and daunorubicin) Liposome for Injection Versus Conventional Cytarabine Plus Daunorubicin in Older Patients With Newly Diagnosed Secondary Acute Myeloid Leukemia

2018 ◽  
Vol 36 (26) ◽  
pp. 2684-2692 ◽  
Author(s):  
Jeffrey E. Lancet ◽  
Geoffrey L. Uy ◽  
Jorge E. Cortes ◽  
Laura F. Newell ◽  
Tara L. Lin ◽  
...  
Keyword(s):  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Older Patients ◽  
Myeloid Leukemia ◽  
Bone Marrow Cells ◽  
Remission Rate ◽  
Phase Iii ◽  
Newly Diagnosed ◽  
Secondary Acute Myeloid Leukemia ◽  
Acute Myeloid

Purpose CPX-351 is a dual-drug liposomal encapsulation of cytarabine and daunorubicin that delivers a synergistic 5:1 drug ratio into leukemia cells to a greater extent than normal bone marrow cells. Prior clinical studies demonstrated a sustained drug ratio and exposure in vivo and prolonged survival versus standard-of-care cytarabine plus daunorubicin chemotherapy (7+3 regimen) in older patients with newly diagnosed secondary acute myeloid leukemia (sAML). Patients and Methods In this open-label, randomized, phase III trial, 309 patients age 60 to 75 years with newly diagnosed high-risk/sAML received one to two induction cycles of CPX-351 or 7+3 followed by consolidation therapy with a similar regimen. The primary end point was overall survival. Results CPX-351 significantly improved median overall survival versus 7+3 (9.56 v 5.95 months; hazard ratio, 0.69; 95% CI, 0.52 to 0.90; one-sided P = .003). Overall remission rate was also significantly higher with CPX-351 versus 7+3 (47.7% v 33.3%; two-sided P = .016). Improved outcomes were observed across age-groups and AML subtypes. The incidences of nonhematologic adverse events were comparable between arms, despite a longer treatment phase and prolonged time to neutrophil and platelet count recovery with CPX-351. Early mortality rates with CPX-351 and 7+3 were 5.9% and 10.6% (two-sided P = .149) through day 30 and 13.7% and 21.2% (two-sided P = .097) through day 60. Conclusion CPX-351 treatment is associated with significantly longer survival compared with conventional 7+3 in older adults with newly diagnosed sAML. The safety profile of CPX-351 was similar to that of conventional 7+3 therapy.

Hematopoietic Stem Cell Transplantation (HSCT) Benefits the Survival of Acute Myeloid Leukemia (AML) Patients with IDH1, NRAS and DNMT3A Mutations

Blood ◽  
2012 ◽  
Vol 120 (21) ◽  
pp. 1981-1981
Author(s):  
Yang Xu ◽  
Zhen Yang ◽  
Hong Tian ◽  
Huiying Qiu ◽  
Aining Sun ◽  
...  
Keyword(s):  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Stem Cell ◽  
Hematopoietic Stem Cell Transplantation ◽  
Stem Cell Transplantation ◽  
Myeloid Leukemia ◽  
Gene Mutations ◽  
Newly Diagnosed ◽  
Hematopoietic Stem ◽  
Acute Myeloid

Abstract Abstract 1981 Background: Gene mutations may serve as potential markers to extend the prognostic parameters in acute myeloid leukemia (AML) patients. In this study, we detected distribution of mutations in the nucleophosmin gene (NPM1), C-KIT, the fms-related tyrosine kinase 3 gene (FLT3), Isocitrate dehydrogenase gene 1 and 2 (IDH1, IDH2), the neuroblastoma RAS viral oncogene homolog (NRAS) and DNA methyltransferase 3A gene (DNMT3A) in 442 newly diagnosed AML patients (none-APL). Associations of gene mutations with clinical outcomes in these patients followed HSCT treatment or chemotherapy were further evaluated. Methods: Between February 2005 and December 2011, 442 newly diagnosed AML (none-APL) patients in our centre were retrospectively analyzed. There are 248 males and 194 females, and the median ages were 40 (16–60) years. 393 patients (88.9%) of patients were with single or normal karyotype and 49 patients (11.1%) were with complex abnormal karyotype. In addition to MICM examination, direct sequencing was employed to access the distribution of mutations in of FLT3-ITD (exon14), FLT3-TKD (exon 20), NPM1 (exon12), C-KIT (exon8, 17), IDH2 (exon 4), NRAS (exon1, 2), DNMT3A (exon23) of 445 AML patients. Complete remission (CR) was achieved in 258 patients (58.4%) followed the standard induction therapy, 128 patients received HSCT (Allo-HSCT: 121 vs. Auto-HSCT: 7) therapy after first remission or second remission while 258 patients received consolidation chemotherapy contained 4–6 cycles high dose Ara-C (HD-Ara-C). Overall survival (OS) and Event-free survival (EFS) were measured at last follow-up (censored), and Kaplan-Meier analysis was used to calculate the distribution of OS and EFS. Results: In 442 AML (None-APL) patients, 44 patients (9.7%) had C-KIT mutations, 97 patients (21.9%) had NPM1 mutations, 95 patients (21.5%) had FLT3-ITD mutations, 26 patients (5.9%) had FLT3-TKD mutations, 23 patients (5.2%) had IDH1 mutations, 48 patients (10.9%) had IDH2 mutations, 31 patients (7.0%) had DNMT3A mutations, and 40 patients (9.0%) had NRAS mutations. Using COX regression, we found that mutations in FLT3-ITD (HR:2.113; 95%CI: 1.1420 to 3.144),IDH1 (HR:3.023; 95%CI: 1.055 to 3.879), NRAS (HR:1.881; 95%CI: 1.021 to 2.945), and DNMT3A (HR: 2.394; 95%CI: 1.328 to 4.315) were independent unfavorable prognostic indicators of overall survival of AML patients. We further compared the outcomes of AML patients with such gene mutations followed different therapy (HSCT vs. HD Ara-C), and results shown that patients with mutations in IDH1, NRAS and DNMT3A received HSCT therapy had better survival. The median OS and EFS of patients with FLT3-ITD, IDH1, NRAS and DNMT3A in the two groups (HSCT vs. HD Ara-C) were as follows: IDH1 (OS: 35 months vs. 11 months, p=0.016; EFS: 34 months vs. 8 months, p=0.012), NRAS (OS: 27months vs. 8 months, p=0.008; EFS: 23 months vs. 4 months, p=0.049), DNMT3A (OS: 66 months vs. 19 months, p=0.008; EFS: 54 months vs. 13 months, p=0.002). Conclusions: Taken together, our data proved that mutant FLT3-ITD, IDH1, NRAS, and DNMT3A might serve as poor prognostic markers and hematopoietic stem cell transplantation as first-line treatment could favor the outcome of AML patients carrying IDH1, NRAS, and DNMT3A mutations. Disclosures: No relevant conflicts of interest to declare.

Daunorubicine, Cytarabine and Cladribine (DAC) Vs Daunorubicine and Cytarabine (DA) Induction Treatment in Elderly Acute Myeloid Leukemia (AML) Patients – Results of the Prospective, Multicenter, Randomized Trial of the Polish Adult Leukemia Group (PALG)

Blood ◽  
2012 ◽  
Vol 120 (21) ◽  
pp. 3602-3602
Author(s):  
Agnieszka Pluta ◽  
Tadeusz Robak ◽  
Agata Wrzesien-Kus ◽  
Bozena Katarzyna Budziszewska ◽  
Kazimierz Sulek ◽  
...  
Keyword(s):  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Treatment Option ◽  
Induction Therapy ◽  
Myeloid Leukemia ◽  
Performance Status ◽  
Hematological Toxicity ◽  
Proportional Hazard ◽  
Newly Diagnosed ◽  
Acute Myeloid

Abstract Abstract 3602 Background: AML in elderly patients is associated with very poor prognosis. The best treatment option for this group of patients is not established, yet. The intensity of treatment depends on performance status and comorbidities. The previous PALG AML study showed that addition of cladribine (2CdA) to conventional induction therapy; especially in patients above 40 yrs, is associated with better outcome (Ho3owiecki 2004). Based on this observation we designed a study addressed to newly diagnosed AML patients above 60 yrs old, who were fit enough to intensive treatment. Aim: To verify whether addition of 2CdA has an impact to clinical outcome in newly diagnosed AML patients older than 60 years old. Methods: From October 2004 to November 2011, 178 patients from 16 hematological PALG centers were randomly assigned to DA induction therapy consisting of daunorubicine (DNR) 45mg/m2, intravenously (iv), day 1–3 and cytarabine (AraC) 100 mg/m2, iv, day 1–7 (DA) or DA with addition of 2CdA 5mg/m2, iv, day 1–5 (DAC). Patients, who achieved complete remission (CR), received one course of consolidation with mitoxantron 6mg/m2 iv day1–2 and AraC 100mg/m2 iv day 1–5, followed by six cycles of maintenance consisting of (DNR 30mg/m2 iv day 1–2 with AraC 100mg/m2 sc day 1–5 and tioguanine 100mg/m2, p.o., twice day, day 1–5 with AraC 100mg/m2 s.c. day 1–5, alternately). Response criteria were determined according to revised recommendations of the International Working Group for Diagnosis, Standardization of Response Criteria, Treatment Outcomes, and Reporting Standards for Therapeutic Trials in Acute Myeloid Leukemia (Chesson 2003). Statistical analysis: Pairwise comparisons between patient characteristics were performed by the Mann-Whitney U-test for continuous variables and by χ2-statistics or Fisher's exact test for categorical variable. The Kaplan-Meier estimates of survival were calculated and compared using the log-rank test. For multivariate analysis, the Cox proportional hazard regression model was applied. P values < 0.05 were considered significant. Results: 88 pts with median age 66 yrs (range 60–79 yrs) were randomized to DA and 90 pts with median age 64 yrs (range 60–79 yrs) was enrolled to DAC schema. The both groups were comparable in terms of age, sex, performance status, white blood cell count, hemoglobin level, platelets count, tumor burden parameters, cytogenetic, between the both groups. The overall CR rate was 38%. In DA and DAC groups CR was achieved in 33% and 43% pts, respectively (p=0.12). However, in patients under 65 yrs the trend towards higher CR rate in DAC arm than DA group was observed (47% vs. 29%, p=0.09). In pts above 65 yrs the CR rate was comparable (39% vs. 38%, p=0.8). The efficacy and hematological toxicity in DA and DAC groups was similar (Table 1). Also no statistical significant differences in non-hematological toxicity were observed (data not shown). Early deaths in DA and DAC did not differ significantly. Median overall survival (OS) in DA and DAC arm was also similar in both groups (Table 1). In proportional hazard Cox analysis only age under 65yo, CR achievement and WBC above 100G/L were important for better OS (p=0.02, p<0.001 and p=0.09). The presence of dysplastic changes, karyotype, LDH, number of bone marrow blasts did not influenced OS. Conclusions: Our data suggest that prolonged overall survival can be achieved in elderly AML patients mainly till 65yrs. Intensive therapy, especially in patients older than 65yrs, may be associated with high number of complications what results withdrawing from intensive treatment protocol. Hematological and non-hematological toxicity of DA and DAC schema is comparable, however higher CR rate in DAC group in patient till 65yrs may suggest, that addition of 2CdA to DA does not increase toxicity and may be a treatment option in this patient population. Disclosures: Wiktor-Jedrzejczak: Janssen-Cilag: Consultancy; Amgen: Consultancy; Novartis: Consultancy, Speakers Bureau; Pfizer: Consultancy; Bayer: Consultancy; Genopharm: Speakers Bureau; Celgene: Speakers Bureau; Genzyme: Speakers Bureau; Bristol-Myers Squibb: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau.

Body mass index (BMI) influence on survival in adult patients with newly diagnosed acute myeloid leukemia (AML)/high-risk MDS: Retrospective study of 130 patients from a single institution.

2013 ◽  
Vol 31 (15_suppl) ◽  
pp. e18011-e18011
Author(s):  
Mohamed Abdelfatah ◽  
Ali Al-Ameri ◽  
Zeyad Kanaan ◽  
Ahmed Malkawi ◽  
Nairmeen Awad Haller
Keyword(s):  
Body Mass Index ◽  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Median Survival ◽  
Survival Benefit ◽  
Myeloid Leukemia ◽  
Normal Weight ◽  
Adult Patients ◽  
Newly Diagnosed ◽  
Acute Myeloid

e18011 Background: The incidence of obesity is increasing worldwide and is associated with numerous adverse health outcomes. In AML high body mass index (BMI) is associated with increased risk of treatment-related complications; the overall survival in patients with acute myeloid leukemia is inferior, with most studies conducted in the pediatric population. Aim: To evaluate the effect of increasing (BMI) in the overall survival (OS) of adult patients with AML/High risk MDS. Methods: After obtaining IRB approval, all adult patients with AML diagnosed and treated at our institution (2002–2010) were studied. Data collection included patient demographics, laboratory tests, bone marrow biopsies, BMI, and survival information. We classified the AML patients into two groups according to BMI (kg/m2) classification by WHO; normal Weight 18-25 kg/m2, overweight and obese >25 kg/m2. Chi-Square and T-test were used for between group comparisons and Kaplan-Meier test was applied for survival estimates. Results: Adult patients with newly diagnosed AML (n = 130) had a median age of 55 years (range: 19-90), and 43 (56%) patients were older than 75 years. Seventy-two patients (55%) were male and 58 (45%) were female. 45 patients (35%) in total had complex cytogenetics, 20 patients (15%) had AML arise from MDS.Forty-four patients (34%) were considered normal weight; Eighty-six patients (66%) were classified as overweight or obese. Overall median survival was 28 weeks; patients with BMI 18-25 kg/m2 had a 36-week median survival, while patients with BMI <25 kg/m2 had a 25-week median survival (p<0.499). Conclusions: Overall survival was low in the study population; survival in obese and overweight patients (BMI>25) was slightly lower than normal weight group (18-25 kg/m2), although this did not translate into a survival benefit. Future large scale studies may be needed to further define the role of BMI in survival benefit for these patients.

Response Rate, Event-Free Survival, and Overall Survival in Newly Diagnosed Acute Myeloid Leukemia: US Food and Drug Administration Trial-Level and Patient-Level Analyses

2021 ◽  
Author(s):  
Kelly J. Norsworthy ◽  
Xin Gao ◽  
Chia-Wen Ko ◽  
E. Dianne Pulte ◽  
Jiaxi Zhou ◽  
...  
Keyword(s):  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Strong Association ◽  
Intensive Chemotherapy ◽  
Newly Diagnosed ◽  
Event Free Survival ◽  
Free Survival ◽  
Patient Level ◽  
Acute Myeloid

PURPOSE To explore trial-level and patient-level associations between response (complete remission [CR] and CR + CR with incomplete hematologic [CRi] or platelet [CRp] recovery), event-free survival (EFS), and overall survival (OS) in newly diagnosed acute myeloid leukemia (AML) trials of intensive chemotherapy. METHODS We identified data from eight randomized, active-controlled trials of intensive chemotherapy submitted to the US Food and Drug Administration for treatment of newly diagnosed AML (N = 4,482). Associations between trial-level odds ratios (ORs) for CR and CR + CRi or CRp, and hazard ratios (HRs) for EFS and OS were analyzed using weighted linear regression models. We performed patient-level responder analyses to compare OS by response using pooled data from all studies. RESULTS In trial-level analyses, association between HR for OS and OR for CR was moderate (R2 = 0.49; 95% CI, 0.05 to 0.86), as was the association with OR for CR + CRi or CRp (R2 = 0.48; 95% CI, 0.05 to 0.99). For OS versus EFS, a strong association was observed (R2 = 0.87; 95% CI, 0.47 to 0.98) when EFS definitions were harmonized across trials using raw data. In the patient-level responder analyses, patients who achieved CR had better OS compared with CRi or CRp responders (0.73; 95% CI, 0.64 to 0.84) and nonresponders (HR, 0.33; 95% CI, 0.31 to 0.37). CONCLUSION On a trial level, there is a moderate association between OS and CR rate. A strong association between EFS and OS was observed. However, CIs were wide, and results became moderate using alternative definitions for EFS. Patient-level analyses showed CR responders have better OS compared with CRi or CRp responders and nonresponders. A therapy in newly diagnosed AML with benefit in EFS or substantial benefit in CR rate would be likely to have an OS effect.

Prognostic Index for Older Adult Patients with Newly Diagnosed Acute Myeloid Leukemia: The Edouard Herriot Hospital Experience.

Blood ◽  
2007 ◽  
Vol 110 (11) ◽  
pp. 4352-4352
Author(s):  
Claudiu Plesa ◽  
Quoc-Hung Le ◽  
Youcef Chelghoum ◽  
Mohamed Elhamri ◽  
Isabelle Tigaud ◽  
...  
Keyword(s):  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Risk Group ◽  
Prognostic Score ◽  
Prognostic Index ◽  
Disease Free Survival ◽  
Newly Diagnosed ◽  
Co Morbidity ◽  
Acute Myeloid

Abstract The treatment of older adults with acute myeloid leukemia (AML) is associated with unsatisfactory rates of complete responses and long-term overall survival. Therefore, a clinically usefull prognostic index can facilitate therapeutic decision making and evaluation of investigational treatment strategies in this patient population. Overall, 243 of the 432 patients (56%, 95% CI: 51–60%) achieved CR (229 of them after the first induction course and 14 after salvage therapy). The median disease-free survival (DFS) and the median overall survival (OS) of the entire cohort were 8.4 months (95% CI: 7.2–10.1 months) and 8.3 months (95% CI: 7.2–10 months) respectively. A prognostic score is presented based on the multivariate analysis of 432 newly diagnosed non-M3 AML patients aged more than 60 years, selected on the base of their initial performance status and the absence of severe co-morbidity factors, for entering onto five successive clinical trials combining an anthracycline and cytarabine. Four clinically relevant parameters are included in this index: cytogenetics at diagnosis, history of previous hematologic disorder, hematologic features at diagnosis, and LDH level at diagnosis. Using this stratification system, three risk groups were defined: a favorable-risk group A (OS of 39% at 2 years and 21% at 5 years), an intermediate-risk group B (OS of 19% at 2 years and 8% at 5 years), and a poor-risk group (OS of 5% at 2 years and 0% at 5 years). The prognostic index estimates the outcome of elderly AML patients usually selected for intensive chemotherapy trials using four easily determined parameters and might identify patients who are really candidates for this treatment strategy from those for whom investigational therapy or palliation may be most appropriate.

scholarly journals Using Circ-ANAPC7 As a Novel Type of Biomarker in the Monitoring of Acute Myeloid Leukemia

Blood ◽  
2019 ◽  
Vol 134 (Supplement_1) ◽  
pp. 5179-5179
Author(s):  
Ying Shen ◽  
Yachun Jia ◽  
Ru Zhang ◽  
Hongli Chen ◽  
Yuandong Feng ◽  
...  
Keyword(s):  
Bone Marrow ◽  
Overall Survival ◽  
Acute Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Expression Level ◽  
Circular Rnas ◽  
Newly Diagnosed ◽  
Free Survival ◽  
Non Coding Rnas ◽  
Acute Myeloid

Introduction: Acute myeloid leukemia (AML) is a heterogeneous disease characterized by the clonal proliferation of immature myeloid progenitor cells in the bone marrow, compressing normal blood cell production and leading to bone marrow failure ultimately. Overwhelming evidence has established that non-coding RNAs (ncRNAs), such as long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs) have great role in AML pathogenesis. Circular RNAs (circRNAs) that occupy gene expression at the transcriptional or post-transcriptional level have great potential to be biomarker for types of cancers. We have screened one altered circRNA named circ-ANAPC7 in AML before. In this study, we aimed to validate its expression by enlarging sample size and illuminating the diagnostic and monitoring value of circ-ANAPC7 in AML. Methods: Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was supposed to confirm the expression of circ-ANAPC7 of AML patients. The sequences of circ-ANAPC7 primers were as follows: 5′- GGGAGCAGCACTTAGGAACAT -3′ (sense) and 5′-AAAGCTGGTACTTCTGAGGTGG-3′ (antisense). Receiver operating characteristic (ROC) curve was carried out to evaluate the diagnostic value. Overall survival rate and event-free survival rate were estimated by the Kplan-Meier analysis and compared using the log-rank test. All tests were two-sided, and P < 0.05 was defined as a significant difference. Results: The expression level of circ-ANAPC7 in newly diagnosed AML was significantly higher than CR patients and iron deficiency anemia (IDA) control group (P < 0.001) (Figure 1A). Furthermore, we chose 24 AML patients who undergo the condition of newly diagnosed AML, CR and relapse to dynamical monitor the expression of circ-ANAPC7. We discovered that circ-ANAPC7 expression level changed accompanied with the disease condition transformation. It was high expressed in newly diagnosed and relapsed AML patients. When patients got CR, the expression level of circ-ANAPC7 decreased (P < 0.05). In the continuous CR patients, it remained in a minimal level (Figure 1C). ROC curve analysis revealed that circ-ANAPC7 has significant value of AML diagnosis (AUC = 0.915, P < 0.001) (Figure 1B). Moreover, we conducted survival analysis to explore long-term effect of circ-ANAPC7 expression in AML patients. The result revealed that circ-ANAPC7 expression was not related to overall survival (OS) and disease-free survival (DFS) of AML patients (P > 0.05) (Figure 1D). Conclusions: We validated that circ-ANAPC7 was upregulated in AML patients. The clinical analysis revealed that circ-ANAPC7 may be a predictive index for diagnosing and supervising early recurrence of AML. What's more, additional molecular mechanisms and biological functions of circ-ANAPC7 merit deeper investigation. Figure 1 Disclosures No relevant conflicts of interest to declare.

Sign in / Sign up

Export Citation Format

Share Document