scholarly journals First Report of a Leaf Blight Caused by Pyricularia pennisetigena on Cenchrus echinatus in Paraguay

Plant Disease ◽  
2021 ◽  
Author(s):  
Cinthia C. Cazal-Martínez ◽  
Yessica Magaliz Reyes Caballero ◽  
Alice Chávez ◽  
Pastor Enmanuel Pérez Estigarribia ◽  
Alcides Rojas ◽  
...  
Keyword(s):  
Rna Polymerase Ii ◽  
Large Subunit ◽  
Fungal Species ◽  
Leaf Blight ◽  
Internal Transcribed Spacers ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Potential Threat ◽  
First Report ◽  
Microscopic Features

The genus Pyricularia contains several fungal species known to cause diseases on plants in the Poaceae family (Klaubauf et al. 2014; Wang et al. 2019). While sampling for P. oryzae during March-2015 and April-2018, common weed Cenchrus echinatus L. was observed with leaf lesions in and around experimental wheat fields in the departments of Canindeyú and Itapúa. C. echinatus samples from both locations displayed similar leaf lesions, varying from small light brown pinpoint to elliptical brown lesions with greyish center. Symptomatic leaves were surface disinfested and cultured on potato dextrose agar (PDA) amended with 1% gentamicin at 25°C. Two monosporic isolates were obtained, one from Itapúa (ITCeh117) and the other from Canindeyú (YCeh55). The isolates were subsequently grown on oatmeal agar (OA) and PDA under a 12-h photoperiod at 25°C and evaluated after ten days for colony diameter, sporulation, macroscopic and microscopic features. Colonies on OA reached up to 4.8 cm diameter and were light grey, whereas colonies on PDA reached up to 5.3 cm diameter and were brown with grey centers, with cottony mycelium and broad white rims. Mycelium consisted of smooth, hyaline, branched, septate hyphae 4-4.5 µm diameter. Conidiophores were erect, straight or curved, unbranched, medium brown and smooth. Conidia were solitary, pyriform, pale brown, smooth, granular, 2-septate, 32-33 × 9-10 μm; truncated with protruding hilum and varied in length from 1.0 to 1.5 μm and diameters from 2.0 to 2.2 μm. Both isolates were similar and identified as Pyricularia pennisetigena, according to morphological and morphometric characteristics (Klaubauf et al. 2014). Subsequently, genomic DNA was extracted from each isolate using the primers described in Klaubauf et al. (2014) to amplify and sequence the internal transcribed spacers (ITS), partial large subunit (LSU), partial RNA polymerase II large subunit gene (RPB1), partial actin gene (ACT), and partial calmodulin gene (CAL). Sequences from each isolate (YCeh55/ITCeh117) were deposited in GenBank with the following submission ID for ITS: MN947521/MN947526, RPB1: MN984710/MN984715, LSU: MN944829/MN944834, ACT: MN917177/MN917182, and CAL: MN984688/MN984693. Phylogenetic analysis was conducted using the software Beast v1.10.4. The results obtained from the concatenated matrix of the five loci placed these isolates in the P. pennisetigena clade. To confirm pathogenicity, each isolate was adjusted to 5×104 conidia/ml of sterile water and C. echinatus plants were sprayed with the conidial suspension for isolate YCeh55, ITCeh117 or sterile water using an oilless airbrush sprayer until runoff. The three treatments were kept in the greenhouse at 25-28°C and about 75% relative humidity under natural daylight. Each treatment included three to five inoculated plants and 10 leaves were evaluated per treatment. Symptoms were observed 8-15 days after inoculation and were similar to those originally observed in the field for both isolates, whereas the control plants remained asymptomatic. P. pennisetigena was re-isolated from the inoculated leaves fulfilling Koch’s postulates. To our knowledge, this is the first report of leaf blight on C. echinatus caused by P. pennisetigena in Paraguay. The occurrence of P. pennisetigena in the region and its ability to infect economically important crops such as wheat and barley (Klaubauf et al. 2014; Reges et al., 2016, 2018) pose a potential threat to agriculture in Paraguay.

scholarly journals First report of leaf blight on Magnolia coco caused by Nothophoma quercina in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Qian Zeng ◽  
Yicong Lv ◽  
Xinyue Li ◽  
Xiulan Xu ◽  
Chunlin Yang ◽  
...  
Keyword(s):  
Large Subunit ◽  
Leaf Blight ◽  
Internal Transcribed Spacers ◽  
Control Measures ◽  
Morphological Observation ◽  
Effective Control ◽  
Conidial Suspension ◽  
First Report ◽  
Chaenomeles Sinensis ◽  
Initial Symptoms

Magnolia coco (Lour.) DC. is an ornamental shrub and widely cultivated in southern China (Nana et al. 2017). In April 2020, leaf blight symptoms were observed on the leaves of M. coco in the Chengdu campus of Sichuan Agricultural University (30°42′19.92″N, 103°51′30.61″E, 493 m) where didn’t have great protection, with roughly 70% leaves per plant were diseased. The initial symptoms presented on the leaf apex, which was manifested as dark brown spots surrounded with obvious yellowish halo (Fig. 1). As the disease progressed, spots gradually enlarged and coalesced covering the leaf, and severe infection finally caused leaf necrosis and plant decline. Four specimens from different diseased plants were used for pathogen isolation and morphological observation. Four fungal isolates were obtained from four specimens, following Chomnunti et al. (2014). Colonies on potato dextrose agar (PDA) medium were initially white and then light brown to dark brown. Pycnidia measured 284-427 × 326-554 μm (x=372.8 μm × 476.1 μm, n=20), and were brownish-black to black, broadly globose to irregular. The pycnidial wall measured 16-27 μm wide (n=20) and was composed of hyaline to brown cells of textura angularis. Conidiophores were absent, and the conidiogenous cells are pear-shaped, colorless, and smooth. Conidia measured 5-8 × 4-6 μm (x=6.5 μm × 4.6 μm, n=50), and were elliptical or subglobose, thick-walled, aseptate, hyaline, smooth, brown. These asexual structures were similar to Nothophoma quercina (Syd. & P. Syd.) Qian Chen & L. Cai described by Chen et al. (2017). The genomic DNA of representative isolate SICAUCC 21-0011 was extracted, and the internal transcribed spacers (ITS), 28S large subunit rDNA (LSU), RNA polymerase II large subunit 2 (RPB2), and beta-tubulin (TUB2) regions were amplified using the primer pairs ITS5/ITS4, LR0R/LR5, FRPB2-5F/FRPB2-7cR, and T1/BT4R, respectively. The accession numbers deposited in GenBank were MW541930 (ITS), MW541934 (LSU), MW883395 (RPB2), and MW883394 (TUB2). Nucleotide BLAST showed high homology with the sequences of N. quercina, viz. GU237900 (ITS, 485/486, 99.79%), EU754127 (LSU, 862/862, 100%), KT389657 (RPB2, 593/596, 99.49%), and GU237609 (TUB2, 333/335, 99.40%). Phylogenetic analyses based on a combined dataset showed 100% bootstrap support values in a clade with N. quercina complexes (Fig. 2). Four healthy potted plants (2-years-old) with 15 to 20 leaves per plant were sprayed with conidial suspension (105 conidia/mL) prepared from 4-week-old cultures of SICAUCC 21-0011, which incubated on PDA at 25℃, onto the wounded sites via pin-prick inoculation described by Desai et al. (2019). Another four plants were sprayed with sterilely distilled water as controls. Inoculated plants were cultured in a growth chamber (25℃, 95% relative humidity, and 12-h photoperiod). About 30 days later, brown spots were found on the inoculated leaves, which were similar to those observed in the field. There were no symptoms on the control plants, and the pathogen was re-isolated from the diseased leaves and characterized morphologically. N. quercina has been reported on Photinia × fraseri Dress, Aucuba japonica, Malus micromalus, and Chaenomeles sinensis (Mohamed et al. 2019, Lv et al. 2020, Zou et al. 2021). To our knowledge, this is the first report of leaf blight on M. coco caused by N. quercina. M. coco is one of the important ornaments in the courtyard, street, and park in China, and the risk of this pathogen needs further exploration and effective control measures should be made. Qian Zeng, Yicong Lv, and Xinyue Li contributed equally to this work.

scholarly journals First Report of Fusarium proliferatum Causing Garlic clove Rot in Russian Federation

Plant Disease ◽  
2021 ◽  
Author(s):  
Olga K Anisimova ◽  
Timofey M Seredin ◽  
Olga A Danilova ◽  
Mikhail Filyushin
Keyword(s):  
Rna Polymerase Ii ◽  
Fruits And Vegetables ◽  
Fusarium Species ◽  
Taxonomic Status ◽  
Basic Research ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Single Spore ◽  
First Report ◽  
Post Harvest

Garlic (Allium sativum L.) is a widely consumed bulbous crop both worldwide and in Russia. About 200,000 tons of garlic is produced in Russia annually (https://rosstat.gov.ru/). Significant pre- and post-harvest losses of garlic regularly occur due to Fusarium sp. (Taylor et al., 2013). Since September 2018, rotting has been observed in Russia during garlic bulb storage (data of the Federal Scientific Vegetable Center, FSVC, Moscow Region). The outer bulb surface looked healthy, but underneath the integumentary scales, the cloves had light brown and brown spots. When grown, diseased plants were characterized by root and bulb disruption and leaf drying; for some cultivars, up to 100% of plants died. In January 2020, cv. Strelets and Dubkovsky bulbs, collected in July 2019, with rot symptoms, were taken from the FSVC storage. Necrotic clove tissue fragments (0.2-0.5 cm) were cut, sanitized with 70% ethanol for 3 min, rinsed with sterile water, and incubated on potato dextrose agar (PDA) with 1 mg/ml ampicillin at 22°C in the dark. Four single-spore cultures were obtained from four diseased bulbs. After 6 days of incubation, the isolates produced abundant aerial white mycelia and acquired a purple pigmentation. The hyphae were hyaline with septation. All isolates (Dubkovsky, Dubkovsky 2, Strelets, and Strelets 2) produced numerous oval unicellular microconidia without septa, 4.1 to 11.6 × 1.3 to 3.4 µm (n = 50) and very few macroconidia with 3-4 septa (21 to 26 × 3 to 4 µm (n = 30)), narrowed at both ends. The cultural and conidial characteristics of the isolates corresponded to Fusarium species (Leslie and Summerell 2006). To determine the species, DNA was extracted from four isolates, and the internal transcribed spacer (ITS), and genes of translation elongation factor 1α (EF1α) and subunits 1 and 2 of DNA-directed RNA polymerase II (RPB1 and RPB2) were amplified and sequenced with primers ITS1/ITS4 (White et al. 1990), EF1/EF2 (O'Donnell et al. 1998a), RPB1-F5/RPB1-R8 (O’Donnell et al. 2010) and fRPB2-5F/fRPB2-7cR (Liu et al. 1999). The obtained sequences were identical for all four isolates. The isolate Strelets sequences were deposited in NCBI GenBank (MW149129 (ITS), MW161161 (EF1α), MW413302 (RPB1) and MW413303 (RPB2)); their analysis in MLST (http://fusarium.mycobank.org) showed 98.8-99.8% similarity to F. proliferatum (NRRL 13582, 13598 and others), which is part of the F. fujikuroi complex (O'Donnell et al. 1998b). The test on pathogenicity was performed two times according to (Leyronas et al. 2018). For this, three replicates of 10 cloves (cv. Strelets) were soaked in a conidial suspension (~106 conidia/ml; Strelets isolate) for 24 h. Ten control cloves were soaked in sterile water. The cloves were incubated on Petri dishes (5 cloves on a dish; on filter paper wettened with sterile water) in the dark at 23°C. After 5 days, brown lesions and white mycelium developed on the surface of the treated cloves. The taxonomic status of the fungus isolated from necrotic tissue was determined as F. proliferatum according to the ITS, EF1α, RPB1 and RPB2 analysis. Garlic basal and bulb rot is known to be caused by F. oxysporum f. sp. cepae and F. proliferatum (Snowdon 1990). This study is the first report of F. proliferatum causing rot of garlic bulbs during storage in Russia. F. proliferatum produces a variety of mycotoxins during bulb infestation, and our findings are important for diagnosing a Fusarium disease and the use of garlic crop in culinary and medicine. Funding The reported study was funded by Russian Foundation for Basic Research, project number 20-316-70009. References: Leslie, J. F., and Summerell, B. A. 2006. Page 224 in: The Fusarium Laboratory Manual. Blackwell, Oxford, UK. https://doi.org/10.1002/9780470278376 Leyronas, C., et al. 2018. Plant Dis. 102:2658 https://doi.org/10.1094/PDIS-06-18-0962-PDN Liu, Y.J. et al. 1999. Mol. Biol. Evol. 16: 1799 https://doi.org/10.1093/oxfordjournals.molbev.a026092 O'Donnell, K, et al. 1998a. Proc Natl Acad Sci USA. 95(5):2044. https://doi.org/10.1073/pnas.95.5.2044. O’Donnell, et al. 1998b. Mycologia 90:465 O’Donnell, K., et al. 2010. J. Clin. Microbiol., 48: 3708 https://doi.org/10.1128/JCM.00989-10 Snowdon, A. L. Pages 250–252 in: A Color Atlas of Post-Harvest Diseases and Disorders of Fruits and Vegetables. Vol. 1. 1990. Wolfe Scientific, London. Taylor, A, et al. 2013. Plant Pathol. 62:103. https://doi.org/10.1111/j.1365-3059.2012.02624.x White, T. J., et al. 1990. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA.

scholarly journals First Report of Berkeleyomyces basicola Causing Black Root Rot on Lisianthus (Eustoma grandiflorum) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yishuo Huang ◽  
Xuewen Xie ◽  
Yanxia Shi ◽  
A LI CHAI ◽  
Lei Li ◽  
...  
Keyword(s):  
Root Rot ◽  
Mangifera Indica ◽  
Large Subunit ◽  
Morphological Characteristics ◽  
Internal Transcribed Spacers ◽  
Likelihood Method ◽  
Conidial Suspension ◽  
Eustoma Grandiflorum ◽  
Black Root Rot ◽  
First Report

Lisianthus (Eustoma grandiflorum (Raf.) Shinn.) is an important ornamental plant ranking in the top 10 cut flowers worldwide (Xiao et al., 2018). In 2020 and 2021, black root rot was found as a major disease limiting lisianthus production in Yunnan Province, China. Black root rot was first observed in early July 2020 on lisianthus grown in a commercial flower-production plantation, with nearly 60% plants infected. Symptoms appeared as coalescing necrotic lesions leading to black discoloration of the roots. Root damage induced by disease resulted in insufficient water and nutrient uptake by the plant, causing stunting and whole-plant wilting. The pathogen could not infect the intact endodermis, and vascular tissues below the discolored cortical tissue remained healthy. Symptomatic roots were surface sterilized using 1% NaClO for 1 min, rinsed three times in sterile water, placed onto potato dextrose agar (PDA), and incubated at 25°C for 7 days in the dark. The morphological characteristics were basically consistent: the colonies were white to gray in color, and the conidiophores were colorless to brown, solitary or clustered. Conidia were single-celled, colorless, rod-shaped, and obtuse at both ends. Chlamydospores were dark brown, clustered or solitary. The morphological characteristics of the pathogen were similar to those of Berkeleyomyces basicola (Berk. & Broome) W.J. Nel, Z.W. de Beer, T.A. Duong & M.J. Wingf. (Nakane et al. 2019). DNA was extracted from mycelia of representative isolate TB using the Plant Genomic DNA Kit (Tiangen, Beijing, China). The internal transcribed spacers (ITS), DNA replication licensing factor (MCM7), ribosomal large subunit (LSU), and 60S ribosomal protein RPL10 (60S) regions were amplified with primer pairs ITS1/ITS4 (Groenewald et al. 2013), MCM7-for/MCM7-rev, LR0R/LR5, and 60S-506F/60S-908R, respectively (Nel et al. 2018). Phylogenetic analysis of multiple genes (Bakhshi et al. 2018) was conducted with the maximum likelihood method using MEGA7. The sequences of our isolate (TB) and three published sequences of B. basicola were clustered into one clade with a 100% bootstrapping value. The accession numbers of B. basicola reference sequences are MF952423 (ITS), MF967079 (MCM7), MF948658 (LSU), and MF967072 (60S) of isolate CMW6714; MF952428 (ITS), MF967088 (MCM7), MF948661 (LSU), and MF967073 (60S) of isolate CMW25440; MF952429 (ITS), MF967102 (MCM7), MF948659 (LSU), and MF967075 (60S) of isolate CMW49352. The sequences of TB have been deposited in GenBank with accession numbers MZ351733 for ITS, MZ695817 for MCM7, MZ695816 for LSU, and MZ695815 for the 60S region. To verify the pathogenicity of the fungus, inoculations were performed on ten 2-month-old potted lisianthus plants by dipping the roots into a conidial suspension (105 spores/ml) for 2 h. Ten plants were mock inoculated with distilled water as a control. Symptoms of black root rot were observed 30 days after inoculation, whereas the control roots remained healthy. The causal fungus has a host range of over 230 species and is a destructive pathogen of many crops and ornamental plants, including cotton (Gossypium barbadense L.), tobacco (Nicotiana tabacum L.) and mango (Mangifera indica L.) (Shukla et al. 2021; Toksoz and Rothrock 2009). This is the first report worldwide of B. basicola infecting lisianthus. This discovery is of great importance for Chinese flower growers because this fungus is well established in the observed area, and effective measures are needed to manage this disease.

scholarly journals First Report of Curvularia richardiae Causing Leaf Blight on Richardia brasiliensis in Brazil

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1740-1740
Author(s):  
W. S. Lisboa ◽  
L. L. Duarte ◽  
R. W. Barreto
Keyword(s):  
Large Subunit ◽  
Culture Collection ◽  
Leaf Blight ◽  
The Other ◽  
Conidial Suspension ◽  
Weed Species ◽  
First Report ◽  
Plant Press ◽  
Agricultural Weed ◽  
The Tropics

Richardia brasiliensis (Rubiaceae), also known as white eye or ‘poaia-branca’ in Brazil, is an important agricultural weed in the tropics (2). Relatively little is known about diseases affecting this species. In March 2013, all of the plants of this weed species invading an orchid plantation in Nova Friburgo (State of Rio de Janeiro) and a private orchard at Viçosa (State of Minas Gerais) in Brazil were found to bear intense leaf blight symptoms. Lesions were circular to elliptical, 1.4 to 10.5 mm in diameter, grayish to pale brown, and coalesced leading to necrosis of large areas of the leaves. Leaf samples were collected, dried in a plant press, and representative specimens deposited in the local herbarium at the Universidade Federal de Viçosa (Accession Nos. VIC 39759 and VIC 39760). A fungus found in association with diseased tissues was isolated by directly transferring conidia from infected leaves onto PDA plates, and two isolates were deposited in a local culture collection (COAD Accession Nos. 1335 and 1443). Conidia were removed from infected leaves using a scalpel, and mounted in lactophenol and lactofuchsin for observation with a light microscope (Olympus BX 51). Conidiophores were epiphylous, isolated, subcylindrical, straight to slightly curved, 97.5 to 170.0 × 5.0 to 8.0 μm, 2 to 6 septate, unbranched, pale brown and paler towards the apex, and smooth. Conidia were straight to slightly curved, pyriform to obovoid, 35.5 to 43.5 × 12.5 to 25.0 μm, with the apex rounded and the base subacute, 1 to 3 distoseptate, the subterminal cell often dark brown and larger than the other cells (sometimes leading to the distortion and curving of conidia); the other cells were golden brown and the conidia were smooth. The morphology of the fungus on R. brasiliensis was equivalent to that described for Curvularia richardiae (1). Genomic DNA was extracted from a 7-day-old pure culture of both isolates, and the large subunit (LSU) region of ribosomal DNA (rDNA) was amplified with the primers LR0R/LR5 (3). The resulting sequences were deposited in GenBank (KF880800 and KF880801). A BLASTn search revealed 99% similarity of the two isolates from Brazil with the LSU sequence of an isolate of Cochiobolus geniculatus (JN941528). Three healthy, 10-cm-tall R. brasiliensis plants were inoculated with a conidial suspension (1 × 106 conidia/ml) of isolate COAD 1335 until runoff, and the plants kept for 2 days in a dew chamber at 26 ± 3°C. Additionally, two plants were sprayed with distilled water and kept under the same conditions. Six days after inoculation, symptoms appeared on all inoculated plants that were similar to symptoms on plants in the field. Non-treated control plants remained healthy. C. richardiae was isolated from the lesions on inoculated plants. Although there is an incomplete record of a Curvularia sp. associated with seeds of R. brasiliensis in Brazil (4), that record included no description of the fungus or information on a disease caused on the plants. This is the first report of C. richardiae causing a disease on R. brasiliensis in Brazil. Although the fungus was first described in Australia (1), C. richardiae is most likely a native from the neotropics, as is the host plant, R. brasiliensis. The fungus was probably introduced accidentally into Australia on the weedy host but has remained unnoticed in the native range until now. References: (1) J. L. Alcorn. Trans. Brit. Mycol. Soc. 56:155, 1971. (2) R. R. Rosseto et al. Planta Daninha 15:25, 1997. (3) R. Vilgalys et al. J. Bacteriol. 172:4239, 1990. (4) C. Yamashita et al. Fitopatol. Bras. 13:122, 1988.

scholarly journals Molecular reassessment of diaporthalean fungi associated with strawberry, including the leaf blight fungus, Paraphomopsis obscurans gen. et comb. nov. (Melanconiellaceae)

IMA Fungus ◽  
2021 ◽  
Vol 12 (1) ◽  
Author(s):  
Dhanushka Udayanga ◽  
Shaneya D. Miriyagalla ◽  
Dimuthu S. Manamgoda ◽  
Kim S. Lewers ◽  
Alain Gardiennet ◽  
...  
Keyword(s):  
Rna Polymerase Ii ◽  
Ribosomal Dna ◽  
Root Rot ◽  
Large Subunit ◽  
Elongation Factor ◽  
Molecular Data ◽  
Leaf Blight ◽  
Internal Transcribed Spacers ◽  
New Combination ◽  
Leaf Blotch

ABSTRACTPhytopathogenic fungi in the order Diaporthales (Sordariomycetes) cause diseases on numerous economically important crops worldwide. In this study, we reassessed the diaporthalean species associated with prominent diseases of strawberry, namely leaf blight, leaf blotch, root rot and petiole blight, based on molecular data and morphological characters using fresh and herbarium collections. Combined analyses of four nuclear loci, 28S ribosomal DNA/large subunit rDNA (LSU), ribosomal internal transcribed spacers 1 and 2 with 5.8S ribosomal DNA (ITS), partial sequences of second largest subunit of RNA polymerase II (RPB2) and translation elongation factor 1-α (TEF1), were used to reconstruct a phylogeny for these pathogens. Results confirmed that the leaf blight pathogen formerly known as Phomopsis obscurans belongs in the family Melanconiellaceae and not with Diaporthe (syn. Phomopsis) or any other known genus in the order. A new genus Paraphomopsis is introduced herein with a new combination, Paraphomopsis obscurans, to accommodate the leaf blight fungus. Gnomoniopsis fragariae comb. nov. (Gnomoniaceae), is introduced to accommodate Gnomoniopsis fructicola, the cause of leaf blotch of strawberry. Both of the fungi causing leaf blight and leaf blotch were epitypified. Fresh collections and new molecular data were incorporated for Paragnomonia fragariae (Sydowiellaceae), which causes petiole blight and root rot of strawberry and is distinct from the above taxa. An updated multilocus phylogeny for the Diaporthales is provided with representatives of currently known families.

scholarly journals First Report of Leaf Blight of Japanese Yew Caused by Pestalotiopsis microspora in Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 691-691 ◽  
Author(s):  
Y. H. Jeon ◽  
W. Cheon
Keyword(s):  
Dna Sequences ◽  
Apical Cell ◽  
Morphological Characteristics ◽  
Leaf Blight ◽  
Economic Damage ◽  
Leaf Margin ◽  
Conidial Suspension ◽  
First Report ◽  
Pestalotiopsis Microspora ◽  
Large Trees

Worldwide, Japanese yew (Taxus cuspidata Sieb. & Zucc.) is a popular garden tree, with large trees also being used for timber. In July 2012, leaf blight was observed on 10% of Japanese yew seedling leaves planted in a 500-m2 field in Andong, Gyeongsangbuk-do Province, South Korea. Typical symptoms included small, brown lesions that were first visible on the leaf margin, which enlarged and coalesced into the leaf becoming brown and blighted. To isolate potential pathogens from infected leaves, small sections of leaf tissue (5 to 10 mm2) were excised from lesion margins. Eight fungi were isolated from eight symptomatic trees, respectively. These fungi were hyphal tipped twice and transferred to potato dextrose agar (PDA) plates for incubation at 25°C. After 7 days, the fungi produced circular mats of white aerial mycelia. After 12 days, black acervuli containing slimy spore masses formed over the mycelial mats. Two representative isolates were further characterized. Their conidia were straight or slightly curved, fusiform to clavate, five-celled with constrictions at the septa, and 17.4 to 28.5 × 5.8 to 7.1 μm. Two to four 19.8- to 30.7-μm-long hyaline filamentous appendages (mostly three appendages) were attached to each apical cell, whereas one 3.7- to 7.1-μm-long hyaline appendage was attached to each basal cell, matching the description for Pestalotiopsis microspora (2). The pathogenicity of the two isolates was tested using 2-year-old plants (T. cuspidata var. nana Rehder; three plants per isolate) in 30-cm-diameter pots filled with soil under greenhouse conditions. The plants were inoculated by spraying the leaves with an atomizer with a conidial suspension (105 conidia/ml; ~50 ml on each plant) cultured for 10 days on PDA. As a control, three plants were inoculated with sterilized water. The plants were covered with plastic bags for 72 h to maintain high relative humidity (24 to 28°C). At 20 days after inoculation, small dark lesions enlarged into brown blight similar to that observed on naturally infected leaves. P. microspora was isolated from all inoculated plants, but not the controls. The fungus was confirmed by molecular analysis of the 5.8S subunit and flanking internal transcribed spaces (ITS1 and ITS2) of rDNA amplified from DNA extracted from single-spore cultures, and amplified with the ITS1/ITS4 primers and sequenced as previously described (4). Sequences were compared with other DNA sequences in GenBank using a BLASTN search. The P. microspora isolates were 99% homologous to other P. microspora (DQ456865, EU279435, FJ459951, and FJ459950). The morphological characteristics, pathogenicity, and molecular data assimilated in this study corresponded with the fungus P. microspora (2). This fungus has been previously reported as the causal agent of scab disease of Psidium guajava in Hawaii, the decline of Torreya taxifolia in Florida, and the leaf blight of Reineckea carnea in China (1,3). Therefore, this study presents the first report of P. microspora as a pathogen on T. cuspidata in Korea. The degree of pathogenicity of P. microspora to the Korean garden evergreen T. cuspidata requires quantification to determine its potential economic damage and to establish effective management practices. References: (1) D. F. Farr and A. Y. Rossman, Fungal Databases, Syst. Mycol. Microbiol. Lab. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ (2) L. M. Keith et al. Plant Dis. 90:16, 2006. (3) S. S. N. Maharachchikumbura. Fungal Diversity 50:167, 2011. (4) T. J. White et al. PCR Protocols. Academic Press, San Diego, CA, 1990.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals First Report of Anthracnose of Salsola tragus Caused by Colletotrichum gloeosporioides in Russia

Plant Disease ◽  
2008 ◽  
Vol 92 (9) ◽  
pp. 1366-1366 ◽  
Author(s):  
T. Kolomiets ◽  
O. Skatenok ◽  
A. Alexandrova ◽  
Z. Mukhina ◽  
T. Matveeva ◽  
...  
Keyword(s):  
Colletotrichum Gloeosporioides ◽  
Science Research ◽  
Research Unit ◽  
Internal Transcribed Spacers ◽  
Conidial Suspension ◽  
Voucher Specimen ◽  
First Report ◽  
Glucose Agar ◽  
Stems And Leaves ◽  
C 30

In October of 2006, dying Salsola tragus L. (Russian thistle, tumbleweed), family Chenopodiaceae, plants were found along the Azov Sea at Chushka, Russia. Approximately 40 plants in the area were diseased and almost 80% of these were dying. Plants were approximately 1 m tall × 0.5 m wide. Dying plants had irregular, necrotic lesions along the length of the stems. Leaves of these plants were also necrotic. Lesions on stems and leaves were dark brown and usually coalesced. Diseased stems were cut into 3- to 5-mm pieces, disinfested in 70% ethyl alcohol, and then placed onto the surface of potato glucose agar (PGA). Numerous, waxy, subepidermal acervuli with 110 μm long (mean) black setae were observed in all of the lesions after 2 to 3 days. Conidiophores were simple, short, and erect. Conidia were one-celled, hyaline, ovoid to oblong, falcate to straight, and measured 12.9 to 18.0 × 2.8 to 5.5 μm (mean 15.6 × 4.2 μm). Appressoria formed 24 h after placing conidia on a dialysis membrane over 20% V8 juice agar. Appressoria measured 4.0 to 13.9 × 2.4 to 8.8 μm (mean 7.0 × 5.2 μm). These characters conformed to the description of Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. in Penz. (1). A voucher specimen was deposited with the U.S. National Fungus Collections, Beltsville, MD (BPI 878389). Nucleotide sequences for the internal transcribed spacers (ITS 1 and 2) were deposited in GenBank (Accession No. EU530697) and aligned with ITS sequences of two other isolates from S. tragus. There was 100% similarity to each isolate, one from Greece (Accession No. DQ344621) and one from Hungary (Accession No. EU805538). Axenic cultures on PGA were sent to the Foreign Disease-Weed Science Research Unit, USDA, ARS, Fort Detrick, MD for testing in quarantine. Conidia were harvested from 14-day-old cultures grown on 20% V8 juice agar, and healthy stems and leaves of 30-day-old plants of S. tragus (13 plants) were spray inoculated with an aqueous conidial suspension of 1.0 × 106 conidia/ml plus 0.1% v/v polysorbate 20. Another 13 control plants were sprayed with water and surfactant without conidia. Plants were placed in an environmental chamber at 100% humidity for 16 h in the dark at 25°C. After approximately 24 h, all plants were transferred to a greenhouse at 20 to 25°C, 30 to 50% relative humidity, and natural light augmented by 12-h light periods with 500 W sodium vapor lights. Lesions developed on stems of all inoculated plants after 7 days. After 14 days, nine plants were dead and all inoculated plants were dead after 3 weeks. No symptoms developed on control plants. C. gloeosporioides was reisolated from stem pieces of all inoculated plants, and the morphology of the reisolated pathogen was the same as that of the initially isolated pathogen. To our knowledge, this is the first report of anthracnose caused by C. gloeosporioides on S. tragus in Russia. Reference: (1) B. C. Sutton. Page 15 in: Colletotrichum Biology, Pathology and Control. J. A. Bailey and M. J. Jeger, eds. CAB International, Wallingford, UK, 1992.

scholarly journals Stagonosporopsis pogostemonis: A Novel Ascomycete Fungus Causing Leaf Spot and Stem Blight on Pogostemon cablin (Lamiaceae) in South China

Pathogens ◽  
2021 ◽  
Vol 10 (9) ◽  
pp. 1093
Author(s):  
Zhang-Yong Dong ◽  
Ying-Hua Huang ◽  
Ishara S. Manawasinghe ◽  
Dhanushka N. Wanasinghe ◽  
Jia-Wei Liu ◽  
...  
Keyword(s):  
Rna Polymerase Ii ◽  
South China ◽  
Leaf Spot ◽  
Large Subunit ◽  
Fungal Species ◽  
Leaf Spot Disease ◽  
Causal Organism ◽  
Stem Blight ◽  
Southern Chinese ◽  
Pogostemon Cablin

Pogostemon cablin is one of the well-known Southern Chinese medicinal plants with detoxification, anti-bacterial, anti-inflammatory, and other pharmacological functions. Identification and characterization of phytopathogens on P. cablin are of great significance for the prevention and control of diseases. From spring to summer of 2019 and 2020, a leaf spot disease on Pogostemon cablin was observed in Guangdong Province, South China. The pathogen was isolated and identified based on both morphological and DNA molecular approaches. The molecular identification was conducted using multi-gene sequence analysis of large subunit (LSU), the nuclear ribosomal internal transcribed spacer (ITS), beta-tubulin (β-tubulin), and RNA polymerase II (rpb2) genes. The causal organism was identified as Stagonosporopsis pogostemonis, a novel fungal species. Pathogenicity of Stagonosporopsis pogostemonis on P. cablin was fulfilled via confining the Koch's postulates, causing leaf spots and stem blight disease. This is the first report of leaf spot diseases on P. cablin caused by Stagonosporopsis species worldwide.

Paraboeremia yungensis sp. nov., a new fungal species isolated from Las Yungas, South America, with promising tyrosinase production potential

Phytotaxa ◽  
2021 ◽  
Vol 528 (3) ◽  
pp. 191-201
Author(s):  
MARIA PATRICIA PERALTA ◽  
JOAQUÍN ALIAGA ◽  
OSVALDO DANIEL DELGADO ◽  
JULIA INÉS FARIÑA ◽  
BERNARDO ERNESTO LECHNER
Keyword(s):  
South America ◽  
Rna Polymerase Ii ◽  
Single Gene ◽  
Large Subunit ◽  
Fungal Species ◽  
Malt Extract ◽  
South American ◽  
South American Species ◽  
Morphological Studies ◽  
Identification Approach

In the context of a bioprospection programme for tyrosinase/L-DOPA- and melanin-producing fungal strains for biotechnological purposes, a hyperproducer isolate was obtained from Las Yungas rainforest, a relevant biodiverse ecoregion in North-Western Argentina. The selected strain was preliminarily identified as Paraboeremia sp. This is, to the best of our knowledge, the first native reported species of this genus in South America. Single-gene and multi-locus analyses of the internal transcribed spacer nuclear ribosomal RNA gene region (ITS), partial large subunit 28S nrDNA region (LSU), RNA polymerase II region (RPB2) and partial β-tubulin gene (TUB2) alignments were carried out to define the phylogenetic identity of this strain. As part of a polyphasic identification approach, these results were combined with morphological studies of active cultures growing on malt extract, oatmeal and potato dextrose agar plates. Incubation was performed under diverse conditions to stimulate sporulation for the subsequent micromorphological analysis. Microphotographs of pycnidia and conidia were taken with a scanning electron microscope. Maximum likelihood and Bayesian Inference analyses supported the location of the strain within the genus Paraboeremia, whilst morphological features allowed distinguishing it from previously described species within this genus. Based on the results herein reported, the new South-American species Paraboeremia yungensis is described and proposed.

Sign in / Sign up

Export Citation Format

Share Document