scholarly journals First Report of Pepper vein yellows virus Infecting Sweet Pepper in Spain

Plant Disease ◽  
2013 ◽  
Vol 97 (9) ◽  
pp. 1261-1261 ◽  
Author(s):  
F. Villanueva ◽  
P. Castillo ◽  
M. I. Font ◽  
A. Alfaro-Fernández ◽  
E. Moriones ◽  
...  
Keyword(s):  
Sandwich Elisa ◽  
Sweet Pepper ◽  
Nucleotide Identity ◽  
Pcr Product ◽  
Fruit Samples ◽  
Pcr Products ◽  
Symptomatic Leaf ◽  
Universal Detection ◽  
Global Threat ◽  
Pepper Vein Yellows Virus

In November 2012, unusual symptoms were observed in plants of sweet pepper (Capsicum annuum L.) grown in commercial greenhouses of Almería Province, southeastern Spain. Symptoms included interveinal yellowing, upward leaf curling, and internode shortening, and were more evident in the upper part of the plant. Abnormal ripening of fruits was observed in symptomatic plants, with fruits remaining orange in the red varieties and yellow in the orange varieties, thus reducing their marketability. During December 2012 and January 2013, severe outbreaks of this disease syndrome occurred, with many greenhouses exhibiting almost 100% incidence. The symptoms observed were similar to those reported for isolates of Pepper vein yellows virus (PeVYV, genus Polerovirus, family Luteoviridae) (previously also named Pepper yellow leaf curl virus [PYLCV] and Pepper yellows virus [PYV]) (2,4). Twenty five symptomatic leaf and/or fruit samples (some of them supplied by Zeraim Ibérica, S.A.), each from a different greenhouse, were analyzed and all reacted positively in double-antibody sandwich-ELISA with an antiserum against the polerovirus Cucurbit aphid-borne yellows virus (CABYV) (Sediag, Longvic, France), known to cross-react with PeVYV (2). Total RNA was extracted by TRIsure reagent (Bioline, London, United Kingdom) from symptomatic leaves and analyzed by reverse transcription (RT)-PCR with primers Pol-G-F (5′-GAYTGCTCYGGYTTYGACTGGAG-3′) and Pol-G-R (5′-GATYTTATAYTCATGGTAGGCCTTGAG-3′) designed for universal detection of poleroviruses by amplifying the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) partial genes (3). DNA fragments of the expected size (1.1 kbp) were amplified supporting a polerovirus infection in all the analyzed samples. The PCR product obtained from one sample (Almería-1) was extracted from agarose gel with a QIAquick gel extraction kit (Qiagen, Hilden, Germany), cloned in pGEM-T Easy vector (Promega, Madison, WI), and one clone was sequenced (Macrogen Inc., Seoul, South Korea). The PCR products amplified from three other samples (2-13, 7-13, and 8-13) were directly sequenced. The nucleotide identity between the amplified fragments (GenBank Accession Nos. KC769487, KC839992 to 94), calculated after alignment with ClustalW, was 99.7 to 100%. The highest nucleotide identity of the Spanish sequences was with a PeVYV isolate from Turkey (FN600344, named as PYV) (98.5 to 98.7%). The spread of PeVYV in Spain is additional evidence of the emergence of this virus as a global threat for pepper crops after its first detection in Japan in 1995 and recent reports from the Mediterranean Basin (1,2). References: (1) N. Buzkan et al. Arch. Virol. 158:881, 2013. (2) A. Dombrovsky et al. Phytoparasitica 38:477, 2010. (3) D. Knierim et al. Plant Pathol. 59:991, 2010. (4) R. Murakami et al. Arch. Virol. 156:921, 2011.

scholarly journals First Report of Cucurbit chlorotic yellows virus in Cucumber, Melon, and Watermelon in China

Plant Disease ◽  
2011 ◽  
Vol 95 (1) ◽  
pp. 73-73 ◽  
Author(s):  
Q. S. Gu ◽  
Y. H. Liu ◽  
Y. H. Wang ◽  
W. G. Huangfu ◽  
H. F. Gu ◽  
...  
Keyword(s):  
Bemisia Tabaci ◽  
Disease Incidence ◽  
Pcr Primers ◽  
Degenerate Primers ◽  
First Report ◽  
Representative Sequence ◽  
Pcr Product ◽  
Pcr Products ◽  
Symptomatic Leaf ◽  
Cucurbit Chlorotic Yellows Virus

Systemic foliar chlorosis of melon, watermelon, and cucumber plants grown in plastichouses was first observed in Shanghai, China in 2008. By the end of October 2009, this symptom had become prevalent across 13,000 ha of plastichouses in Shanghai, Ningbo in Zhejiang Province, and Shouguang in Shandong Province. By mid-October, disease incidence ranged from 50 to 100% and losses were estimated between 10 and 20% across 100 plastichouses. Initial disease symptoms were chlorosis beginning at the base and middle portion of the older leaves followed by development of chlorotic spots on the lamina. Within 4 to 5 days, the entire leaf lamina was bright yellow and the veins remained green. The whitefly, Bemisia tabaci, was frequently observed colonizing plants in all plastichouses included in this study. Leaf samples were collected from six symptomatic cucumber, melon, and watermelon plants from individual plastichouses in Shanghai, Ningbo, and Shouguang. A pair of degenerate primers, F-5′-GGN TTA GAN TTC GGN ACN AC-3′ and R-5′-TCA AAN GTN CCN CCN CCN AA-3′, that were specific for the genera Crinivirus and Closterovirus, family Closteroviridae (2) were used to amplify a 636-bp fragment of the viral heat shock protein 70 gene (Hsp70). A PCR product of the expected size was amplified from RNA extracted with TaKaRa RNAiso Reagent (TaKaRa, Dalian, China) from symptomatic leaf samples: 3 of 3 melon, 2 of 2 watermelon, and 1 of 1 cucumber, and from 5 of 5 Bemisia tabaci adults collected from plants in five plastichouses in Shanghai, Ningbo, and Shouguang. No PCR product was obtained from RNA extracted from cucumber leaves grown in a virus-free facility at the Fruit Research Institute, Zhengzhou. PCR products were sequenced from representative plants samples and the sequences were submitted to GenBank (Nos. GU721105 to GU721107, GU72118 to GU721110, and GU721111. The six Hsp70 sequences shared 99.8 to 100% identity with Cucurbit chlorotic yellows virus (CCYV) (GenBank No. AB523789) from Japan. Using the complete CCYV sequence (1), PCR primers were designed to amplify the complete CCYV coat protein (Cp): Cp F-5′-CGCAATCAATAAGGCGGCGACC-3′ and Cp R-5′-ACTACAACCTCCCGGTGCCAACT-3′ (804 bp), minor Cp (Cpm): Cpm-F-5′-TGATGAANTGCCANGCTNTGAAA-3′ and Cpm-R5′-ACAANTGATTCACATTNACAAT-3′ (1,632 bp); and Hsp70: Hsp F-5′-TGCAACCGATGTCAGGTTCAGCG-3′ with Hsp R-5′-TGGATAATTGGTCACGACCTCCAGT-3′ (1,947 bp). One PCR amplicon was obtained for each target gene using RNA extracted from a cucumber collected in Ningbo. Three of the PCR amplicons were cloned and the DNA sequence was determined. A representative sequence for each gene was deposited in GenBank as: cp (HM581658), cpm (HM581657), and hsp70 (HM581659). The cp, cpm, and hsp70 sequences shared 99.7, 99.9, and 99.9% nt identity with the respective genes of CCYV (AB523789), whereas they shared only 62.5, 49.9, and 69.6% identity with the respective gene sequences for Cucurbit yellow stunting disorder virus (CYSDV; NC004810), suggesting the two viruses are divergent crinivirus species. Although this virus was first reported to infect cucurbits in Japan in 2009 (1), to our knowledge, this is the first report of CCYV in China. Eradication and management efforts are therefore paramount to reducing the spread of the disease. References: (1) M. Okuda et al. Phytopathology 100:560, 2010. (2) T. Tian et al. Phytopathology 86:1167, 1996.

scholarly journals A PCR-Based Method of Detection and Differentiation of K88+ Adhesive Escherichia Coli

1996 ◽  
Vol 8 (4) ◽  
pp. 460-463 ◽  
Author(s):  
Mark A. Franklin ◽  
David H. Francis ◽  
Diane Baker ◽  
Alan G. Mathew
Keyword(s):  
Escherichia Coli ◽  
Enzyme Linked Immunosorbent Assay ◽  
Antigenic Variant ◽  
Variable Regions ◽  
E Coli ◽  
Clinical Assay ◽  
Pcr Product ◽  
Structural Subunit ◽  
Pcr Products ◽  
Polymerase Chain

The objective of this study was to develop a polymerase chain reaction (PCR)-based method to detect and differentiate among Escherichia coli strains containing genes for the expression of 3 antigenic variants of the fimbrial adhesin K88 (K88ab, K88ac, and K88ad). Five primers were designed that allowed detection of K88+ E. coli, regardless of antigenic variant, and the separate detection of the ab, ac, and ad variants. Primers AM005 and AM006 are 21 base pair (bp) oligomers that correspond to a region of the K88 operon that is common to all 3 antigenic variants. Primers MF007, MF008, and MF009 are 24-bp oligomers that matched variable regions specific to ab, ac, and ad, respectively. Using primers AM005 and AM006, a PCR product was obtained that corresponds to a 764-bp region within the large structural subunit of the K88 operon common to all 3 antigenic variants. Primer AM005 used with MF007, MF008, or MF009 produced PCR products approximately 500-bp in length from within the large structural subunit of the K88 operon of the 3 respective antigenic variants. Fragments were identified by rates of migration on a 1% agarose gel relative to each other as well as to BstEII-digested lambda fragments. This PCR-based method was comparable to the enzyme-linked immunosorbent assay and western blot test in the ability to differentiate between the antigenic variants. K88+ E. coli were differentiated from among laboratory strains and detected in ileal samples taken from cannulated pigs challenged with a known K88+ variant. K88+ E. coli were also detected from fecal swabs taken from newly weaned pigs, thus confirming that this PCR-based test could provide a convenient clinical assay for the detection of K88+ E. coli. Detection and differentiation of K88+ E. coli using general and specific primers was successful. PCR methods of detection should permit identification of K88+ antigenic variants regardless of the level of expression of the antigen.

scholarly journals First Report of a Group 16SrII Phytoplasma Associated with Witches'-Broom of Eggplant in Oman

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 360-360 ◽  
Author(s):  
A. M. Al-Subhi ◽  
N. A. Al-Saady ◽  
A. J. Khan ◽  
M. L. Deadman
Keyword(s):  
Nested Pcr ◽  
Solanum Melongena ◽  
Positive Control ◽  
Rrna Gene ◽  
Direct Pcr ◽  
First Report ◽  
Pcr Product ◽  
Pcr Products ◽  
Broom Disease ◽  
Phytoplasma Infection

Eggplant (Solanum melongena L.) belongs to the family Solanaceae and is an important vegetable cash crop grown in most parts of Oman. In February 2010, plants showing phyllody symptoms and proliferation of shoots resembling those caused by phytoplasma infection were observed at Khasab, 500 km north of Muscat. Total genomic DNA was extracted from healthy and two symptomatic plants with a modified (CTAB) buffer method (2) and analyzed by direct and nested PCR with universal phytoplasma 16S rDNA primers P1/P7 and R16F2n/ R16R2, respectively. PCR amplifications from all infected plants yielded an expected product of 1.8 kb with P1/P7 primers and a 1.2-kb fragment with nested PCR, while no products were evident with DNA from healthy plants. Restriction fragment length polymorphism (RFLP) profiles of the 1.2-kb nested PCR products of two eggplant phyllody phytoplasma and five phytoplasma control strains belonging to different groups used as positive control were generated with the restriction endonucleases RsaI, AluI, Tru9I, T-HB8I, and HpaII. The eggplant phytoplasma DNA yielded patterns similar to alfalfa witches'-broom phytoplasma (GenBank Accession No. AF438413) belonging to subgroup 16SrII-D, which has been recorded in Oman (1). The DNA sequence of the 1.8-kb direct PCR product was deposited in GenBank (Accession No. HQ423156). Sequence homology results using BLAST revealed that the eggplant phyllody phytoplasma shared >99% sequence identity with Scaevola witches'-broom phytoplasma (Accession No. AB257291.1), eggplant phyllody phytoplasma (Accession No. FN257482.1), and alfalfa witches'-broom phytoplasma (Accession No. AY169323). The RFLP and BLAST results of 16S rRNA gene sequences confirm that eggplant phyllody phytoplasma is similar to the alfalfa phytoplasma belonging to subgroup 16SrII-D. To our knowledge, this is the first report of a phytoplasma of the 16SrII-D group causing witches'-broom disease on eggplant in Oman. References: (1) A. J. Khan et al. Phytopathology 92:1038, 2002. (2) M. A. Saghai-Maroof et al. Proc. Natl. Acad. Sci. USA, 81:8014, 1984.

scholarly journals Genotyping Single-Nucleotide Polymorphisms by the Invader Assay with Dual-Color Fluorescence Polarization Detection

2001 ◽  
Vol 47 (8) ◽  
pp. 1373-1377 ◽  
Author(s):  
Tony M Hsu ◽  
Scott M Law ◽  
Shenghui Duan ◽  
Bruce P Neri ◽  
Pui-Yan Kwok
Keyword(s):  
Fluorescence Polarization ◽  
Cost Effective ◽  
Snp Markers ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Clear Cut ◽  
Pcr Product ◽  
Invader Assay ◽  
Pcr Products ◽  
Incorporation Assay

Abstract Background: The PCR-Invader® assay is a robust, homogeneous assay that has been shown to be highly sensitive and specific in genotyping single-nucleotide polymorphism (SNP) markers. In this study, we introduce two changes to improve the assay: (a) we streamline the PCR-Invader method by assaying both alleles for each SNP in one reaction; and (b) we reduce the cost of the method by adopting fluorescence polarization (FP) as the detection method. Methods: PCR product was incubated with Invader oligonucleotide and two primary probes at 93 °C for 5 min. Signal probes corresponding to the cleaved flaps of the primary probes [labeled with fluorescein and 6-carboxytetramethylrhodamine (TAMRA) dye] and Cleavase® VIII enzyme (a flap endonuclease) were then added to the mixture. This reaction mixture was incubated at 63 °C for 5 min. FP measurements were made with a fluorescence plate reader. Results: Eighty-eight individuals were genotyped across a panel of 10 SNPs, using PCR product as template, for a total of 880 genotypes. An average “no call” rate of 3.2% was observed after first round of experiments. PCR products were remade in those samples that failed to produce any genotype in the first round, and all gave clear-cut genotypes. When the genotypes determined by the PCR-Invader assay and template-directed dye-terminator incorporation assay with FP were compared, they were in 100% concordance for all SNP markers and experiments. Conclusions: The improvements introduced in this study make PCR-Invader assay simpler and more cost-effective, and therefore more suitable for high-throughput genotyping.

Automated closed-vessel system for in vitro diagnostics based on polymerase chain reaction

1993 ◽  
Vol 39 (9) ◽  
pp. 1927-1933 ◽  
Author(s):  
J B Findlay ◽  
S M Atwood ◽  
L Bergmeyer ◽  
J Chemelli ◽  
K Christy ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Pcr Amplification ◽  
Automated System ◽  
Closed Vessel ◽  
Chain Reaction ◽  
Panel Testing ◽  
Pcr Product ◽  
Pcr Products ◽  
Polymerase Chain

Abstract An automated system for polymerase chain reaction (PCR) amplification and detection combats false-positive results caused by "PCR product carryover." The system uses a single vessel for both PCR amplification and the subsequent detection of PCR products, eliminating the need to handle PCR products in an open environment and risk product carryover. The sample and PCR reagents are introduced into one compartment within the vessel, and amplification occurs as they are thermally cycled. Other compartments contain the reagents for detection of PCR products. Pressure from a roller provides for sequential delivery of the contents of the compartments to a detection area. The PCR products are biotinylated at their 5' ends during amplification through the use of biotinylated primers. After delivery to the detection area, they are specifically captured by hybridization with immobilized oligonucleotide probes. Subsequent reaction with streptavidin-horseradish peroxidase conjugate forms a complex that catalyzes dye formation from dye precursor. Wash steps minimize nonspecific background. This format is amenable to multiplexing, permitting internal controls, speciation of bacteria, typing of viruses, and panel testing. An HIV assay performed with this system demonstrated 100% sensitivity and 95% specificity for 64 patients' samples relative to a conventional PCR assay based on 32P solution hybridization. Similarly, an automated closed-vessel assay of cytomegalovirus exhibited 97.5% sensitivity and 100% specificity.

scholarly journals AtypicalCTSKTranscripts andARNTTranscription Read-Through intoCTSK

2005 ◽  
Vol 6 (5-6) ◽  
pp. 268-276
Author(s):  
Fabienne S. Giraudeau ◽  
Jean-Philippe Walhin ◽  
Paul R. Murdock ◽  
Nigel K. Spurr ◽  
Ian C. Gray
Keyword(s):  
Negative Impact ◽  
Cathepsin K ◽  
Chromosome 1 ◽  
Rt Pcr ◽  
Transcription Start ◽  
Aryl Hydrocarbon ◽  
Pcr Product ◽  
Close Proximity ◽  
Pcr Products ◽  
Human Chromosome 1

The aryl hydrocarbon receptor nuclear translocator (ARNT) and cathepsin K (CTSK) genes lie in a tandem head-to-tail arrangement on human chromosome 1. The two genes are in extremely close proximity; the usualCTSKtranscription start site is less than 1.4 kb downstream of the end of the longest reportedARNTtranscript. By generating an RT-PCR product that overlaps both the 3′ end ofARNTand the 5′ end ofCTSK, we show thatARNTtranscripts may extend through theARNT–CTSKintergenic region and progress into theCTSKgene. Furthermore, by using quantitative RT-PCR from several tissues to detect theARNTexpression signature inCTSKintrons, we show thatARNTtranscripts can read through intoCTSKas far asCTSKintron 3, extending approximately 3.7 kb downstream of the end of the longest previously describedARNTmRNA. Given thatARNTandCTSKare expressed in an overlapping range of tissues,ARNTread-through may have a negative impact onCTSKtranscript levels by interfering withCTSKexpression. We also present evidence for novelCTSKtranscripts following sequence analysis ofCTSK-derived ESTs and RT-PCR products. These transcripts show alternate 5′ splicing and or 5′ extension and are sometimes initiated from a cryptic alternative promoter which is upstream of the knownCTSKpromoter and possibly in the 3′ UTR ofARNT.

scholarly journals First Report of Tomato chlorosis virus Infecting Sweet Pepper in Costa Rica

Plant Disease ◽  
2011 ◽  
Vol 95 (11) ◽  
pp. 1482-1482 ◽  
Author(s):  
J. A. Vargas ◽  
E. Hernández ◽  
N. Barboza ◽  
F. Mora ◽  
P. Ramírez
Keyword(s):  
Costa Rica ◽  
The United States ◽  
Sweet Pepper ◽  
Nutritional Deficiencies ◽  
Total Rna ◽  
First Report ◽  
Leaf Curling ◽  
Pcr Products ◽  
Tomato Chlorosis Virus ◽  
Pepper Plants

In September 2008, a survey of whiteflies and whitefly-borne viruses was performed in 11 pepper-growing greenhouses in the province of Cartago, Costa Rica. During this survey, the vast majority of sweet pepper (Capsicum annuum cv. Nataly) plants showed interveinal chlorosis, enations, necrosis, and mild upward leaf curling. Large populations of whiteflies were present and they were found to be composed only of Trialeurodes vaporariorum. Total RNA from frozen plant samples was extracted with TRI Reagent (Molecular Research Inc., Cincinnati, OH). RevertAid H Minus Reverse Transcriptase Kit (Fermentas, Hanover, MD) was used for reverse transcription of the total RNA extract, with cDNA synthesis directed using random primers. A real-time PCR assay was performed to detect Tomato chlorosis virus (ToCV) (genus Crinivirus, family Closteroviridae) using the SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA). Three sets of primers were used to confirm the presence of ToCV in the samples: TocQ875F/TocQ998R primer set directed to a fragment of 123 bp of the HSP gene (3); ToCVp22RQF (5′-TGGATCTCACTGGTTGCTTG-3′)-ToCVp22RQR (5′-TAGTGTTTCAGCGCCAACAG-3′) primer pair that amplifies a 198-bp segment of the ToCV p22 gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora, and P. Ramirez, unpublished) and the ToCVCPmRQF (5′-CATTGGTTGGGGATTACGTC-3′)-ToCVCPmRQR (5′-TCTCAGCCTTGACTTGAGCA-3′) primer pair designed to amplify a 170-bp portion of the ToCV CPm gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora and P. Ramirez, unpublished). Fifteen symptomatic samples per greenhouse were tested for a total of 165 sweet pepper plants. From this total, seven samples from four different greenhouses produced amplification of PCR products with all three sets of primers. One of the seven samples showed mild chlorosis, but others were highly chlorotic with different levels of upward leaf curling. None of the other samples showed amplification with any of the primer sets; the symptoms on these plants could have been due to nutritional deficiencies or infection by viruses. Sequence analysis of the 460-bp HSP PCR products, produced using previously reported primers (3), and 150-bp fragment of the P22 revealed 100% sequence identity with a tomato isolate of ToCV from the United States (GenBank Accession No. AY903448). Because of the low number of samples infected with ToCV and the high incidence of symptoms, DNA extraction and a begomovirus PCR detection assay was performed using primer pair AV494/AC1048 (4). Negative results were obtained for all samples. To our knowledge, this is the first report of ToCV infecting sweet pepper plants in Costa Rica and the third one worldwide. ToCV has also been found to be infecting tomato in open field and greenhouses (1) and other weeds in greenhouses including Ruta chalepensis (Rutaceae), Phytolacca icosandra (Phytolaccaceae), Plantago major (Plantaginaceae), and Brassica sp. (Brassicaceae) (2) in the same region of Costa Rica, suggesting that it has adapted to the conditions of the area and poses an important threat to the vegetable production. References: (1) R. M. Castro et al. Plant Dis. 93:970, 2009. (2) A. Solorzano-Morales et al. Plant Dis. 95:497, 2011. (3) W. M. Wintermantel et al. Phytopathology 98:1340, 2008. (4) S. Wyatt and J. Brown. Phytopathology 86:1288, 1996.

Real-Time Polymerase Chain Reaction Detection of Bovine DNA in Meat and Bone Meal Samples

2002 ◽  
Vol 65 (7) ◽  
pp. 1158-1165 ◽  
Author(s):  
S. LAHIFF ◽  
M. GLENNON ◽  
J. LYNG ◽  
T. SMITH ◽  
N. SHILTON ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Meat And Bone Meal ◽  
Bone Meal ◽  
Chain Reaction ◽  
Pcr Assay ◽  
The Real ◽  
Pcr Product ◽  
Pcr Products ◽  
Polymerase Chain

We describe a real-time polymerase chain reaction (PCR) assay for the detection of bovine DNA extracted from meat and bone meal (MBM) samples. PCR primers were used to amplify a 271-bp region of the mitochondrial ATPase 8–ATPase 6 gene, and a fluorogenic probe (BOV1) labeled with a 5′ FAM reporter and a 3′ TAMRA quencher was designed to specifically detect bovine PCR product. The specificity of the BOV1 probe for the detection of the bovine PCR product was confirmed by Southern blot hybridization analysis of the probe with PCR products generated from ovine, porcine, and bovine genomic DNA extracted from blood and with PCR products generated from genomic DNA extracted from single-species laboratory scale rendered MBM samples. The specificity of the BOV1 probe was also evaluated in real-time PCR reactions including these genomic targets. Both methods demonstrated that the BOV1 probe was specific for the detection of bovine PCR product. The BOV1 probe had a detection limit of 0.0001% bovine material by Southern blot DNA probe hybridization analysis and a detection limit of 0.001% bovine material in the real-time PCR assay. Application of the real-time PCR assay to six industrial samples that had previously tested positive for the presence of bovine material with a conventional PCR assay yielded positive results with the real-time PCR assay for four samples.

scholarly journals First Report of Aster Yellows (16SrI-B) Associated with Potatoes in Alaska

Plant Disease ◽  
2011 ◽  
Vol 95 (6) ◽  
pp. 767-767
Author(s):  
J. H. McBeath ◽  
P. J. Laski ◽  
M. Cheng
Keyword(s):  
Nested Pcr ◽  
Disease Transmission ◽  
Sequence Data ◽  
Restriction Enzymes ◽  
Reference Pattern ◽  
Aster Yellows ◽  
First Report ◽  
Group I ◽  
Pcr Product ◽  
Pcr Products

During a disease survey conducted in 2009 in Alaska, one potato plant (Solanum tuberosum) with symptoms characteristic of aster yellows, such as apical leaves rolling inward, leaves turning yellow or purple, and presence of aerial tubers, was found in a commercial field. Total DNA was extracted from leaves, stems, and roots of the symptomatic and symptomless plants with a DNeasy Plant Mini Kit (Qiagen, Valencia, CA) according to the instructions of the manufacturer. A nested PCR was carried out with the first round primer pair P1/P7 followed by second round primer pair R16F2n/R16R2 (1,3). An approximate 1.2-kb PCR product was amplified from the symptomatic plant, but not symptomless plants. The PCR products from R16F2n/R16R2 were digested using restriction enzymes AluI, BfaI, BstUI, HhaI, HpaI, KpnI, MseI, and RsaI. The restriction fragment length polymorphism (RFLP) patterns were compared with those from known phytoplasma strains (1) and they matched the patterns for aster yellows subgroup B (16SrI-B). After P1/P7 amplification, the nested PCR product of primer pair P1A/16S-SR (2) was purified with a MiniElute Gel Extraction kit (Qiagen), sequenced by GENEWIZ (South Plainfield, NJ), and the sequence data analyzed by iPhyClassifier software (4). The results indicated that the sequence (GenBank Accession No. HQ599231) had 99.65% similarity to ‘Candidatus Phytoplasma asteris’ reference strain (GenBank Accession No. M30790). The RFLP similarity was identical (coefficient 1.00) to the reference pattern of 16Sr group I, subgroup B (GenBank Accession No. NC 005303). To our knowledge, this is the first report on the molecular identification of aster yellows phytoplasma associated with potatoes in Alaska. The source of the phytoplasma and pathway of disease transmission is currently under investigation. References: (1) I.-M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (2) I.-M. Lee et al. Int. J. Syst. Evol. Microbiol. 54:337, 2004. (3) C. D. Smart et al. Appl. Environ. Microbiol. 62:2988, 1996. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2009.

scholarly journals USE OF DIFFERENTIAL LYSIS FOR DNA ISOLATION TO CONFIRM SPERM TRANSFECTION

2021 ◽  
Vol 61 ◽  
pp. 179-185
Author(s):  
A. K. Pochernyaev ◽  
P. V. Denysiuk ◽  
M. O. Ilchenko ◽  
S. F. Lobchenko ◽  
K. F. Pochernyaev
Keyword(s):  
Dna Isolation ◽  
Aqueous Suspension ◽  
Proteinase K ◽  
Oligonucleotide Primers ◽  
Chelex 100 ◽  
Final Volume ◽  
Pcr Product ◽  
Pcr Products ◽  
Differential Lysis ◽  
Foreign Dna

The purpose of the work. Despite some progress, the creation of transgenic pigs remains a long and inefficient process. One of the key points in the transfection of porcine generative cells is determining the event of the internalization of foreign DNA by cells. The methods currently used to determine the event of the internalization of foreign DNA by cells do not take into account the possibility of the presence of foreign DNA on the surface of sperm, even after washing from the culture medium. With this in mind, the purpose of this work is to develop a method for confirming the transfection of sperm with plasmid DNA. Materials and methods of research. Sperm were washed four times with GCCS diluent. Sperm transfection was carried out in 0.6 ml polypropylene tubes with a lid in a volume of 50 μl of a suspension of protein-washed sperm in GCCS with a sperm concentration of 100 million/ml. To 50 μl of the suspension of washed sperm from proteins it was added 10 μl of the ring form of plasmid pET-28c (Novagen, France). Sperm were incubated in a thermostat at 37.7°C for two hours. Incubated sperm were stored at -20°C. To isolate DNA, 60 μl of a suspension of washed sperm from proteins with plasmid pET-28c was transferred to 1.5 ml of a polypropylene tube with a lid and centrifuged for 5 min under conditions of 12 thousand vol. min, then 35 μl of supernatant was transferred into a clean 1.5 ml tube leaving at the bottom of approximately 25 μl of liquid with sediment. Isolation of DNA from the supernatant: In a 1.5 ml tube containing 35 μl of supernatant, 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 were added to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing the DNA of plasmid pET-28c was transferred to a clean 0.6 ml tube with a lid and stored at -20°C. Isolation of DNA from the precipitate: To the precipitate it was added 100 μl of TE buffer and 2 μl of Proteinase K (20 mg/ml) and kept for 1.5 h at +56°C. After 5 minutes of centrifugation under conditions of 12 thousand vol. min the supernatant was removed, then to the precipitate was added 100 μl of TE buffer. The procedure of washing with TE buffer was repeated twice. To the purified precipitate it was added 7 μl of dithiothreitol (DTT), 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid-state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing boar sperm DNA was transferred to a clean 0.6 ml tube with a lid and stored at -20°C. The amplification was performed on a programmable thermostat TERTSIK-2 (DNA Technology, Russia). Oligonucleotide primers for the amplification of pET-28c DNA had the following structure: T7 promoter – TAATACGACTCACTATAGGG, T7 terminator – CGCTGAGCAATAACTAGC. This pair of oligonucleotide primers allows to obtain a PCR product with a size of 314 b.p. Tubes with PCR products were stored at -20°C. The specificity of the PCR products was checked by 2% agarose gel electrophoresis in 1 × Tris-borate electrode buffer (TBE) for 2 h at a current of 50 mA in a horizontal electrophoretic chamber (Cleaver Scientific Ltd., UK). DNA of plasmid pUC19 hydrolyzed by Msp I endonuclease was used as a molecular weight marker. After electrophoresis, the gel was stained with ethidium bromide solution (10 mg / cm3), and the results of electrophoresis were photographed using a gel documentation system (Cleaver Scientific Ltd., UK). Research results. The amplification of DNA of plasmid pET-28c, which was isolated using differential lysis, allowed to obtain a PCR product with a size of 314 b.p. The size of the PCR product using oligonucleotide primers (T7promoter/T7terminator) was as expected. Thus, evidence was obtained that plasmid DNA can enter sperm. Conclusions. The time required to isolate DNA using differential lysis depends on the qualifications of the staff and the amount of researches and averages 5–6 hours. This method of DNA isolation does not require the complex equipment and significant costs for reagents, but fertilization of eggs with sperm with a confirmed transfection event will save in the next stages of transfection.

Sign in / Sign up

Export Citation Format

Share Document