scholarly journals First Report of Colletotrichum fructicola Causing Anthracnose on Camellia yuhsienensis Hu in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Xinggang Chen ◽  
Changlin Liu ◽  
Jun Ang Liu ◽  
Guo Ying Zhou
Keyword(s):  
Dna Sequences ◽  
Control Plant ◽  
Morphological Features ◽  
Hunan Province ◽  
Post Inoculation ◽  
Oilseed Crop ◽  
Conidial Suspension ◽  
Effective Prevention ◽  
First Report ◽  
Representative Isolate

Camellia yuhsienensis Hu is an endemic species from China, where is the predominant oilseed crop due to its anthracnose resistance (Kuang 2015; J. Li et al. 2020; Nie et al. 2020). In April 2019, anthracnose symptoms were observed on C. yuhsienensis in a plantation in Youxian, Zhuzhou, Hunan Province, China (113.32°E, 26.79°N). It was detected approximately 10% anthracnose incidence in 500 two-year-old plants in a 5000 m2 cultivated area. Diseased leaves showed irregular grayish brown spots with dark brown edges and dark brown undersides. Symptomatic tissues (4 to 5 mm2) were surface-disinfected for 90 s in 75% ethanol, then rinsed twice with sterile water, and finally incubated on PDA (potato dextrose agar) at 28℃ (Jiang et al. 2018). Pure cultures were obtained by the single-spore isolation method. A total of 100 fungal isolates were obtained from 85 symptomatic leaves, from which 81 had similar colony morphology. Colonies on PDA were white, fluffy and cottony, and becoming dark gray after 5 days. The character of the reverse of the colony were similar to that of the upper of the colony, but the color was darker at the same time. The isolates produced a large number of single-celled, hyaline, straight and cylindrical conidia, with 10.35 to 17.58 length × 3.46 to 5.69 μm width (x=13.61 × 4.63 μm, n = 30). The isolates were preliminarily identified as Colletotrichum spp. according to morphological features (Weir et al. 2012). Representative isolate YX2-5-2 was used for molecular identification: internal transcribed spacer (ITS), partial actin (ACT), chitin synthase (CHS-1) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genomic DNA regions were amplified by PCR (Weir et al. 2012). Gene sequences were deposited in GenBank (GenBank accession no. MW398863 for ACT, MW886232 for CHS-1, MW398864 for GAPDH, MW398865 for ITS). BLAST analysis revealed that DNA sequences of YX2-5-2 at the ITS, GAPDH, ACT, and CHS-1 loci showed 100%, 99.25%, 100%, and 99.33% sequence identity, respectively to their corresponding loci in strains ZH6 (GenBank accession no. MT476840.1), ICKP18B4 (LC494274.1), YN17 (MN525804.1), and ICKG4 (LC469131.1) of C. fructicola. A Maximum Likelihood phylogenetic tree based on the combined ACT, CHS-1, ITS and GAPDH sequences revealed that the representative isolate YX2-5-2 clustered with C. fructicola. In addition, the morphological features of YX2-5-2 were similar to C. fructicola which has been reported (Weir et al. 2012). Pathogenicity was tested using isolate YX2-5-2 by inoculating leaves of 2-year-old C. yuhsienensis. Four leaves of each healthy C. yuhsienensis were sprayed with a conidial suspension (105 conidial/mL) of isolate YX2-5-2, and the above steps were repeated three times. Two additional mock-inoculated control plants were sprayed with sterilized liquid potato dextrose medium. The plants were incubated in a greenhouse at 28℃ and 90% humidity with a 12 h photoperiod. Anthracnose-like symptoms were observed 5 days post-inoculation. The control plant tissues remained healthy. C. fructicola was re-isolated on PDA from lesions, and the morphological features were consistent with YX2-5-2, confirming Koch’s postulates. To our knowledge, this is the first report of anthracnose of C. yuhsienensis caused by C. fructicola in China. Anthracnose of Camellia. oleifera has been reported for a long time (H. Li et al. 2016). C. yuhsienensis, as a wild relative of C. oleifera (commonly known as tea-oil tree), has been concerned about its resistance to anthracnose. Therefore, the occurrence of C. yuhsienensis anthracnose hindered the control of anthracnose tea-oil tree. This finding will lay the foundation for studying the pathogenesis of anthracnose of tea-oil tree and developing effective prevention methods. References: Jiang, S. Q., et al. 2018. Plant Dis. 102: 674. Kuang, R. 2015. Forest Pest and Disease. Li, H., et al. 2016. PLoS One 11: e0156841. Li, J., et al. 2020. Microorganisms 8: 1385. Nie, Z., et al. 2020. Mitochondrial. DNA. B. 5: 3016. Weir, B. S., et al. 2012. Stud. Mycol. 73: 115.

scholarly journals First Report of Diaporthe hongkongensis Causing Fruit rot on Peach (Prunus persica) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Zhou Zhang ◽  
Zheng Bing Zhang ◽  
Yuan Tai Huang ◽  
FeiXiang Wang ◽  
Wei Hua Hu ◽  
...  
Keyword(s):  
Prunus Persica ◽  
Fruit Rot ◽  
Hunan Province ◽  
Post Inoculation ◽  
Distilled Water ◽  
Conidial Suspension ◽  
Internal Transcribed Spacer Region ◽  
First Report ◽  
Representative Isolate ◽  
Rot Disease

Peach [Prunus persica (L.) Batsch] is an important deciduous fruit tree in the family Rosaceae and is a widely grown fruit in China (Verde et al., 2013). In July and August 2018, a fruit rot disease was observed in a few peach orchards in Zhuzhou city, the Hunan Province of China. Approximately 30% of the fruit in more than 400 trees was affected. Symptoms displayed were brown necrotic spots that expanded, coalesced, and lead to fruit being rotten. Symptomatic tissues excised from the margins of lesions were surface sterilized in 70% ethanol for 10 s, 0.1% HgCl2 for 2 min, rinsed with sterile distilled water three times, and incubated on potato dextrose agar (PDA) at 26°C in the dark. Fungal colonies with similar morphology developed, and eight fungal colonies were isolated for further identification. Colonies grown on PDA were grayish-white with white aerial mycelium. After an incubation period of approximately 3 weeks, pycnidia developed and produced α-conidia and β-conidia. The α-conidia were one-celled, hyaline, fusiform, and ranged in size from 6.0 to 8.4 × 2.1 to 3.1 μm, whereas the β-conidia were filiform, hamate, and 15.0 to 27.0 × 0.8 to 1.6 μm. For molecular identification, total genomic DNA was extracted from the mycelium of a representative isolate HT-1 and the internal transcribed spacer region (ITS), β-tubulin gene (TUB), translation elongation factor 1-α gene (TEF1), calmodulin (CAL), and histone H3 gene (HIS) were amplified and sequenced (Meng et al. 2018). The ITS, TUB, TEF1, CAL and HIS sequences (GenBank accession nos. MT740484, MT749776, MT749778, MT749777, and MT749779, respectively) were obtained and in analysis by BLAST against sequences in NCBI GenBank, showed 99.37 to 100% identity with D. hongkongensis or D. lithocarpus (the synonym of D. hongkongensis) (Gao et al., 2016) (GenBank accession nos. MG832540.1 for ITS, LT601561.1 for TUB, KJ490551.1 for HIS, KY433566.1 for TEF1, and MK442962.1 for CAL). Pathogenicity tests were performed on peach fruits by inoculation of mycelial plugs and conidial suspensions. In one set, 0.5 mm diameter mycelial discs, which were obtained from an actively growing representative isolate of the fungus on PDA, were placed individually on the surface of each fruit. Sterile agar plugs were used as controls. In another set, each of the fruits was inoculated by application of 1 ml conidial suspension (105 conidia/ml) by a spray bottle. Control assays were carried out with sterile distilled water. All treatments were maintained in humid chambers at 26°C with a 12-h photoperiod. The inoculation tests were conducted twice, with each one having three fruits as replications. Six days post-inoculation, symptoms of fruit rot were observed on inoculated fruits, whereas no symptoms developed on fruits treated with agar plugs and sterile water. The fungus was re-isolated and identified to be D. hongkongensis by morphological and molecular methods, thus fulfilling Koch’s Postulates. This fungus has been reported to cause fruit rot on kiwifruit (Li et al. 2016) and is also known to cause peach tree dieback in China (Dissanayake et al. 2017). However, to our knowledge, this is the first report of D. hongkongensis causing peach fruit rot disease in China. The identification of the pathogen will provide important information for growers to manage this disease.

scholarly journals First Report of Colletotrichum cliviicola Causing Leaf Spot on Tobacco (Nicotiana tabacum) in Hunan Province of China

Plant Disease ◽  
2021 ◽  
Author(s):  
Ya Rong Wang ◽  
Zhao Hu ◽  
Jie Zhong ◽  
Yi Chen ◽  
Jun Zi Zhu
Keyword(s):  
Nicotiana Tabacum ◽  
Leaf Spot ◽  
Morphological Characteristics ◽  
Disease Diagnosis ◽  
Hunan Province ◽  
Leaf Spot Disease ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
First Report ◽  
Colletotrichum Species

Tobacco (Nicotiana tabacum L.) is an annual, leafy, herb of the genus Nicotiana in the family Solanaceae. It is an important commercial crop in China. In 2020, a leaf spot disease was observed on tobacco leaves in commercial fields in the Hunan Province of China. Symptoms appeared as water-soaked, yellow-green spots, then turned dark brown, and coalesced into larger necrotic lesions, often leading to leaf wilt. Approximately 20% of the plants in a 50-ha area were infected, exhibiting symptomatic spots on 60% of these leaves. Symptomatic leaf samples were collected and cut into small pieces, sterilized with 70% ethanol for 10 s, 0.1% HgCl2 for 40s, rinsed with sterile distilled water for three times, plated on potato dextrose agar (PDA) and incubated at 26°C in the dark. Isolates with similar morphology were developed from ten samples. Fungal isolates produced densely, white to dark green, aerial mycelium. Conidia were straight, hyaline, aseptate, cylindrical, contained oil globules, and 15 to 25 µm × 3.0 to 4.0 µm (n=50). Appressoria were dark brown, irregularly shaped, 5.5 to 10.0 μm × 4.5 to 6.5 μm (n=50). These morphological characteristics were typical of Colletotrichum cliviicola (Yang et al. 2009). For molecular identification, the internal transcribed spacer (ITS) region of rDNA, actin (ACT), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and chitin synthase (CHS-1) genes of a representative isolate CS16-2 were amplified and sequenced using the primer pairs as described previously (Weir et al. 2012). These sequences were deposited in GenBank (GenBank Accession Nos. MW649137 for ITS, MW656181 for ACT, MW656182 for GAPDH and MW656183 for CHS-1). BLAST analysis showed that they had 99.46% to 100% identity to the corresponding sequences of C. cliviicola strains. A concatenated phylogenetic tree was generated, using the ACT, GAPDH and CHS-1 sequences of the isolate CS16-2 and other closely matching Colletotrichum species obtained from the GenBank. We found that the CS16-2 was grouped with the C. cliviicola clade with 97% bootstrap support, including the C. cliviicola strain AH1B6 (Wang et al. 2016). Pathogenicity was tested spraying 2-month-old potted tobacco plants until runoff with a conidial suspension (105 spores/ml). Leaves were mock inoculated with sterilized water. The pathogenicity tests were performed twice, with three replicate plants each. Plants were kept in humid chambers at 26°C with a 12-h photoperiod. Five days post-inoculation, the inoculated plants developed symptoms of consisting of the yellow-brown necrotic lesion resembling the symptoms that were observed in fields, while the control plants remained symptomless. C. cliviicola was re-isolated and identified by morphological and molecular methods as described above. Currently, C. cliviicola has been reported to be the causal agent of anthracnose in some plants, such as soybean (Zhou et al. 2017) and Zamioculcas zamiifolia (Barbieri et al. 2017). However, to our knowledge, this is the first report of C. cliviicola causing leaf spot on tobacco in China and even in the word. Given that the may greatly affect the yield and quality of tobacco production, growers should be prepared to manage this new disease. This work might provide further insight for disease diagnosis on tobacco as some other Colletotrichum species, such as C. fructicola (Wang et al. 2016) and C. karsti (Zhao et al. 2020), have also been responsible for anthracnose.

scholarly journals First Report of Phoma glomerata Associated with the Ascochyta Blight Complex on Field Pea (Pisum sativum) in Australia

Plant Disease ◽  
2014 ◽  
Vol 98 (3) ◽  
pp. 427-427 ◽  
Author(s):  
H. S. Tran ◽  
M. P. You ◽  
V. Lanoiselet ◽  
T. N. Khan ◽  
M. J. Barbetti
Keyword(s):  
Pisum Sativum ◽  
Western Australia ◽  
Ascochyta Blight ◽  
Field Pea ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Single Spore ◽  
First Report ◽  
Representative Isolate ◽  
Eastern Australia

The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as “black spot disease” in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5′GTTTCCGTAGGTGAACCTGC 3′) and AB28 (5′ATATGCTTAAGTTCAGCGGGT 3′) were used to amplify extracted DNA from the 3′ end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5′ end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 106 conidia ml–1 from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under >90% RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species. References: (1) T. W. Bretag et al. Aust. J. Agric. Res. 57:883, 2006. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. Morgan-Jones. CMI Descriptions of Pathogenic Fungi and Bacteria No.134 Phoma glomerata, 1967. (4) R. G. Shivas. J. Roy. Soc. West. Aust. 72:1, 1989.

scholarly journals First Report of Fusarium commune causing Stem Rot of Tobacco (Nicotiana tabacum) in Hunan Province, China

Plant Disease ◽  
2020 ◽  
Author(s):  
Quan Zhong ◽  
Yan song Xiao ◽  
Bin He ◽  
Zhi Hui Cao ◽  
Zhi Guo Shou ◽  
...  
Keyword(s):  
Nicotiana Tabacum ◽  
Pathogenic Fungus ◽  
Morphological Characteristics ◽  
Disease Diagnosis ◽  
Hunan Province ◽  
Stem Rot ◽  
Molecular Characteristics ◽  
Conidial Suspension ◽  
First Report ◽  
Representative Isolate

Tobacco (Nicotiana tabacum L.) is a leafy, annual, solanaceous plant grown commercially for its leaves. It is one of the most important cash crops in China. In April of 2020, tobacco stems in commercial tobacco fields developed a brown to dark brown rot, in the Hunan Province of China. Almost 20% of the plants were infected. Symptoms appeared as round water-soaked spots, then turned dark black and developed into brown necrotic lesions leading to the stem becoming girdled and rotted. Diseased stem tissue was cut and sterilized with 70% ethanol for 10 s, 0.1% HgCl2 for 2 min, rinsed with sterile distilled water three times, and then plated on potato dextrose agar (PDA) and incubated at 26°C in the dark. Six isolates with similar morphology were obtained. Colonies cultured on PDA have morphological characteristics of Fusarium spp. producing white to orange-white, densely aerial mycelium with magenta to dark violet pigmentation. Macroconidia were produced on carnation leaf agar plates (Xi et al. 2019), which were slightly curved, with apical and basal cells curved, and usually contained three or five septa, 25.50 to 41.50×3.55 to 5.80 μm (n=50). Microconidia were cylindrical, ovate-oblong, straight to slightly curved, aseptate and 5.80 to 13.75 × 3.10 to 4.10 μm (n=50). For molecular identification, the translation elongation factor 1-alpha (EF1-α), the largest subunit of RNA polymerase II gene sequences (RPB2) and the mitochondrial small subunit rDNA (mtSSU) of a representative isolate CZ3-5-6 were amplified using the primer pairs ef1/ef2 (O’Donnell et al. 1998), 5F2/7Cr (O’Donnell et al. 2010) and NMS1/ NMS2 (Li et al. 1994). The obtained EF1-α, RPB2 and mtSSU sequences (GenBank accession nos. MT708482, MT708483 and MW260121, respectively) were 99.70 %, 100% and 100% identical to strains of F. commune (HM057338.1 for EF1-α, KU171700.1 for RPB2 and MG846025 for mtSSU). Moreover, Fusarium-ID database searches revealed that the EF1-α and RPB2 were 100% identical to F. commune strains (FD_01140_EF-1a and FD_02411_RPB2). Based on the morphological and molecular characteristics of the representative isolate, the fungal species was identified as F. commune. Pathogenicity testing of a representative isolate was performed by inoculating tobacco plants, which were grown for 2.5 months in a sterile pot with autoclaved soil. Each tobacco stem was injected with 20 μl of conidial suspension (105 spores/ml). Plants inoculated with sterilized water served as control. The pathogenicity tests were performed twice using three replicate plants, and all plants were kept in humid chambers (80 × 50 × 80 cm) at 26°C with a 12-h photoperiod. After 10 days, dark brown necrotic symptoms around the inoculated site, similar to those observed in natural field, were developed in all inoculated plants, whereas no symptoms were observed on the control plants. The pathogenic fungus was re-isolated from symptomatic tissue and identified as F. commune but was not recovered from the control plants. Fusarium commune has been reported to cause root rot or stalk and stem rot on some plants, such as sugarcane (Wang et al. 2018), Gentiana scabra (Guan et al. 2016) and maize (Xi et al. 2019). However, to our knowledge, this is the first report of F. commune causing stem rot on tobacco in China. Identification of F. commune as a stem rot causing pathogen might provide important insights for disease diagnosis on tobacco caused by different Fusarium species. Overall, this disease might bring a threat to tobacco production, and appropriate control measures should be adopted to reduce losses in tobacco fields.

scholarly journals First Report of Leaf Spot Caused by Ramularia sphaeroidea on Vicia villosa var. glabrescens in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Min Shi ◽  
Yan Zhong Li
Keyword(s):  
Dna Sequences ◽  
Leaf Spot ◽  
Tween 80 ◽  
The United States ◽  
Diseased Plant ◽  
Post Inoculation ◽  
Distilled Water ◽  
Conidial Suspension ◽  
Vicia Villosa ◽  
First Report

Hairy vetch Vicia villosa Roth is widely grown in southwestern China for green manure and forage. In December 2019, a leaf disease occurred on 80% plants of V. villosa var. glabrescens in an eight-hectare field in Qujing(N 25°28′12″, E 103°36′22″), Yunnan Province, China. The disease leaves had irregular, brown to dark brown leaf spots with white mold. Twenty diseased leaves from five plants were randomly collected from the field. The leaf samples were sterilized with 75% ethanol for 30 s and 1% NaClO for 75 s, rinsed three times with sterile distilled water, surface water removed with sterile filter paper, and placed onto potato dextrose agar (PDA) for culture at 20oC. The obtained fungal isolates were purified by transferring 1 to 2 mm hyphal tips onto fresh PDA plates and cultured under the same temperature condition. The isolates grew slowly, at a rate of 0.7 mm/d at 20℃ for 4 weeks. A diseased plant specimen (accession MHLZU19326) and three isolates (accessions YN1931401, YN1931402, and YN1931403) were deposited in the Mycological Herbarium of Lanzhou University (MHLZU). Conidia from the PDA cultures were hyaline, spherical, smooth, aseptate, and measured 2.13 to 3.67 × 4.56 to 5.77 μm (n = 50). Conidiophores were hyaline, smooth, and straight. DNA of purified isolates was extracted and the nuclear ribosomal internal transcribed spacer (ITS), tef1-α, his3 and gapdh genes were amplified and sequenced with primers ITS1/ITS4 (White et al. 1990), EF1-728F/EF2 (Carbone and Kohn 1999;O’Donnell et al. 1998), CylH3F/CylH3R (Crous et al. 2004), and gpd1/gpd2 (Berbee et al. 1999), respectively. DNA sequences of isolates YN1931401, YN1931402, and YN1931403 were deposited in GenBank for the ITS (accessions MW092181, MW332205, and MW332206), tef1-α (MW448172 to MW448174), his3 (MW448175 to MW448177), and gapdh (MW448178 to MW448180). These sequences had the highest similarities with sequences of Ramularia sphaeroidea Sacc. in GenBank, 99%(514∕516, 515∕517, and 514∕517 bp) for ITS, 99% (402∕403, 403∕405, and 405∕405bp) for tef1-α, 99% (377∕378, 378∕378, and 376∕378bp) for his3, and 100% (558∕557, 557∕559 and 561∕565 bp) for gapdh . A phylogenetic tree generated with the sequences clustered the fungus closely with R. sphaeroidea. Infection experiments were carried out with 50 plants of V. villosa var. glabrescens in 10 pots. A conidial suspension of 1. 0 × 106 conidia/ml with 0.01% Tween 80 was prepared by adding sterile distilled water to the YN1931401 culture and scraping with a sterile scalpel. The leaves of 25 healthy plants were sprayed with the conidial suspension, and those of the 25 control plants were sprayed with sterile water. All plants were covered with clear polyethylene bags for 3 days to maintain high humidity and then grown in a greenhouse at diurnal cycles of 18℃ for 18h with light and 22℃ for 6 h in dark. Ten days post-inoculation, the inoculated plants exhibited brown lesions similar to the symptoms observed in the field (Fig. 1-F), whereas no symptoms appeared on the control plants. The same fungus was re-isolated and identified as described above. R. sphaeroidea has been reported on V. fabae and V. sativa in Ethiopia and Israel (Braun 1998), on various Vicia species including V. villosa in California, the United States (Koike et al. 2004) and on V. craccain China (Zhang et al. 2006), but to our knowledge, this is the first report of this fungus causing leaf spot on V. villosa in China.

scholarly journals First Report of Pepper Fruit Rot Caused by Fusarium concentricum in China

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1657-1657 ◽  
Author(s):  
J. H. Wang ◽  
Z. H. Feng ◽  
Z. Han ◽  
S. Q. Song ◽  
S. H. Lin ◽  
...  
Keyword(s):  
Fusarium Species ◽  
Fruit Rot ◽  
Post Inoculation ◽  
Distilled Water ◽  
Conidial Suspension ◽  
Average Growth ◽  
First Report ◽  
Control Fruit ◽  
Pepper Fruit ◽  
Fruit Samples

Pepper (Capsicum annuum L.) is an important vegetable crop worldwide. Some Fusarium species can cause pepper fruit rot, leading to significant yield losses of pepper production and, for some Fusarium species, potential risk of mycotoxin contamination. A total of 106 diseased pepper fruit samples were collected from various pepper cultivars from seven provinces (Gansu, Hainan, Heilongjiang, Hunan, Shandong, Shanghai, and Zhejiang) in China during the 2012 growing season, where pepper production occurs on approximately 25,000 ha. Pepper fruit rot symptom incidence ranged from 5 to 20% in individual fields. Symptomatic fruit tissue was surface-sterilized in 0.1% HgCl2 for 1 min, dipped in 70% ethanol for 30 s, then rinsed in sterilized distilled water three times, dried, and plated in 90 mm diameter petri dishes containing potato dextrose agar (PDA). After incubation for 5 days at 28°C in the dark, putative Fusarium colonies were purified by single-sporing. Forty-three Fusarium strains were isolated and identified to species as described previously (1,2). Morphological characteristics of one strain were identical to those of F. concentricum. Aerial mycelium was reddish-white with an average growth rate of 4.2 to 4.3 mm/day at 25°C in the dark on PDA. Pigments in the agar were formed in alternating red and orange concentric rings. Microconidia were 0- to 1-septate, mostly 0-septate, and oval, obovoid to allantoid. Macroconidia were relatively slender with no significant curvature, 3- to 5-septate, with a beaked apical cell and a foot-shaped basal cell. To confirm the species identity, the partial TEF gene sequence (646 bp) was amplified and sequenced (GenBank Accession No. KC816735). A BLASTn search with TEF gene sequences in NCBI and the Fusarium ID databases revealed 99.7 and 100% sequence identity, respectively, to known TEF sequences of F. concentricum. Thus, both morphological and molecular criteria supported identification of the strain as F. concentricum. This strain was deposited as Accession MUCL 54697 (http://bccm.belspo.be/about/mucl.php). Pathogenicity of the strain was confirmed by inoculating 10 wounded, mature pepper fruits that had been harvested 70 days after planting the cultivar Zhongjiao-5 with a conidial suspension (1 × 106 spores/ml), as described previously (3). A control treatment consisted of inoculating 10 pepper fruits of the same cultivar with sterilized distilled water. The fruit were incubated at 25°C in a moist chamber, and the experiment was repeated independently in triplicate. Initially, green to dark brown lesions were observed on the outer surface of inoculated fruit. Typical soft-rot symptoms and lesions were observed on the inner wall when the fruit were cut open 10 days post-inoculation. Some infected seeds in the fruits were grayish-black and covered by mycelium, similar to the original fruit symptoms observed at the sampling sites. The control fruit remained healthy after 10 days of incubation. The same fungus was isolated from the inoculated infected fruit using the method described above, but no fungal growth was observed from the control fruit. To our knowledge, this is the first report of F. concentricum causing a pepper fruit rot. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006. (2) K. O'Donnell et al. Proc. Nat. Acad. Sci. USA 95:2044, 1998. (3) Y. Yang et al. 2011. Int. J. Food Microbiol. 151:150, 2011.

scholarly journals First Report of Leaf Blight of Japanese Yew Caused by Pestalotiopsis microspora in Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 691-691 ◽  
Author(s):  
Y. H. Jeon ◽  
W. Cheon
Keyword(s):  
Dna Sequences ◽  
Apical Cell ◽  
Morphological Characteristics ◽  
Leaf Blight ◽  
Economic Damage ◽  
Leaf Margin ◽  
Conidial Suspension ◽  
First Report ◽  
Pestalotiopsis Microspora ◽  
Large Trees

Worldwide, Japanese yew (Taxus cuspidata Sieb. & Zucc.) is a popular garden tree, with large trees also being used for timber. In July 2012, leaf blight was observed on 10% of Japanese yew seedling leaves planted in a 500-m2 field in Andong, Gyeongsangbuk-do Province, South Korea. Typical symptoms included small, brown lesions that were first visible on the leaf margin, which enlarged and coalesced into the leaf becoming brown and blighted. To isolate potential pathogens from infected leaves, small sections of leaf tissue (5 to 10 mm2) were excised from lesion margins. Eight fungi were isolated from eight symptomatic trees, respectively. These fungi were hyphal tipped twice and transferred to potato dextrose agar (PDA) plates for incubation at 25°C. After 7 days, the fungi produced circular mats of white aerial mycelia. After 12 days, black acervuli containing slimy spore masses formed over the mycelial mats. Two representative isolates were further characterized. Their conidia were straight or slightly curved, fusiform to clavate, five-celled with constrictions at the septa, and 17.4 to 28.5 × 5.8 to 7.1 μm. Two to four 19.8- to 30.7-μm-long hyaline filamentous appendages (mostly three appendages) were attached to each apical cell, whereas one 3.7- to 7.1-μm-long hyaline appendage was attached to each basal cell, matching the description for Pestalotiopsis microspora (2). The pathogenicity of the two isolates was tested using 2-year-old plants (T. cuspidata var. nana Rehder; three plants per isolate) in 30-cm-diameter pots filled with soil under greenhouse conditions. The plants were inoculated by spraying the leaves with an atomizer with a conidial suspension (105 conidia/ml; ~50 ml on each plant) cultured for 10 days on PDA. As a control, three plants were inoculated with sterilized water. The plants were covered with plastic bags for 72 h to maintain high relative humidity (24 to 28°C). At 20 days after inoculation, small dark lesions enlarged into brown blight similar to that observed on naturally infected leaves. P. microspora was isolated from all inoculated plants, but not the controls. The fungus was confirmed by molecular analysis of the 5.8S subunit and flanking internal transcribed spaces (ITS1 and ITS2) of rDNA amplified from DNA extracted from single-spore cultures, and amplified with the ITS1/ITS4 primers and sequenced as previously described (4). Sequences were compared with other DNA sequences in GenBank using a BLASTN search. The P. microspora isolates were 99% homologous to other P. microspora (DQ456865, EU279435, FJ459951, and FJ459950). The morphological characteristics, pathogenicity, and molecular data assimilated in this study corresponded with the fungus P. microspora (2). This fungus has been previously reported as the causal agent of scab disease of Psidium guajava in Hawaii, the decline of Torreya taxifolia in Florida, and the leaf blight of Reineckea carnea in China (1,3). Therefore, this study presents the first report of P. microspora as a pathogen on T. cuspidata in Korea. The degree of pathogenicity of P. microspora to the Korean garden evergreen T. cuspidata requires quantification to determine its potential economic damage and to establish effective management practices. References: (1) D. F. Farr and A. Y. Rossman, Fungal Databases, Syst. Mycol. Microbiol. Lab. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ (2) L. M. Keith et al. Plant Dis. 90:16, 2006. (3) S. S. N. Maharachchikumbura. Fungal Diversity 50:167, 2011. (4) T. J. White et al. PCR Protocols. Academic Press, San Diego, CA, 1990.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals First Report of Alternaria Leaf Spot Caused by Alternaria sp. on Highbush Blueberry (Vaccinium corymbosum) in South Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1434-1434
Author(s):  
J.-H. Kwon ◽  
D.-W. Kang ◽  
M.-G. Cheon ◽  
J. Kim
Keyword(s):  
South Korea ◽  
Leaf Spot ◽  
Disease Incidence ◽  
Vaccinium Corymbosum ◽  
Its Rdna ◽  
Universal Primers ◽  
Conidial Suspension ◽  
First Report ◽  
Representative Isolate ◽  
Alternaria Sp

In South Korea, the culture, production, and consumption of blueberry (Vaccinium corymbosum) have increased rapidly over the past 10 years. In June and July 2012, blueberry plants with leaf spots (~10% of disease incidence) were sampled from a blueberry orchard in Jinju, South Korea. Leaf symptoms included small (1 to 5 mm in diameter) brown spots that were circular to irregular in shape. The spots expanded and fused into irregularly shaped, large lesions with distinct dark, brownish-red borders. The leaves with severe infection dropped early. A fungus was recovered consistently from sections of surface-disinfested (1% NaOCl) symptomatic leaf tissue after transfer onto water agar and sub-culture on PDA at 25°C. Fungal colonies were dark olive and produced loose, aerial hyphae on the culture surfaces. Conidia, which had 3 to 6 transverse septa, 1 to 2 longitudinal septa, and sometimes also a few oblique septa, were pale brown to golden brown, ellipsoid to ovoid, obclavate to obpyriform, and 16 to 42 × 7 to 16 μm (n = 50). Conidiophores were pale to mid-brown, solitary or fasciculate, and 28 to 116 × 3 to 5 μm (n = 50). The species was placed in the Alternaria alternata group (1). To confirm the identity of the fungus, the complete internal transcribed spacer (ITS) rDNA region of a representative isolate, AAVC-01, was amplified using ITS1 and ITS4 primers (2). The DNA products were cloned into the pGEM-T Easy vector (Promega, Madison, WI) and the resulting pOR13 plasmid was sequenced using universal primers. The resulting 570-bp sequence was deposited in GenBank (Accession No. KJ636460). Comparison of ITS rDNA sequences with other Alternaria spp. using ClustalX showed ≥99% similarity with the sequences of A. alternata causing blight on Jatropha curcas (JQ660842) from Mexico and Cajannus cajan (JQ074093) from India, citrus black rot (AF404664) from South Africa, and other Alternaria species, including A. tenuissima (WAC13639) (3), A. lini (Y17071), and A. longipes (AF267137). Two base substitutions, C to T at positions 345 and 426, were found in the 570-bp amplicon. Phylogenetic analysis revealed that the present Alternaria sp. infecting blueberry grouped separately from A. tenuissima and A. alternata reported from other hosts. A representative isolate of the pathogen was used to inoculate V. corymbosum Northland leaves for pathogenicity testing. A conidial suspension (2 × 104 conidia/ml) from a single spore culture and 0.025% Tween was spot inoculated onto 30 leaves, ranging from recently emerged to oldest, of 2-year-old V. corymbosum Northland plants. Ten leaves were treated with sterilized distilled water and 0.025% Tween as a control. The plants were kept in a moist chamber with >90% relative humidity at 25°C for 48 h and then moved to a greenhouse. After 15 days, leaf spot symptoms similar to those observed in the field developed on the inoculated leaves, whereas the control plants remained asymptomatic. The causal fungus was re-isolated from the lesions of the inoculated plants to fulfill Koch's postulates. To our knowledge, this is the first report of Alternaria sp. on V. corymbosum in South Korea. References: (1) E. G. Simmons. Page 1797 in: Alternaria: An Identification Manual. CBS Fungal Biodiversity Centre, Utrecht, The Netherlands, 2007. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990. (3) M. P. You et al. Plant Dis. 98:423, 2014.

scholarly journals First Report of Phomopsis citri Associated with Dieback of Citrus lemon in India

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1281-1281 ◽  
Author(s):  
S. Mahadevakumar ◽  
Vandana Yadav ◽  
G. S. Tejaswini ◽  
S. N. Sandeep ◽  
G. R. Janardhana
Keyword(s):  
Fungal Pathogen ◽  
The United States ◽  
Apical Region ◽  
Post Inoculation ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Internal Transcribed Spacer Region ◽  
Productivity Level ◽  
First Report ◽  
Dieback Disease

Lemon (Citrus lemon (L.) Burm. f.) is an important fruit crop cultivated worldwide, and is grown practically in every state in India (3). During a survey conducted in 2013, a few small trees in a lemon orchard near Mysore city (Karnataka) (12°19.629′ N, 76°31.892′ E) were found affected by dieback disease. Approximately 10 to 20% of trees were affected as young shoots and branches showed progressive death from the apical region downward. Different samples were collected and diagnosed via morphological methods. The fungus was consistently isolated from the infected branches when they were surface sanitized with 1.5% NaOCl and plated on potato dextrose agar (PDA). Plates were incubated at 26 ± 2°C for 7 days at 12/12 h alternating light and dark period. Fungal colonies were whitish with pale brown stripes having an uneven margin and pycnidia were fully embedded in the culture plate. No sexual state was observed. Pycnidia were globose, dark, 158 to 320 μm in diameter, and scattered throughout the mycelial growth. Both alpha and beta conidia were present within pycnidia. Alpha conidia were single celled (5.3 to 8.7 × 2.28 to 3.96 μm) (n = 50), bigittulate, hyaline, with one end blunt and other truncated. Beta conidia (24.8 to 29.49 × 0.9 to 1.4 μm) (n = 50) were single celled, filiform, with one end rounded and the other acute and curved. Based on the morphological and cultural features, the fungal pathogen was identified as Phomopsis citri H.S. Fawc. Pathogenicity test was conducted on nine healthy 2-year-old lemon plants via foliar application of a conidial suspension (3 × 106); plants were covered with polythene bags for 6 days and maintained in the greenhouse. Sterile distilled water inoculated plants (in triplicate) served as controls and were symptomless. Development of dieback symptoms was observed after 25 days post inoculation and the fungal pathogen was re-isolated from the inoculated lemon trees. The internal transcribed spacer region (ITS) of the isolated fungal genomic DNA was amplified using universal-primer pair ITS1/ITS4 and sequenced to confirm the species-level diagnosis (4). The sequence data of the 558-bp amplicon was deposited in GenBank (Accession No. KJ477016.1) and nBLAST search showed 99% homology with Diaporthe citri (teleomorph) strain 199.39 (KC343051.1). P. citri is known for its association with melanose disease of citrus in India, the United States, and abroad. P. citri also causes stem end rot of citrus, which leads to yield loss and reduction in fruit quality (1,2). Dieback disease is of serious concern for lemon growers as it affects the overall productivity level of the tree. To the best of our knowledge, this is the first report of P. citri causing dieback of lemon in India. References: (1) I. H. Fischer et al. Sci. Agric. (Piracicaba). 66:210, 2009. (2) S. N. Mondal et al. Plant Dis. 91:387, 2007. (3) S. P. Raychaudhuri. Proc. Int. Soc. Citriculture 1:461, 1981. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Sign in / Sign up

Export Citation Format

Share Document