First Report of Tomato yellow leaf curl virus Co-infecting Pepper with Tomato chino La Paz virus in Baja California Sur, Mexico

Chile peppers are among the most common and important crops in the State of Baja California Sur, Mexico, where diverse varieties of this crop are annually cultivated. The “chile ancho” (Capsicum annuum L. var. ancho poblano) is one of the most popular hot peppers that is exported fresh to the United States. During a survey in December of 2007 in an experimental field of the CIBNOR in El Carrizal, one of the principal farm districts in the state, a high incidence of yellowing, stunted growth with shortened internodes, foliage discoloration, malformation and crinkle, abortion of flowers, and reduction in size and quantity of fruit were noted in chile ancho. Symptoms and the presence of large populations of whiteflies in the field suggested a possible viral etiology of disease. The symptoms of disease were successfully transmitted by grafting from field plants to tomato and pepper test plants. Samples from both field and test plants were analyzed by scanning electron microscopy (SEM) and molecular techniques. SEM study revealed groups of geminate particles characteristic of begomoviruses (Geminiviridae) in phloem tissue of randomly selected symptomatic plants (four field and two test plants). Total DNA from 12 symptomatic plants (eight naturally infected and four test plants) was obtained by a modified Dellaporta method and analyzed by PCR using the begomovirus universal primers prRepDGR (2) and prC889 (3). Amplicons of ~1.4 kb were obtained from all plant samples and PCR products from four of them were cloned into pGEM-T Easy vector (Promega, Madison, WI) and subsequently analyzed by restriction fragment length polymorphism (RFLP) using EcoRI and HinfI. Two distinct restriction fragment patterns were observed among the cloned PCR products, indicating the occurrence of at least two viruses in the infected plant tissues. The four examined samples contained the same two begomoviruses according to the RFLP analysis data. The complete sequence of the genomic component A of those viruses was determined by PCR amplification of viral DNA with universal, degenerate primers previously described (2), the subsequent cloning of overlapped PCR products, and sequencing. The full-length DNA-A sequence was assembled and compared with viral sequences available at the GenBank database using BlastN and the ClustalV alignment method (MegAlign; DNASTAR, Madison, WI). The 2,781-bp complete genome sequence of one co-infecting monopartite begomovirus (Accession No. HM459851) displayed the highest identity (99%) with Tomato yellow leaf curl virus (TYLCV), isolate Guasave, Sinaloa (Accession No. FJ609655). The 2,609-bp DNA-A sequence of the second begomovirus exhibited the highest nucleotide identity (96%) with Tomato chino La Paz virus (ToChLPV)-[Baja California Sur] (Accession No. AY339619). The presence of TYLCV in this region of Mexico had not been previously reported nor was ToChLPV detected in pepper until now. To our knowledge, this is the first report of a mixed infection of pepper plants with TYLCV and a bipartite begomovirus in Baja California Peninsula. Since the high frequency of recombination events observed in begomovirus mixed infections involving TYLCV (1), it would be important to monitor the possible emergence of ToChLPV-TYLCV recombinants with higher potential virulence. References: (1) S. García-Andrés et al. Virology 365:210, 2007. (2) A. Mauricio-Castillo et al. Plant Dis. 91:1513, 2007. (3) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text

First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽

10.1094/pd-90-0379c ◽

2006 ◽

Vol 90 (3) ◽

pp. 379-379 ◽

Cited By ~ 13

Author(s):

K. S. Ling ◽

A. M. Simmons ◽

R. L. Hassell ◽

A. P. Keinath ◽

J. E. Polston

Keyword(s):

South Carolina ◽

The United States ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Pcr Products ◽

Primer Sequence ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text

Creole cattle from northwestern Mexico has high genetic diversity in the locus DRB3.2

Animal Genetic Resources/Ressources génétiques animales/Recursos genéticos animales ◽

10.1017/s2078633615000211 ◽

2015 ◽

Vol 57 ◽

pp. 31-38

Author(s):

I.G. Fernández ◽

I. Leyva-Baca ◽

F. Rodríguez-Almeida ◽

R. Ulloa-Arvizu ◽

J.G. Ríos-Ramírez ◽

...

Keyword(s):

Genetic Diversity ◽

Baja California ◽

The State ◽

Baja California Sur ◽

High Genetic Diversity ◽

La Paz ◽

Separate Branch ◽

Pcr Rflp ◽

Creole Cattle ◽

Northwestern Mexico

SummaryThe objective of this study was to determine the genetic diversity of creole cattle in northwestern Mexico using the BoLA-DRB3.2 locus of the Major Histocompatibility Complex (MHC). A total of 56 creole cattle were sampled from five communities; in the state of Chihuahua (Cerocahui, Guadalupe y Calvo and Cuauhtémoc) and in the state of Baja California Sur (La Paz and Mulegé). The BoLA-DRB3.2 locus was genotyped by PCR-RFLP assay. Thirty-nine alleles were identified, out of which 14 had not been previously reported. The average level of inbreeding in all populations analyzed wasFIS= 0.09 (P< 0.0001), but only two populations (Cerocahui and Guadalupe y Calvo) showed an excess of homozygotes (P< 0.05). The breed differentiation in all populations studied wasFSC= 0.068 (P< 0.0001). The smallest genetic distance was between La Paz and Mulegé (0.022); but Mulegé presented smaller distances (0.028–0.053) with the populations of La Paz (0.071–0.083) and with Chihuahua. Baja California Sur populations are grouped in a separate branch than Chihuahua populations. We conclude that creole cattle from Baja California Sur and Chihuahua show high genetic diversity in the locus BoLA-DRB3.2.

Download Full-text

Occurrence of Tomato yellow leaf curl virus in Tomato in Martinique, Lesser Antilles

Plant Disease ◽

10.1094/pdis-91-8-1058a ◽

2007 ◽

Vol 91 (8) ◽

pp. 1058-1058 ◽

Cited By ~ 2

Author(s):

C. Urbino ◽

A. Dalmon

Keyword(s):

Pcr Primers ◽

Tomato Yellow Leaf ◽

Lesser Antilles ◽

Yellow Leaf ◽

Rapid Spread ◽

Pcr Products ◽

Dnaman Software ◽

Northwest Region ◽

Leaf Curl Virus ◽

Leaf Curl

During April of 2002, symptoms of stunting and chlorotic curled leaves of reduced size, similar to those caused by Tomato yellow leaf curl virus (TYLCV), were observed for the first time in commercial tomato (Solanum lycopersicum) in the northwest region of Martinique. Six months later, many tomato fields had more than 80% of plants expressing these symptoms and yield was drastically reduced. Samples from two symptomatic plants were collected and analyzed by PCR. Primers PC1 (5′-TGACTATGTCGAAGCGACCAGG-3′) and PC2 (5′-CGACATTACAGCCTCAGACTGG-3′) were used to amplify a 950-bp fragment within the coat protein gene (CP) of TYLCV species (1). Primer pair MP16-MP82 (2) amplified a 550-bp fragment from the conserved nonanucleotide sequence (TAATATTAC) to the 5′ end of the CP gene. Products of expected sizes were obtained with both pairs of primers from symptomatic samples but not from uninfected ones. The two overlapping PCR products were cloned into a pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. A BLAST analysis was conducted with begomovirus sequences available in the GenBank database at the NCBI, and DNAMAN software (Lynnon Corporation, Quebec, Canada) was used for further comparisons. The 1275-bp sequence (GenBank Accession No. EF490995) shared 99% nucleotide identity with the partial sequences of TYLCV from Antigua and Barbuda (GenBank Accession No. EF028240), Saint Kitts and Nevis (GenBank Accession No. EF028239), and the two overlapping sequences from Guadeloupe (GenBank Accessions No. AY319645 and AY319646). It was at least 98% identical to TYLCV isolates from Florida (GenBank Accession No AY530931), Dominican Republic (GenBank Accession No. AF024715), and Cuba (GenBank Accession No. AJ223505). These results confirm the introduction of TYLCV into Martinique, possibly from a nearby Caribbean country, and reveal its southward spread in the Lesser Antilles. The nearness of the islands in the Lesser Antilles (20 to 100 km distant) probably permitted the rapid spread of TYLCV through the movement of plant material or wind transport of viruliferous whiteflies from one island to the next. Monitoring the spread of TYLCV in this Caribbean archipelago is important for regional virus management and in forecasting the spread of TYLCV to nearby countries in South America. References: (1) Y. Martinez et al. Rev. Prot. Veg. 18:168, 2003. (2) P. Umaharan et al. Phytopathology 88:1262, 1998.

Download Full-text

First Report of Tomato Yellow Leaf Curl Virus-Is in Spain: Coexistence of Two Different Geminiviruses in the Same Epidemic Outbreak

Plant Disease ◽

10.1094/pdis.1997.81.12.1461b ◽

1997 ◽

Vol 81 (12) ◽

pp. 1461-1461 ◽

Cited By ~ 39

Author(s):

J. Navas-Castillo ◽

S. Sánchez-Campos ◽

J. A. Díaz ◽

E. Sáez-Alonso ◽

E. Moriones

Keyword(s):

Direct Sequencing ◽

Nucleotide Sequences ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

First Report ◽

Western Mediterranean Basin ◽

Two Samples ◽

Pcr Products ◽

Leaf Curl Virus ◽

Leaf Curl

Epidemics of tomato yellow leaf curl have occurred annually in greenhouse- and field-grown tomato (Lycopersicon esculentum Mill.) crops in southern Spain since 1992 (2). The nucleotide sequences of two tomato yellow leaf curl virus (TYLCV) isolates from this region, TYLCV-M (GenBank accession no. Z25751) and TYLCV-Alm (L27708), have been determined and these isolates are closely related to isolates reported from Italy (X61153 and Z28390), suggesting the existence of a geographical cluster of closely related TYLCV isolates in the Western Mediterranean Basin (2). In June 1997, new and unusually severe symptoms of stunting, yellowing, and curling of leaflet margins, with a marked reduction in leaf size, were observed in some plants of a greenhouse-grown tomato crop in Almeria (southeastern Spain). Tomato plants showing milder symptoms similar to those previously described for TYLCV infection in that region (2) were also present in the same greenhouse. Total nucleic acids extracts from plants exhibiting both types of symptoms were analyzed by dot blot hybridization with a probe prepared by random priming on a 1,674-bp SalI fragment of the pSP95 clone of TYLCV-M (3). A strong reaction was obtained with the samples that showed mild symptoms, whereas a weak reaction was observed with the severely affected plants. Specific pairs of primers were prepared to amplify the complete pre-coat (V1) (MA10: 5′-ATGTGGGATCCTTTATTAAATG-3′; MA11: 5′-TCAGGGCTTCTGTACATTC-3′) and C2 (MA12: 5′-TAAAGACTCTTAAAAAATGACC-3′; MA13: 5′-AATGCAATCTTCGTCACC-3′) genes based on TYLCV-M sequence. With polymerase chain reaction (PCR), the expected fragments were amplified from extracts of both types of plants. The PCR products were submitted to single-strand conformation polymorphism (SSCP) analysis. Clearly distinguishable SSCP patterns were obtained: one for the plants with mild symptoms, identical to that of known TYLCV-M infected plants, and another for the plants with more severe symptoms. Further analyses done on tomato samples collected from the same area showed that both SSCP patterns were present simultaneously in several severely affected plants. The nucleotide sequences of the V1 and C2 PCR products from two samples differing in their SSCP pattern were obtained by direct sequencing, and compared with available TYLCV sequences. The sequences corresponding to the sample with mild symptoms were 100% identical to those previously reported for TYLCV-M. In contrast, the sequences from the sample that showed severe symptoms (GenBank accesion no. AF022219 for V1, and AF022220 for C2) were only 80 and 76% identical to TYLCV-M V1 and C2 genes, respectively, but were 99% identical to the sequence reported for an isolate of TYLCV-Is from Israel (X15656). Epidemics in tomato caused by TYLCV-Is have been recently reported from Portugal (1). Our results demonstrate that the unusually severe symptoms observed are associated with an isolate of TYLCV-Is that coexists in the field with the milder TYLCV previously reported from this area. This is the first report of the occurence of TYLCV-Is in Spain. References: (1) D. Louro et al. Plant Dis. 80:1079, 1996. (2) E. Noris et al. Arch. Virol. 135:165, 1994.

Download Full-text

First Report of Tomato Yellow Leaf Curl Virus in Greenhouse Tomatoes in Kentucky

Plant Health Progress ◽

10.1094/php-2008-0819-01-rs ◽

2008 ◽

Vol 9 (1) ◽

pp. 12 ◽

Cited By ~ 3

Author(s):

P. B. de Sá ◽

K. W. Seebold ◽

P. Vincelli

Keyword(s):

Pathogen Detection ◽

The United States ◽

Tomato Yellow Leaf ◽

The State ◽

Yellow Leaf ◽

Greenhouse Production ◽

Tomato Plants ◽

Detection Approach ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), genus Begomovirus in the family Geminiviridae, was identified for the first time in the United States in Florida in 1997 and since then has been reported in other states on tomato in greenhouse and in field production environments. During 2005 symptoms typical of geminivirus infection were observed on tomato plants grown in a greenhouse production system in Jefferson Co., KY. A nucleic acid-based pathogen detection approach was used and TYLCV infection was confirmed in tomato plants collected from the greenhouse and in symptomless Acalypha ostryifolia growing outside the greenhouse. To our knowledge, A. ostryifolia has not been previously described as a host of this virus. This find raises concerns regarding the introduction of TYLCV to the state in infected transplants or in viruliferous whiteflies transported on infested plants, and its potential impact on economically important crops in the state. Accepted for publication 17 June 2008. Published 19 August 2008.

Download Full-text

Introduction of Tomato Yellow Leaf Curl Virus in Florida and Implications for the Spread of This and Other Geminiviruses of Tomato

Plant Disease ◽

10.1094/pdis.1999.83.11.984 ◽

1999 ◽

Vol 83 (11) ◽

pp. 984-988 ◽

Cited By ~ 126

Author(s):

J. E. Polston ◽

R. J. McGovern ◽

L. G. Brown

Keyword(s):

Management Practices ◽

The United States ◽

Tomato Yellow Leaf ◽

The State ◽

Restriction Enzyme Digestion ◽

Dade County ◽

Yellow Leaf ◽

Infected Tomato ◽

Leaf Curl Virus ◽

Leaf Curl

In July 1997, symptoms characteristic of tomato yellow leaf curl virus (TYLCV-Is) were observed on one tomato plant in a field in Collier County, Florida, and on several tomato plants in a retail garden center in Sarasota, Florida. Amplification with three sets of primers, analysis of amplified fragments using restriction enzyme digestion, and hybridization with a clone of TYLCV-Is indicated that TYLCV-Is was present in symptomatic plants. The sequence of a 1,300-bp amplified fragment was 99% identical to TYLCV-Is from the Dominican Republic and 98% identical to an isolate from Israel. It appears that TYLCV-Is entered the United States in Dade County, Florida, in late 1996 or early 1997. Subsequently, infected tomato transplants produced for retail sale at two Dade County facilities were rapidly distributed via retail garden centers throughout the state. Infected plants purchased by homeowners and placed in and around homes appeared to be the source of TYLCV-Is for nearby commercial nurseries and production fields. It appears that transplants have played a role in the movement of this and probably other geminiviruses. A number of regulatory procedures, as well as field management practices, were implemented in the 1997-98 production season to minimize the movement of TYLCV-Is within and out of the state.

Download Full-text

Detection of Satellite DNA Beta in Tomato Plants with Tomato Yellow Leaf Curl Disease in Jordan

Plant Disease ◽

10.1094/pdis-02-14-0144-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1017-1017 ◽

Cited By ~ 2

Author(s):

G. Anfoka ◽

F. Haj Ahmad ◽

M. Altaleb ◽

M. Al Shhab

Keyword(s):

Mixed Infection ◽

Tomato Yellow Leaf ◽

Single Infection ◽

Yellow Leaf ◽

Tomato Production ◽

Tomato Plants ◽

Pcr Products ◽

Leaf Curl Virus ◽

Leaf Curl Disease ◽

Leaf Curl

In Jordan, as well as many countries in the region, tomato production is threatened by begomoviruses belonging to the tomato yellow leaf curl virus complex (1). In 2013, an experiment was conducted at Homret Al-Sahen, Jordan (GPS coordinates 32°05′06″ N, 35°38′52″ E), to evaluate different tomato breeding lines for resistance against viruses causing tomato yellow leaf curl disease (TYLCD). Disease symptoms, typical of those caused by TYLCV complex, were observed in many susceptible lines. However, some lines exhibited unusual symptoms including severe leaf curling and stunting. To identify the causal agent of these symptoms, total nucleic acids were extracted from 21 symptomatic plants and used as templates in PCR analysis using nine primers, previously described to detect Tomato yellow leaf curl virus, Tomato yellow leaf curl Sardinia virus, and two recombinants between TYLCV and TYLCSV (3). In addition, the universal primer pair β01/β02 (2) was used to investigate the association of satDNA β with the disease. The PCR products characteristic of TYLCV (664 bp) could be amplified from five plants indicating single infection, while double infection with TYLCV and satDNA β (1,320 bp) was detected in seven plants. Mixed infection with TYLCV, TYLCSV (628 bp), and satDNA β was detected in another seven symptomatic plants and only one plant was infected with TYLCV and TYLCSV. A single plant had mixed infection with TYLCV, TYLCSV, and RecA (a recombinant between TYLCV/TYLCSV) (538 bp) (3). Amplicons obtained from two plants using β01/β02 primers were directly sequenced as 1,320-bp PCR products. Both sequences were found identical and, therefore, this sequence was deposited in the GenBank under the accession number KJ396939. Phylogenetic analysis revealed that this satDNA β sequence had the highest nucleotide (95%) identity with Okra leaf curl virus (OkLCV) satDNA 3 (AF397217) and OkLCV satDNA 10 (AF397215). The contribution of the satDNA β in the modulation of the TYLCD symptoms will be further investigated. Few years ago, another satDNA (Tomβ01-Om) was reported in Oman to be associated with TYLCD (4). However, to the best of our knowledge, this is the first report on the detection of satDNA β in tomato plants infected with viruses causing TYLCD in Jordan. The increasing diversity of begomoviruses causing TYLCD in the region is of great concern due to the possible emergence of more virulent viruses and subsequent increased losses to tomato production. References: (1) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (2) R. W. Briddon and J. Stanley. Virology 344:198, 2006. (3) S. Davino et al. Virus Res. 143:15, 2009. (4) A. J. Khan et al. Virus Gene 36:169, 2008.

Download Full-text

A New Strain of Tomato chino La Paz virus Associated with a Leaf Curl Disease of Tomato in Baja California Sur, Mexico

Plant Disease ◽

10.1094/pd-90-0973b ◽

2006 ◽

Vol 90 (7) ◽

pp. 973-973 ◽

Cited By ~ 4

Author(s):

R. J. Holguín-Peña ◽

G. R. Arguello-Astorga ◽

J. K. Brown ◽

R. F. Rivera-Bustamante

Keyword(s):

Restriction Fragment ◽

Baja California ◽

Sequence Similarity ◽

Polymorphism Analysis ◽

Virus Species ◽

Baja California Sur ◽

La Paz ◽

Tomato Plants ◽

Severe Leaf ◽

Leaf Curl

Since 2001, geminivirus-like disease symptoms have been observed in tomato plants on the Baja California Peninsula of Mexico. These diseases have been associated with large populations of Bemisia tabaci (Genn.) in commercial fields and have caused dramatic decreases in expected yields. Leaf samples from tomato plants displaying symptoms of stunting and severe upward leaf curling were collected in March 2002 in fields located near the city of La Paz, Baja California Sur (BCS). Total DNA was extracted and tested for the presence of geminiviral DNA using polymerase chain reaction (PCR) with begomovirus-specific degenerate primer pairs PALIv1978/PARIc494 and PALIc1978/PARIv494 (4). PCR products of the expected size (~1.16 and ~1.45 kb) were obtained, cloned into pGEM-T Easy (Promega, Madison, WI), and sequenced. Restriction fragment length polymorphism analysis of the PCR fragments was performed using EcoRI, HindIII, PstI, and XbaI. Restriction fragment patterns were the same for all amplicons and no evidence of mixed infection was obtained. In addition, experimental transmission by whiteflies and inoculations by biolistics consistently induced severe leaf epinasty and stunted growth on tomato seedlings. The complete (2,606 nt) DNA-A sequence of the infecting virus was determined (GenBank Accession No. AY339618) and compared with viral sequences available at GenBank-EMBL databases using BLASTN and the CLUSTAL program (MegAlign, DNASTAR, Madison, WI). The highest nucleotide identity was obtained with the recently described Tomato chino Baja California virus, ToChBCV (90.2%, GenBank Accession No. AY339619), isolated from tomato plantings in El Carrizal, BCS, 100 km from La Paz (3). The second and third best scores were obtained with Tomato severe leaf curl virus from Nicaragua (ToSLCV-NI, 79.6%, GenBank Accession No. AJ508784) and Guatemala (ToSLCV-GT94, 73.8%, GenBank Accession No. AF130415), respectively. Overall, sequence similarity with other New World begomoviruses was rather low (less than 70% identity). Careful analysis of differences between the La Paz isolate and its closest relative, ToChBCV from El Carrizal, revealed that they display different Ori-associated iterons (i.e., replication (Rep)-binding sites) having GGAGTA and GGGTCY core sequences, respectively (1). Moreover, sequence comparisons of the Rep-binding domain (aa 1–120) showed that these domains are only 71% identical. Current taxonomic criteria for begomoviruses establishes that a virus DNA-A sequence identity below 89% with its closest relative is indicative of a separate species (2). Since the La Paz and El Carrizal isolates share 90.2% nt identity, they should be considered strains of a same virus species, recently renamed Tomato chino La Paz virus, ToChLPV (2). Nevertheless, the remarkable differences in their putative replication specificity determinants suggest that ToChLPV and ToChLPV-[BCS] could be incompatible in replication, an interesting issue that should be experimentally addressed. References: (1) G. R. Arguello-Astorga et al. Virology 203:90, 1994. (2) C. Fauquet and J. Stanley. Arch. Virol. 150:2151, 2005. (3) R. J. Holguín-Peña et al. Plant Dis. 89:341, 2005. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Download Full-text

Molecular characterization and phylogenetic analysis of a Squash leaf curl virus isolate from Baja California Sur, Mexico

PeerJ ◽

10.7717/peerj.6774 ◽

2019 ◽

Vol 7 ◽

pp. e6774

Author(s):

Diana Medina-Hernández ◽

M. Goretty Caamal-Chan ◽

Mayela Vargas-Salinas ◽

Abraham Loera-Muro ◽

Aarón Barraza ◽

...

Keyword(s):

Phylogenetic Analysis ◽

Middle East ◽

Baja California ◽

Rolling Circle Amplification ◽

Evolutionary Relationship ◽

Baja California Sur ◽

La Paz ◽

Squash Leaf Curl Virus ◽

Leaf Curl Virus ◽

Leaf Curl

Background The begomovirus, squash leaf curl virus (SLCuV) is one of the causal agents of squash leaf curl (SLC) disease, which is among the most destructive diseases of cucurbit crops in tropical, subtropical, and semiarid regions worldwide. This disease was originally reported in the American continent with subsequent spread to the Mediterranean basin. Up to now, SLCuV has only been detected by PCR in Mexico. This study provides the first complete sequence of a Mexican SLCuV isolate from Baja California Sur (BCS). In addition, the genome of the virus was characterized, establishing its phylogenetic relationship with other SLCuV isolates. Methods The full genome (DNA-A and DNA-B) was amplified by rolling circle amplification, cloned and sequenced and the open reading frames (ORF) were annotated. Virus identification was performed according to the International Committee on Taxonomy of Viruses (ICTV) criteria for begomovirus species demarcation. To infer evolutionary relationship with other SLCuV isolates, phylogenetic and recombination analyses were performed. Results The SLCuV-[MX-BCS-La Paz-16] genome (DNA-A and DNA-B) had 99% identity with SLCuV reference genomes. The phylogenetic analysis showed that SLCuV-[MX-BCS-La Paz-16] is closely related to SLCuV isolates from the Middle East (Egypt, Israel, Palestine and Lebanon). No evidence of interspecific recombination was determined and iterons were 100% identical in all isolates in the SLCuV clade. Conclusions SLCuV-[MX-BCS-La Paz-16] showed low genetic variability in its genome, which could be due to a local adaptation process (isolate environment), suggesting that SLCuV isolates from the Middle East could have derived from the southwestern United States of America (USA) and northwestern Mexico.

Download Full-text

Integrated Runoff-Storm Surge Flood Hazard Mapping Associated with Tropical Cyclones in the Suburbs of La Paz, Baja California Sur, México

GeoHazards ◽

10.3390/geohazards3010001 ◽

2021 ◽

Vol 3 (1) ◽

pp. 1-15

Author(s):

Miguel Angel Imaz-Lamadrid ◽

Jobst Wurl ◽

Ernesto Ramos-Velázquez ◽

Jaqueline Rodríguez-Trasviña

Keyword(s):

Tropical Cyclones ◽

Storm Surge ◽

Baja California ◽

The State ◽

Hazard Mapping ◽

Climate Change Scenarios ◽

Baja California Sur ◽

La Paz ◽

The Impact ◽

The City

Floods are amongst the most frequent and destructive type of disaster, causing significant damage to communities. Globally, there is an increasing trend in the damage caused by floods generated by several factors. Flooding is characterized by the overflow of water onto dry land. Tropical cyclones generate floods due to excess water in rivers and streams and storm surges; however, the hazard of both phenomena is presented separately. In this research we present a methodology for the estimation of flood hazards related to tropical cyclones, integrating runoff and storm surge floods. As a case study, we selected the south-western suburbs of the city of La Paz, the capital of the state of Baja California Sur in northwest Mexico. The city has experienced in recent years an expansion of the urban area. In addition, there is an infrastructure of great importance such as the transpeninsular highway that connects the capital with the north of the state, as well as the international airport. Our results indicate that urban areas, agricultural lands, as well as the air force base, airport, and portions of the transpeninsular highway are in hazardous flood areas, making necessary to reduce the exposure and vulnerability to these tropical cyclone-related events. A resulting map was effective in defining those areas that would be exposed to flooding in the face of the impact of tropical cyclones and considering climate change scenarios, which represents an invaluable source of information for society and decision-makers for comprehensive risk management and disaster prevention.

Download Full-text