scholarly journals First Confirmed Report of Tobacco ringspot virus in Cucurbits Crops in Oklahoma

Plant Disease ◽  
2012 ◽  
Vol 96 (11) ◽  
pp. 1705-1705 ◽  
Author(s):  
O. A. Abdalla ◽  
B. D. Bruton ◽  
W. W. Fish ◽  
A. Ali
Keyword(s):  
Citrullus Lanatus ◽  
Negative Control ◽  
Ringspot Virus ◽  
Post Inoculation ◽  
Vegetable Crops ◽  
Rt Pcr ◽  
Total Rna ◽  
Tobacco Ringspot Virus ◽  
Pcr Product ◽  
Two Samples

Cucurbits are major cash crops of vegetable growers in Oklahoma, particularly watermelon, which is the official state vegetable. In 2010, during a survey for cucurbit viruses (1), symptomatic leaf samples of cucumber (Cucumis sativus), cantaloupe (Cucumis melo), pumpkin, (Cucurbita pepo), squash (Cucumis maxima), and watermelon (Citrullus lanatus) showing mild to severe mosaic, mottling, and chlorotic spots were collected in Atoka, Blaine, Jefferson, and Tulsa counties. A total of 161 samples were tested by dot-immunobinding assay (DIBA) (2) using Tobacco ringspot virus (TRSV; genus Nepovirus, family Comoviridae) specific antiserum. Fourteen samples of cantaloupe, pumpkin, and watermelon from Blaine, Jefferson, and Tulsa counties were positive serologically to TRSV. At least one to two samples from each representative cucurbit collected in the field above were used as a source for mechanical inoculation. Sap was extracted from symptomatic leaves using 0.1 M K2HPO4 buffer (pH 7.2) and rub-inoculated to two squash (cv Elite) seedlings at cotyledonary stage pre-dusted with Carborundum. Seven to 10 days post-inoculation, all inoculated plants produced typical TRSV symptoms including chlorotic spots, systemic ringspot, severe leaf deformation, mottling, and stunting. Sap and total RNA was extracted from 10 mechanically inoculated squash seedlings and tested by DIBA and reverse transcription (RT)-PCR using specific TRSV primers (F: 5′-TACAGTGAGGATGCATG-3′ and R: 5′-AGTAGCTGCGACAAGCCA-3′). All of the tested samples were positive by DIBA except the negative control. Similarly, all samples from mechanically inoculated plants were also positive by PCR showing the expected 1,039-bp PCR product when analyzed by agarose gel electrophoresis. Total RNA obtained from mock-inoculated squash seedlings used as a control was negative by PCR. Amplified PCR product (1,039 bp) was directly sequenced from three infected squash seedlings. Sequence analysis confirmed that the virus shared 90 to 92% nucleotide and 94% amino acid identities with RNA2 of TRSV isolate from the U.S. (Accession No AY363727) available in the GenBank database. Total RNA extracted from original tissues of 14 DIBA positive samples collected from field were also positive by RT-PCR. The presence of TRSV could pose a serious threat to many vegetable crops, particularly cucurbits and other agricultural crops, due to its wide host range (3). This report confirms the suspected occurrence of TRSV in 1956 from watermelon in Oklahoma (4). References: (1) Ali et al. Plant Dis. 96:243, 2012 (2) A. Ali and J. W. Randles. Plant Dis. 81:343, 1997 (3) M. J. Adams and J. F. Antoniw. Outlooks Pest Manage. 16:268, 2005 (4) R. J. Shephered and F. B. Struble. Phytopathology 46:358, 1956.

scholarly journals The occurrence of strawberry virus 1 infecting strawberry in Shandong province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Chengyong He ◽  
Dehang Gao ◽  
Lingjiao Fan ◽  
Tengfei Xu ◽  
Fei Xing ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
De Novo ◽  
Shandong Province ◽  
Post Inoculation ◽  
Rt Pcr ◽  
Illumina Hiseq ◽  
Total Rna ◽  
Sodium Phosphate Buffer ◽  
Strawberry Vein Banding Virus ◽  
Two Samples

Strawberry (Fragaria × ananassa Duch.) is one of the most important horticultural plants worldwide with high economic and nutritional value. Strawberry associated virus 1 (SaV1) is a putative Cytorhabdovirus isolated from strawberry in Fujian province, China (Ding et al., 2019). Strawberry virus 1 (StrV-1) is another putative Cytorhabdovirus characterized from F. ananassa and F. vesca in Czech Republic (Fránová et al., 2019). The complete genomes of isolates of SaV1 and StrV-1 share 79 to 98% nucleotide (nt) identities. In August 2020, foliar chlorotic spots or streaks were observed in four strawberry cultivars (cv. Honeoye, Mibao, 8128 and All Star) in Yantai, Shandong province, China. To identify the associated viruses, symptomatic leaves from two plants of each cultivar (8 samples) were pooled for high-throughput sequencing (HTS). Total RNA was extracted from the composite sample and used for constructing a cDNA library after ribosomal RNA (rRNA)-depletion. Sequencing was carried out on Illumina Hiseq 4000 (Novogene, China). Raw reads were filtered, trimmed and de novo assembled as described previously (Grabherr et al., 2013; Zhou et al. 2020). The resulting contigs were screened by BLASTn and BLASTx against GenBank database. Subsequent analyses indicated the presence of strawberry vein banding virus, strawberry pallidosis associated virus and strawberry mottle virus in the analyzed sample, which had been reported previously in strawberry (Martin and Tzanetakis, 2013; Shi et al., 2018; Bhagwat et al., 2016). Besides, five contigs ranging from 266 to 6,057 nt were obtained. They shared 87 to 91% nt sequence identity with StrV-1 isolate B (GenBank accession no. MK211271). To confirm StrV-1 infection in the strawberry plants, total RNA was isolated from all eight samples using RNAprep Pure Plant Plus Kit (Tiangen, China). Reverse transcription polymerase chain reaction (RT-PCR) was conducted with two pairs of specific primers StrVp1 (Forward: 5ʹ-CATTACTGAAGCATTCCGTG-3′/Reverse: 5ʹ-AGATATCACGCACAGTGAC-3ʹ), and StrVp2 (Forward: 5ʹ-TTGCGCGAAGCGGATGTCCG-3′/Reverse: 5ʹ-GGCTGCCAGAGCGTTGGATG-3ʹ), targeting nt positions 70-1,231 and 7,825-9,348 of StrV-1 isolate B, respectively. Fragments with the expected sizes were amplified from two samples of cv. All Star. The amplicons were cloned, sequenced, and deposited in GenBank under accession no. MW419123-124 and MW645247-248. Both protein encoding sequences shared 91 to 92% and 80 to 84% nt identities with the corresponding sequences of StrV-1 isolate B and SaV1, respectively, indicating that the isolates from this study are genetic variants of StrV-1 and distantly related to SaV1. Crude sap was prepared by homogenizing leaf tissues of StrV-1 infected strawberry in 0.02 mol/L sodium phosphate buffer with 0.45% (w/v) sodium diethyldithiocarbamate thihydrate, then gently rubbed onto five healthy Nicotiana benthamiana plants. Neither the inoculated leaves nor the systemically infected leaves showed obvious symptoms seven days post inoculation. However, StrV-1 was detected by RT-PCR in all five N. benthamiana plants as described above. In addition, a survey of strawberry greenhouses was conducted in August 2020 and approximately 10% of plants in a 667 m2 greenhouse in Yantai had StrV-1-like symptoms. To the best of our knowledge, this is the first report of the occurrence of StrV-1 infecting strawberry in Shandong province, China. Our findings expand the geographic range and genetic diversity of StrV-1 and indicate it could be a potential virus threat to strawberry production in China.

scholarly journals First report of groundnut ringspot virus infecting Zinnia sp. in Brazil

Plant Disease ◽  
2021 ◽  
Author(s):  
Felipe Franco de Oliveira ◽  
Gabriel Madoglio Favara ◽  
Camila Geovana Ferro ◽  
Heron Delgado Kraide ◽  
Eike Yudi Nishimura Carmo ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Nucleotide Sequences ◽  
Ringspot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
Concentric Ring ◽  
Leaf Extracts ◽  
Total Rna ◽  
First Report ◽  
Two Samples

Zinnia sp. is a genus belonging to Asteraceae family, originated in Mexico and adapted to a warm-hot climate (Hemmati and Mehrnoosh, 2017). Several types of zinnias with different flower color and forms are cultivated in Brazil (Min et al., 2020 and Souza Jr. et al., 2020). Characteristic symptoms of infection caused by orthotospovirus, including chlorotic spots and concentric rings on the leaves, were observed in two plants of Zinnia sp. of a florist located in the city of Piracicaba, State of São Paulo, Brazil. Orthotospovirus-like particles were observed by transmission electron microscope in leaf extracts from both plants, stained negatively with 1% uranyl acetate. By analyzing ultrathin sections of infected leaf tissues, particles of 80-100 nm in diameter were found in the lumen of the endoplasmic reticulum and nucleocapsid aggregates in the cytoplasm. Total RNA extracted separately from the leaves of both samples, using the Purelink Viral DNA / RNA kit (Thermo Fisher Scientific), was used to detect the virus by reverse transcription polymerase chain reaction (RT-PCR), using the universal primers for orthotospovirus BR60, complementary to the 3’ end of the non-translated region of the S RNA (position 1 to 15 nt), and BR65, matching the nucleocapsid gene (N) (position 433 to 453 nt), generating and amplicon of 453 nt (Eiras et al., 2001). Amplicons of the expected size were obtained for the two samples. An amplicon was purified with the Wizard SV Gel and PCR Clean-Up System kit (Promega) and sequenced in both directions at Macrogen Inc (South Korea). The nucleotide sequence (GenBank MW629018) showed 99.29-99.76% identity with nucleotide sequences of the orthotospovirus groundnut ringspot virus (GRSV) isolates (GenBank MH686229 and KY400110). Leaf extracts from symptomatic plants were also analyzed by plate-trapped antigen-enzyme-linked immunosorbent assay (PTA-ELISA), using polyclonal antiserum produced against the GRSV nucleocapsid protein (Esquivel et al., 2019). The absorbance values obtained for the extracts of the two symptomatic plants of Zinnia sp. (1.3 and 1.7) were twice as high as the value obtained for the healthy plant extract (0.5). Leaf extract of symptomatic Zinnia sp. was inoculated mechanically onto leaves of healthy plants of Zinnia sp., Capsicum annuum cv. Dara, Cucumis sativus, Cucurbita pepo cv. Caserta, Chenopodium amaranticolor, Datura stramonium, Nicotiana tabacum cv. Turkish and Solanum lycopersicum cv. Compack. At 5 days post inoculation (dpi), inoculated leaves of D. stramonium reacted with local lesions, and at 9 dpi, newly developed leaves of inoculated S. lycopersicum plants showed necrotic spot and concentric ring symptoms, whereas C. annuum exhibited concentric rings at 10 dpi. Inoculated zinnia plants showed systemic chlorotic spot and concentric ring symptoms at 20 dpi, indistinguishable from those observed under natural infection. The other inoculated plant species were not symptomatic, nor the virus was detected. PTA-ELISA and RT-PCR confirmed infection with GRSV in symptomatic plants. The amplicons generated by RT-PCR of total RNA extracted from an experimentally infected plant of C. annuum and D. stramonium, and two plants of Zinnia sp. were sent for nucleotide sequencing. The obtained nucleotide sequences (MW629019, MW629020, MW629021, MW629022) shares 100% identity with the nucleotide sequence corresponding to the original GRSV isolate (MW629018) identified in Zinnia sp. This is the first report of the natural occurrence of GRSV in Zinnia sp. in Brazil. Studies on incidence and damage are needed to recommend alternatives for management.

scholarly journals First report of Melon aphid-borne yellows virus infecting watermelon in Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Hee-Seong Byun ◽  
Hong-Soo Choi ◽  
Hyun Ran Kim ◽  
Hae-Ryun Kwak ◽  
Eui-Joon Kil ◽  
...  
Keyword(s):  
De Novo ◽  
Citrullus Lanatus ◽  
Plant Viruses ◽  
Rt Pcr ◽  
Genome Database ◽  
Total Rna ◽  
First Report ◽  
Two Samples ◽  
Primer Sets ◽  
Melon Aphid

Watermelon (Citrullus lanatus) is one of the most popular crops in Korea, with over 100 million units produced annually. As watermelon cultivation increases, the damage caused by plant viruses in watermelon farms is also increasing. In July 2020, some watermelons cultivated on farms in Uiryeong showed typical viral symptoms, such as yellowing and necrosis. In previous studies, two plant viruses, cucurbit aphid-borne yellows virus (CABYV) and cucurbit chlorotic yellows virus (CCYV), have been reported as causal agents of yellowing disease in the cucurbitaceae plant in Korea. To identify the virus(es) associated with the symptomatic watermelon plants, 11 samples were collected. Total RNA was extracted from each sample using the Plant RNA Prep kit (Biocube System, Gwacheon, Korea). RT-PCR was performed using primer sets specific to CABYV and CCYV to detect each virus (Kwak et al. 2018, Wintermantel et al. 2019). CABYV was detected in one sample, and CCYV was detected in 8 samples. Every sample presented similar yellowing symptoms; however, neither virus was detected in the remaining two samples. To investigate unknown viruses, a transcriptome library was constructed using total RNA of the watermelons and sequenced using a NovaSeq 6000 sequencer (Illumina, San Diego, CA). The reads were de novo assembled and annotated using the KEGG virus genome database with the NCBI BLAST utility. All procedures of next generation sequencing were performed by Macrogen (Seoul, Korea). Three large viral contigs were identified, and additional BLAST analyses for nucleotides (nt) and proteins indicated that they were CABYV, CCYV, and melon aphid-borne yellows virus (MAYBV). A total of 247,198 reads were mapped to reference MABYV sequence (GenBank Accession Number NC_010809), and the sequencing depth was 6,575X. The contig (MW505927) had a size of 5,677 nt and showed 100% coverage and 96% identity with known complete MABYV sequences (JQ700307 and EU000534). To confirm the presence of MABYV, RT-PCR was performed using specific primer sets targeting MABYV (MABYV-262-F, 5ʹ-GAACCGTCGACGCACTTCAAAGAGTA-3ʹ and Polero-uni-R, 5ʹ-GATYTTATAYTCATGGTAGGCCTTGAG-3ʹ; Knierim et al. 2010). The expected size of 262 bp was obtained from 5 out of 11 samples, including the two samples mentioned above. MABYV belongs to the genus Polerovirus and has been reported in cucurbit crops in China, Taiwan, and Thailand (Xiang et al. 2008, Knierim et al. 2010, Cheewachaiwit et al. 2017). According to the farmer, outbreak of aphids had previously occurred and were controlled with pesticides. Since aphids are known to be vectors of poleroviruses, we surmise that the watermelons were infected with MABYV by the aphids at that time. To monitor the outbreak of MABYV, watermelon farms in Uiryeong will be continuously investigated. To our knowledge, this is the first report of MABYV in Korea.

scholarly journals Performance evaluation of the Simtomax® CoronaCheck rapid diagnostic test

2020 ◽  
Author(s):  
P. J. Ducrest ◽  
A. Freymond ◽  
J.-M. Segura
Keyword(s):  
Diagnostic Test ◽  
Rapid Diagnostic Test ◽  
Diagnostic Performance ◽  
High Sensitivity ◽  
High Specificity ◽  
Negative Control ◽  
List Type ◽  
Plasma Samples ◽  
Rt Pcr ◽  
Two Samples

AbstractThe aim of this study was to evaluate the diagnostic performance of Simtomax® CoronaCheck, a serology rapid diagnostic test (RDT) for the detection of IgG and IgM against SARS-CoV-2. 48 plasma samples positive for SARS-CoV-2 based on RT-PCR and 98 negative control samples were studied. Diagnostic performance of the IgG/IgM RDT was assessed against RT-PCR and the electro-chemiluminescence immunoassay (ECLIA) Elecsys® Anti-SARS-CoV-2 total Ig. Overall, the RDT sensitivity was 92% (95% confidence interval [95%CI]: 79-97), specificity 97% (95% CI: 91-99%), PPV 94% (95% CI: 81-98) and the NPV 96% (95% CI: 89-99). When considering only samples collected ≥ 15 days post-symptoms (DPS), the sensitivity increased to 98% (95%CI: 86-100) and the specificity was 97% (95% CI: 91-99%). Two samples with 180 DPS were still positive for IgG. Globally, this IgG/IgM RDT displayed a high diagnostic accuracy for SARS-CoV-2 IgG/IgM detection in plasma samples in high COVID-19 prevalence settings. It could be effectively used, in absence of facilities for routine diagnostic serology, for samples with a DPS between 15 and 180 days.Highlights–The rapid diagnostic test Simtomax CoronaCheck displays a high sensitivity of 98% and a high specificity of 97% for SARS-CoV-2 IgG/IgM detection in plasma samples after 15 days post-symptoms.–The rapid diagnostic test Simtomax CoronaCheck can detect SARS-CoV-2 antibodies in plasma up to 180 days after symptom onset.–The rapid diagnostic test Simtomax CoronaCheck could be effectively used as an alternative to serological analysis using laboratory facilities.

scholarly journals First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 561-561 ◽  
Author(s):  
S. Khankhum ◽  
P. Bollich ◽  
R. A. Valverde
Keyword(s):  
Common Bean ◽  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Ringspot Virus ◽  
Wild Plants ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
First Report ◽  
Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

scholarly journals Squash vein yellowing virus Identified in Watermelon (Citrullus lanatus) in Indiana

Plant Disease ◽  
2007 ◽  
Vol 91 (8) ◽  
pp. 1056-1056 ◽  
Author(s):  
D. S. Egel ◽  
S. Adkins
Keyword(s):  
Citrullus Lanatus ◽  
Amino Acid Sequences ◽  
Rt Pcr ◽  
Strain Vector ◽  
First Report ◽  
Pcr Product ◽  
Field Samples ◽  
Health Progress ◽  
Vine Decline ◽  
Yellowing Virus

During September 2006, moderate vine decline symptoms including vine collapse and wilt and root rot were observed on numerous watermelon plants growing in a commercial field in Sullivan County, Indiana. No symptoms were observed on the fruit. Six plants displaying typical vine decline symptoms were collected and assayed for potyvirus infection and subsequently for Squash vein yellowing virus (SqVYV) and Papaya ringspot virus type W (PRSV-W). SqVYV is a whitefly-transmitted member of the Potyviridae, recently shown to cause watermelon vine decline in Florida (1,4). Plants infected with SqVYV in Florida are also frequently infected with PRSV-W, although SqVYV is sufficient for watermelon vine decline. The six field samples harbored one or more potyviruses as determined by ELISA (Agdia, Elkhart, IN). Mechanical inoculation of squash (Cucurbita pepo) and watermelon with sap from three of the field samples induced mosaic symptoms in both that are typical of potyviruses. Vein yellowing in squash and plant death in watermelon typical of SqVYV (1) later developed in plants inoculated with one field sample. A coat protein gene fragment was amplified by reverse transcription (RT)-PCR with SqVYV primers (1) from total RNA of five of the six field samples and also from the symptomatic, inoculated plants. Nucleotide and deduced amino acid sequences of a 957-bp region of the RT-PCR product (primer sequences deleted prior to analysis) were 100% identical to SqVYV (GenBank accession No. DQ812125). PRSV-W also was identified in two of the five SqVYV-infected field samples by ELISA (Agdia) and by sequence analysis of a 3′ genome fragment amplified by RT-PCR with previously described degenerate potyvirus primers (3). No evidence for infection by other potyviruses was obtained. To our knowledge, this is the first report of SqVYV in Indiana and the first report of the virus anywhere outside of Florida. The whitefly (Bemisia tabaci, B strain) vector of SqVYV is relatively uncommon in Indiana and the cold winter temperatures make it unlikely that any SqVYV-infected watermelon vines or whiteflies will overseason, necessitating reintroductions of virus and vector each season. We feel that the moderate and restricted occurrence of SqVYV in Indiana observed in September 2006 should pose little or no threat to commercial watermelon production in Indiana and should not cause growers to alter their growing practices. The occurrence of SqVYV in Indiana does not appear to explain the similar symptoms of mature watermelon vine decline (MWVD) that has been observed in Indiana since the 1980s. In contrast with the insect vectored SqVYV, MWVD seems to be caused by a soilborne biological agent (2). References: (1) S. Adkins et al. Phytopathology 97:145, 2007. (2) D. S. Egel et al. Online publication. doi:10.1094/PHP-2000-1227-01-HN. Plant Health Progress, 2000. (3) A. Gibbs and A. Mackenzie. J. Virol. Methods 63:9, 1997. (4) P. Roberts et al. Citrus Veg. Mag. December 12, 2004.

scholarly journals First Report of Tobacco ringspot virus in Blackberry (Rubus sp.) in Alabama

Plant Disease ◽  
2008 ◽  
Vol 92 (12) ◽  
pp. 1708-1708 ◽  
Author(s):  
E. Coneva ◽  
J. F. Murphy ◽  
R. Boozer ◽  
N. Velásquez
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
Virus Infection ◽  
The United States ◽  
Negative Control ◽  
Ringspot Virus ◽  
First Report ◽  
Tobacco Ringspot Virus ◽  
Control Samples

In 2006, primocane stunted growth and crumbly berry development were observed on 4-year-old Kiowa and Apache blackberry cultivars grown at the Chilton Research and Extension Center, Clanton, AL. Samples from affected plants were tested for virus infection by ELISA kits (Agdia, Inc., Elkhart, IN) specific to each of 14 different viruses. Most samples tested positive for Tobacco ringspot virus (TRSV). TRSV was detected in blackberry samples from North Carolina and South Carolina (2). Bray et al. (1) studied the incidence of viruses in blackberry nursery stock in the United States and reported that 9% of the tested samples contained TRSV. Thus, a survey was conducted for TRSV incidence among commercial blackberry stands in eight counties in Alabama during July 2007. Blackberry plants were observed to express virus-like symptoms including chlorotic spots on leaves, leaf veinal chlorosis, stunting, and combinations thereof. Fruit-bearing plants sometimes had crumbly fruit symptoms characteristic of virus infection. Leaf samples that were collected from symptomatic and nonsymptomatic plants representing 14 cultivars were tested by TRSV ELISA (Agdia, Inc.). Of 180 blackberry samples, 68 tested positive for TRSV. Positive ELISA reactions for TRSV were on average 28 times greater than the reactions of known negative control samples considered negative for TRSV. Blackberry plants shown to be infected with TRSV during the 2007 survey were tested in July 2008 in an effort to confirm the presence of TRSV. Fifty-four percent of the samples tested positive by ELISA with the average positive ELISA value being 21 times higher than the average negative ELISA value for known negative control samples. To further confirm the occurrence of TRSV in Alabama-grown blackberry plants, leaf samples were tested by reverse transcription (RT)-PCR to amplify a 329-bp fragment of the viral coat protein gene (TRSV RNA 2 sequence accession no. NC_005096; primers TRSCP-F (5′-TCTGGCACTATAAGCGGAAG-3′) and TRSCP-R (5′-GAAAACATGGGAGGATGCAC-3′). A single band of the anticipated size was amplified (analyzed by agarose gel electorphoresis and visualized by ethidium bromide staining) from RNA samples extracted with a RNeasy Mini kit (Qiagen, Valencia, CA) from blackberry samples that tested positive for TRSV by ELISA and a known positive control. No amplified product resulted from a blackberry sample that tested negative for TRSV by ELISA. These results illustrate and confirm the presence of TRSV in blackberry leaf tissues grown in Alabama. To our knowledge, this is the first report of TRSV infection of blackberry plants in Alabama. References: (1) M. M. Bray et al. HortScience 40:874, 2005. (2) T. L. Guzmán-Baeny. Incidence, distribution, and symptom description of viruses in cultivated blackberry (Rubus subgenus Eubatus) in the southeastern United States. M.S. thesis, North Carolina State University, Raleigh, 2003.

scholarly journals First Report of Peanut mottle virus Infecting Soybean in South Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1285-1285 ◽  
Author(s):  
S. Lim ◽  
Y.-H. Lee ◽  
D. Igori ◽  
F. Zhao ◽  
R. H. Yoo ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
South Korea ◽  
Mosaic Virus ◽  
Soybean Mosaic Virus ◽  
Nucleotide Sequences ◽  
Mottle Virus ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Pcr Product

In July 2013, soybean (Glycine max) plants at the research field in Daegu, South Korea, showed virus-like symptoms, such as mosaic, mottle, yellowing, and stunting. Overall, there were approximately 1% of soybean plants that showed these symptoms. Sixteen soybean samples were collected based on visual symptoms and subjected to laboratory characterization. Total RNA was extracted from each sample with the Tri Reagent (Molecular Research Center, Cincinnati, OH) and cDNA was synthesized using random N25 primer with RevertAid Reverse Transcriptase (Thermo Scientific, Waltham, MA), according to the manufacturers' instructions. All samples were tested by PCR with Prime Taq Premix (2X) (GeNet Bio, Daejeon, Korea) and primer sets specific to Soybean mosaic virus (SMV; 5′-CATATCAGTTTGTTGGGCA-3′ and 5′-TGCCTATACCCTCAACAT-3′), Peanut stunt virus (PSV; 5′-TGACCGCGTGCCAGTAGGAT-3′ and 5′-AGGTDGCTTTCTWTTGRATTTA-3′), Soybean yellow mottle mosaic virus (SYMMV; 5′-CAACCCTCAGCCACATTCAACTAT-3′ and 5′-TCTAACCACCCCACCCGAAGGATT-3′), and Soybean yellow common mosaic virus (SYCMV; 5′-TTGGCTGAGAGGAGTGGCTT-3′ and 5′-TGCGGTCGTGTAGTCAGTG-3′). Among 16 samples tested, five were positive for SMV and two for SYMMV. Three samples were found infected by both SMV and SYMMV and four by both SMV and PSV. Since two of the symptomatic samples were not infected by viruses described above, a pair of primers specific to Peanut mottle virus (PeMoV; 5′-GCTGTGAATTGTTGTTGAGAA-3′ and 5′-ACAATGATGAAGTTCGTTAC-3′) was tested (1). All 16 samples were subjected to RT-PCR with primers specific to PeMoV. Four were found positive for PeMoV. Two of them were already found infected with SYMMV. In order to identify the complete nucleotide sequences of PeMoV coat protein (CP), another primer set (5′-TGAGCAGGAAAGAATTGTTTC-3′ and 5′-GGAAGCGATATACACACCAAC-3′) was used. RT-PCR product was cloned into RBC TA Cloning Vector (RBC Bioscience, Taipei, Taiwan) and the nucleotide sequence of the insert was determined by Macrogen (Seoul, Korea). CP gene of the PeMoV (GenBank Accession No. KJ664838) showed the highest nucleotide sequence identity with PeMoV isolate Habin (KF977830; 99% identity), and the highest amino acid identity with GenBank Accession No. ABI97347 (100% identity). In order to fulfill Koch's postulates, several G. max cv. Williams 82 were inoculated with the extracts of PeMoV-infected leaf tissue. At 14 days post-inoculation, plants showed systemic mottle symptoms. These symptomatic plants were subjected to RT-PCR, and the nucleotide sequences of the PCR product were found identical to that of the virus in the inoculum. To our knowledge, this is the first report of soybean-infecting PeMoV, a member of the genus Potyvirus in the family Potyviridae, in South Korea. Reference: (1) R. G. Dietzgen et al. Plant Dis. 85:989, 2001.

scholarly journals First Report of Cucurbit chlorotic yellows virus Infecting Cucurbits in Taiwan

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1168-1168 ◽  
Author(s):  
L.-H. Huang ◽  
H.-H. Tseng ◽  
J.-T. Li ◽  
T.-C. Chen
Keyword(s):  
Citrullus Lanatus ◽  
Bottle Gourd ◽  
Insect Vector ◽  
Silverleaf Whitefly ◽  
Rt Pcr ◽  
Specific Primers ◽  
Total Rna ◽  
First Report ◽  
Dna Fragment ◽  
Cucurbit Chlorotic Yellows Virus

In April 2009, chlorosis, yellows, and bleaching accompanied with green veins and brittleness on the lower leaves of cantaloupe (Cucumis melo L.) were observed in Lunbei Township, Yunlin County, Taiwan. The same symptoms were also found on cucumber (Cucumis sativus L.), pumpkin (Cucurbita moschata Duchesne), watermelon (Citrullus lanatus (Thunb.) Matsum. & Nakai), bottle gourd (Lagenaria siceraria (Molina) Standl.), and oriental pickling melon planted in other areas of Yunlin and Changhua counties in central Taiwan. Large populations of whiteflies were observed in association with the diseased cucurbit crops, and they were further identified as silverleaf whitefly (Bemisia argentifolii Bellows & Perring) by PCR with specific primers BaBF (5′-CCACTATAATTATTGCTGTTCCCACA-3′) and l2-N-3014R (5′-TCCAATGCACTAATCTGCCATATTA-3′) (3). In June 2009, samples from symptomatic cantaloupe were collected for virus diagnosis. Flexuous filamentous virions of 700 to 900 nm were observed in crude sap of the symptomatic cantaloupe tissues with transmission electron microscopy. On the basis of the suspected insect vector, symptomology, and virus morphology, a Crinivirus species was suspected as the causal agent. A nested reverse transcription (RT)-PCR assay with degenerate deoxyinosine-containing primers developed for detection of Closterovirus and Crinivirus (1) was conducted. Total RNAs extracted from 16 symptomatic cantaloupe samples with a Plant Total RNA Miniprep Purification Kit (Hopegen, Taichung, Taiwan) were analyzed, and a 0.5-kb DNA fragment was amplified from eight of them. The PCR products were sequenced and the sequences were identical among samples. A comparison of the submitted sequence (Accession No. HM120250) with those in GenBank showed that the sequence was identical to the Hsp70h sequences of Cucurbit chlorotic yellows virus (CCYV) isolates from Japan (Accession No. AB523789) (4) and China (Accession Nos. GU721105, GU721108, and GU721110). To identify CCYV infection in the field, the specific primers, Crini-hsp70-f (5′-GCCATAACCATTACGGGAGA-3′) and Crini-hsp70-r (5′-CGCAGTGAAAAACCCAAACT-3′), that amplify a 389-bp DNA fragment corresponding to the nucleotide 1,324 to 1,712 of RNA2 of the original CCYV Japan isolate (Accession No. AB523789) were designed for detection of CCYV. In RT-PCR analyses, CCYV was identified in cantaloupe (305 of 599 samples), watermelon (27 of 93 samples), cucumber (all 15 samples), melon (82 of 92 samples), pumpkin (8 of 10 samples), and bottle gourd (10 of 17 samples) showing chlorosis and yellowing. The 389-bp DNA fragment was also amplified by RT-PCR with the primer pair Crini-hsp70-f/Crini-hsp70-r from total RNA extracts of 29 of 116 silverleaf whitefly individuals collected from the diseased cantaloupe fields in Lunbei Township from August to October, 2009. CCYV is a newly characterized Crinivirus species, first discovered in Japan in 2004 (2) and also found in China in 2009. To our knowledge, this is the first report that CCYV is emerging as a threat to cucurbit productions in Taiwan. References: (1) C. I. Dovas and N. I. Katis. J. Virol. Methods 109:217, 2003. (2) Y. Gyoutoku et al. Jpn. J. Phytopathol. 75:109, 2009. (3) C. C. Ko et al. J. Appl. Entomol. 131:542, 2007. (4) M. Okuda et al. Phytopathology 100:560, 2010.

scholarly journals First Report of Cucurbit chlorotic yellows virus in Cucumber, Melon, and Watermelon in Greece

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1446-1446 ◽  
Author(s):  
C. Orfanidou ◽  
V. I. Maliogka ◽  
N. I. Katis
Keyword(s):  
Citrullus Lanatus ◽  
Disease Incidence ◽  
Access Time ◽  
Cucumber Plant ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Yellowing Disease ◽  
Beet Pseudo Yellows Virus ◽  
Cucurbit Chlorotic Yellows Virus

In 2011, an outbreak of a yellowing disease causing chlorosis and Interveinal chlorotic spots on lower leaves was observed in cucumber (Cucumis sativus) and melon (C. melo) plants in two greenhouses on the island of Rhodes, Greece. Similar symptoms were observed in 2012 in open field watermelon (Citrullus lanatus) plants in Rhodes and in November 2013 in a cucumber greenhouse in Tympaki, Crete. Disease incidence ranged from 10 to 40%. The observed symptoms were similar to those caused by whitefly transmitted criniviruses (family Closteroviridae) Cucurbit yellow stunting disorder virus (CYSDV) and Beet pseudo-yellows virus (BPYV), as well as Cucurbit chlorotic yellows virus (CCYV), a recently described crinivirus that infects cucurbits in Japan (4) and by the aphid transmitted polerovirus (family Luteoviridae) Cucurbit aphid-borne yellows virus (CABYV). Dense populations of whiteflies were present in all the affected crops. Leaf samples from cucumber (10 from Rhodes and 10 from Crete), melon (10), and watermelon (10) were collected and tested for the presence of the above viruses. Total RNA was extracted from the samples (2) and detection of BPYV, CYSDV, and CABYV was done as previously described (1,3) whereas detection of CCYV was conducted by herein developed two-step RT-PCR assays. Two new pairs of primers, ‘CC-HSP-up’ (5′-GAAGAGATGGGTTGGTGTAGATAAA-3′)/‘CC-HSP-do’ (5′-CACACCGATTTCATAAACATCCTTT-3′) and ‘CC-RdRp-up’ (5′-CCTAATATTGGAGCTTATGAGTACA-3′)/‘CC-RdRp-do’ (5′-CATACACTTTAAACACAACCCC-3′) were designed based on GenBank deposited sequences of CCYV for the amplification of two regions partially covering the heat shock protein 70 homologue (HSP70h) (226 bp) and the RNA dependent RNA polymerase (RdRp) genes (709 bp). Interestingly, CCYV was detected in all samples tested, while CYSDV was detected in 18 cucumbers (10 from Rhodes and 8 from Crete), 1 melon, and 3 watermelon plants. Neither BPYV nor CABYV were detected. In order to verify the presence of CCYV, the partial HSP70h and RdRp regions of a cucumber isolate from Crete were directly sequenced using the primers ‘CC-HSP-up’/‘CC-HSP-do’ and ‘CC-RdRp-up’/‘CC-RdRp-do’. BLAST analysis of the obtained sequences (HG939521 and 22) showed 99% and 100% identities with the HSP70h and RdRp of cucumber CCYV isolates from Lebanon, respectively (KC990511 and 22). Also, the partial HSP70h sequence of a watermelon CCYV isolate from Rhodes showed 99% identity with the cucumber isolate from Crete. Whitefly transmission of CCYV was also carried out by using an infected cucumber from Crete as virus source. Four groups of 30 whitefly adults of Bemisia tabaci biotype Q were given an acquisition and inoculation access time of 48 and 72 h, respectively. Each whitefly group was transferred to a healthy cucumber plant (hybrid Galeon). Two weeks post inoculation, the plants, which have already been showing mild interveinal chlorosis, were tested for virus presence by RT-PCR. CCYV was successfully transmitted in three of four inoculated cucumbers, which was further confirmed by sequencing. In Greece, cucurbit yellowing disease has occurred since the 1990s, with CYSDV, BPYV, and CABYV as causal agents. To our knowledge, this is the first report of CCYV infecting cucurbits in Greece; therefore, our finding supports the notion that the virus is spreading in the Mediterranean basin and is an important pathogen in cucurbit crops. References: (1) I. N. Boubourakas et al. Plant Pathol. 55:276, 2006. (2) E. Chatzinasiou et al. J. Virol. Methods 169:305, 2010. (3) L. Lotos et al. J. Virol. Methods 198:1, 2014. (4) M. Okuda et al. Phytopathology 100:560, 2010.

Sign in / Sign up

Export Citation Format

Share Document