First Report of Black Spot Caused by Neoscytalidium dimidiatum on Sisal in Guangxi, China

Sisal (Agave sisalana Perrine) is an important hard fiber crop that is widely planted in Guangxi, Guangdong, Hainan, Yunnan, and Fujian provinces, China. In July 2019, a new leaf disease of sisal with a disease incident of about 36% was found in Guangxi (Fig.1a~d). The oval or circular black lesions were 2.3 cm to 15.9 cm in length and 1.6 cm to 5.5 cm in width on both sides of the diseased leaves. The central part of the lesions was slightly hollow. The lesions continuously enlarged and ultimately penetrated the leaves. Reddish brown and dark mucus was secreted from the lesions. The junction of lesions and healthy parts was reddish brown to yellow. The diseased leaf fiber and mesophyll tissues were reddish brown and necrotic. Fresh leaf yield was reduced about 30% by the disease, and fiber quality was significantly compromised every year in Guangxi. Six kinds of fungi distinguished by their morphology, size and color of the colonies were isolated from diseased leaf tissues of 60 sisal plants sampled from five different farms in Guangxi. Isolate JMHB1 was isolated at a rate of 95.67%. The isolate JMHB1 was initially white with dense and hairy aerial mycelium, gradually turning dark grey to olive green on PDA (Fig. 2). Conidia, arthrospores, and chlamydospores were observed on PDA in culture (Fig. 3). The conidia formed arthric chains, disarticulating, cylindrical-truncate, oblong-obtuse to doliiform, colorless and transparent, zero- to one-septate, and averaging 4.4 to 13.8 µm × 2.2 to 5.6 µm (n=100). Arthrospores were short columnar, pigmented and transparent, single or formed arthric chains, averaging 5.5 to 17.9 µm × 2.1 to 3.5 µm (n=100). Chlamydospores were dark brown, round or oval, averaging 4.5 to 9.6 µm × 4.5 to 8.6 µm (n=100). Pathogenicity testing was conducted by inoculating 3-year-old healthy sisal plants with PDA plugs (5 × 5 mm) on which the fungus had grown for 5 days. Nine healthy plants were wounded on the leaves with a sterile needle, and mycelial plugs were placed on the wounds, covered with sterile moist cotton, and wrapped with parafilm. Nine control plants were wounded and treated with PDA plugs as the negative control. The test was repeated three times. All treated plants were kept in a greenhouse at ~28 ℃ and 40% RH. After 5 days, only leaves inoculated with isolate JMHB1 showed lesions similar to symptoms observed in the field (Fig.1e~f). The fungus was re-isolated from all nine diseased plants, and no symptoms were observed on the leaves of control plants. Molecular identification of the fungus was made by PCR amplification of the internal transcribed spacer (ITS) region of rDNA, EF1-α gene and β-tubulin gene using primers ITS1/ITS4 (White et al. 1990), EFl-728F/EF1-986R (Carbone and Kohn 1999), TUB2Fd/TUB4Rd (Aveskamp et al. 2009) respectively. The ITS (MT705646), EF1-α (MT733516) and β-tubulin (MT773603) sequences of JMHB1 were similar to the ITS (AY819727), EF1-α (EU144063) and β-tubulin (KF531800) sequences of the epitype of Neoscytalidium dimidiatum (CBS 499.66) with 100%, 99.65% and 99.02% identity, respectively. Based on pathogenicity testing, morphological characteristics, and molecular identification, the pathogen of sisal causing black spot was identified as N. dimidiatum (Penz.) Crous & Slippers (Crous et al. 2006). To our knowledge, this is the first report of black spot caused by N. dimidiatum on sisal in China. Sisal is the main economic crop in arid and semi-arid areas that is widely planted in several provinces of southern China. The serious occurrence of the disease caused by N. dimidiatum has greatly affected the development of sisal industry and local economic income in China. Identification of the pathogen of the disease is of great significance to guide disease control, increase farmers' income and promote the development of sisal industry. References: Aveskamp, M. M., et al. 2009. Mycologia, 101: 363. https://doi.org/10.3852/08-199. Carbone, I., and Kohn, L. M. 1999. Mycologia, 91:553. https://doi.org/10.1080/00275514.1999. 12061051. Crous, P. W., et al. 2006. Stud. Mycol. 55:235. https://doi.org/10.3114/sim.55.1.235. White, T. J., et al. 1990. PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, Page 315. doi.org/10.1002/mrd.1080280418. Supplemental photographs: Fig. 1 Symptoms of sisal black spot disease a, b, c, d showed symptoms in the field, e and f were symptoms after inoculating Neoscytalidium dimidiatum JMHB1. a, c, and e were the front of the lesions, b, d, and f were the back of the lesions. Fig. 2 Primary colony (a) and old colony (b) of Neoscytalidium dimidiatum JMHB1 Fig. 3 Arthrospores (a), conidia and chlamydospores (b) of Neoscytalidium dimidiatum JMHB1

Download Full-text

First report of Coniella castaneicola causing leaf blight on blueberry (Vaccinium virgatum) in China

Plant Disease ◽

10.1094/pdis-05-21-1122-pdn ◽

2021 ◽

Author(s):

Jiahao Lai ◽

Guihong Xiong ◽

Bing Liu ◽

Weigang Kuang ◽

Shuilin Song

Keyword(s):

Molecular Identification ◽

Morphological Characteristics ◽

Leaf Blight ◽

Yield Potential ◽

Effective Control ◽

Economic Losses ◽

Distilled Water ◽

First Report ◽

Fungal Isolates ◽

Blight Disease

Blueberry (Vaccinium virgatum), an economically important small fruit crop, is characterized by its highly nutritive compounds and high content and wide diversity of bioactive compounds (Miller et al. 2019). In September 2020, an unknown leaf blight disease was observed on Rabbiteye blueberry at the Agricultural Science and Technology Park of Jiangxi Agricultural University in Nanchang, China (28°45'51"N, 115°50'52"E). Disease surveys were conducted at that time, the results showed that disease incidence was 90% from a sampled population of 100 plants in the field, and this disease had not been found at other cultivation fields in Nanchang. Leaf blight disease on blueberry caused the leaves to shrivel and curl, or even fall off, which hindered floral bud development and subsequent yield potential. Symptoms of the disease initially appeared as irregular brown spots (1 to 7 mm in diameter) on the leaves, subsequently coalescing to form large irregular taupe lesions (4 to 15 mm in diameter) which became curly. As the disease progressed, irregular grey-brown and blighted lesion ran throughout the leaf lamina from leaf tip to entire leaf sheath and finally caused dieback and even shoot blight. To identify the causal agent, 15 small pieces (5 mm2) of symptomatic leaves were excised from the junction of diseased and healthy tissue, surface-sterilized in 75% ethanol solution for 30 sec and 0.1% mercuric chloride solution for 2 min, rinsed three times with sterile distilled water, and then incubated on potato dextrose agar (PDA) at 28°C for 5-7 days in darkness. Five fungal isolates showing similar morphological characteristics were obtained as pure cultures by single-spore isolation. All fungal colonies on PDA were white with sparse creeping hyphae. Pycnidia were spherical, light brown, and produced numerous conidia. Conidia were 10.60 to 20.12 × 1.98 to 3.11 µm (average 15.27 × 2.52 µm, n = 100), fusiform, sickle-shaped, light brown, without septa. Based on morphological characteristics, the fungal isolates were suspected to be Coniella castaneicola (Cui 2015). To further confirm the identity of this putative pathogen, two representative isolates LGZ2 and LGZ3 were selected for molecular identification. The internal transcribed spacer region (ITS) and large subunit (LSU) were amplified and sequenced using primers ITS1/ITS4 (Peever et al. 2004) and LROR/LR7 (Castlebury and Rossman 2002). The sequences of ITS region (GenBank accession nos. MW672530 and MW856809) showed 100% identity with accessions numbers KF564280 (576/576 bp), MW208111 (544/544 bp), MW208112 (544/544 bp) of C. castaneicola. LSU gene sequences (GenBank accession nos. MW856810 to 11) was 99.85% (1324/1326 bp, 1329/1331 bp) identical to the sequences of C. castaneicola (KY473971, KR232683 to 84). Pathogenicity was tested on three blueberry varieties (‘Rabbiteye’, ‘Double Peak’ and ‘Pink Lemonade’), and four healthy young leaves of a potted blueberry of each variety with and without injury were inoculated with 20 μl suspension of prepared spores (106 conidia/mL) derived from 7-day-old cultures of LGZ2, respectively. In addition, four leaves of each variety with and without injury were sprayed with sterile distilled water as a control, respectively. The experiment was repeated three times, and all plants were incubated in a growth chamber (a 12h light and 12h dark period, 25°C, RH greater than 80%). After 4 days, all the inoculated leaves started showing disease symptoms (large irregular grey-brown lesions) as those observed in the field and there was no difference in severity recorded between the blueberry varieties, whereas the control leaves showed no symptoms. The fungus was reisolated from the inoculated leaves and confirmed as C. castaneicola by morphological and molecular identification, fulfilling Koch’s postulates. To our knowledge, this is the first report of C. castaneicola causing leaf blight on blueberries in China. The discovery of this new disease and the identification of the pathogen will provide useful information for developing effective control strategies, reducing economic losses in blueberry production, and promoting the development of the blueberry industry.

Download Full-text

First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽

10.1094/pdis-94-9-1168c ◽

2010 ◽

Vol 94 (9) ◽

pp. 1168-1168

Author(s):

R. S. Trivedi ◽

J. G. Hampton ◽

J. M. Townshend ◽

M. V. Jaspers ◽

H. J. Ridgway

Keyword(s):

New Zealand ◽

Morphological Characteristics ◽

New Taxon ◽

First Report ◽

Agar Plug ◽

Carrot Seed ◽

Agar Media ◽

Leaves And Roots ◽

Seed Crops ◽

Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

Download Full-text

First Report of Black Stem of Avicennia marina Caused by Fusarium equiseti in China

Plant Disease ◽

10.1094/pdis-08-13-0873-pdn ◽

2014 ◽

Vol 98 (6) ◽

pp. 843-843 ◽

Cited By ~ 6

Author(s):

N.-H. Lu ◽

Q.-Z. Huang ◽

H. He ◽

K.-W. Li ◽

Y.-B. Zhang

Keyword(s):

Morphological Characteristics ◽

Its Region ◽

Avicennia Marina ◽

Optical Microscope ◽

Ethanol Solution ◽

Morphological Observation ◽

Fusarium Equiseti ◽

First Report ◽

Initial Symptoms ◽

Β Tubulin

Avicennia marina is a pioneer species of mangroves, a woody plant community that periodically emerges in the intertidal zone of estuarine regions in tropical and subtropical regions. In February 2013, a new disease that caused the stems of A. marina to blacken and die was found in Techeng Island of Zhanjiang, Guangdong Province, China. Initial symptoms of the disease were water-soaked brown spots on the biennial stems that coalesced so whole stems browned, twigs and branches withered, leaves defoliated, and finally trees died. This disease has the potential to threaten the ecology of the local A. marina community. From February to May 2013, 11 symptomatic trees were collected in three locations on the island and the pathogen was isolated as followed: tissues were surface disinfected with 75% ethanol solution (v/v) for 20 s, soaked in 0.1% mercuric chloride solution for 45 s, rinsed with sterilized water three times, dried, placed on potato dextrose agar (PDA), and incubated for 3 to 5 days at 28°C without light. Five isolates (KW1 to KW5) with different morphological characteristics were obtained, and pathogenic tests were done according Koch's postulates. Fresh wounds were made with a sterile needle on healthy biennial stems of A. marina, and mycelial plugs of each isolate were applied and covered with a piece of wet cotton to maintain moisture. All treated plants were incubated at room temperature. Similar symptoms of black stem were observed only on the stems inoculated the isolate KW5 after 35 days, while the control and all stems inoculated with the other isolates remained symptomless. An isolate similar to KW5 was re-isolated from the affected materials. The pathogenic test was repeated three times with the same conditions and it was confirmed that KW5 was the pathogen causing the black stem of A. marina. Hyphal tips of KW5 were transferred to PDA medium in petri dishes for morphological observation. After 48 to 72 h, white, orange, or brown flocculence patches of KW5 mycelium, 5.0 to 6.0 cm in diameter, grew. Tapering and spindle falciform macroconidia (11 to 17.3 μm long × 1.5 to 2.5 μm wide) with an obviously swelled central cell and narrow strips of apical cells and distinctive foot cells were visible under the optical microscope. The conidiogenous cells were intertwined with mycelia and the chlamydospores were globose and formed in clusters. These morphological characteristics of the isolate KW5 are characteristic of Fusarium equiseti (1). For molecular identification, the ITS of ribosomal DNA, β-tubulin, and EF-1α genes were amplified using the ITS4/ITS5 (5), T1/T2 (2), and EF1/EF2 (3) primer pairs. These sequences were deposited in GenBank (KF515650 for the ITS region; KF747330 for β-tubulin region, and KF747331 for EF-1α region) and showed 98 to 99% identity to F. equiseti strains (HQ332532 for ITS region, JX241676 for β-tubulin gene, and GQ505666 for EF-1α region). According to both morphological and sequences analysis, the pathogen of the black stem of A. marina was identified as F. equiseti. Similar symptoms on absorbing rootlets and trunks of A. marina had been reported in central coastal Queensland, but the pathogen was identified as Phytophthora sp. (4). Therefore, the disease reported in this paper differs from that reported in central coastal Queensland. To our knowledge, this is the first report of black stems of A. marina caused by F. equiseti in China. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, 1st ed. Wiley-Blackwell, Hoboken, NJ, 2006. (2) K. O'Donnell and E. Cigelnik. Mol. Phylogenet. Evol. 7:103, 1997. (3) K. O'Donnell et al. Proc. Natl. Acad. Sci. USA. 95:2044, 1998. (4) K. G. Pegg. Aust et al. Plant Pathol. 3:6, 1980. (5) A. W. Zhang et al. Plant Dis. 81:1143, 1997.

Download Full-text

First report of Leptosphaeria biglobosa ‘canadensis’ causing blackleg on oilseed rape (Brassica napus) in China

Plant Disease ◽

10.1094/pdis-12-20-2735-pdn ◽

2021 ◽

Author(s):

Tao Luo ◽

Guoqing Li ◽

Long Yang

Keyword(s):

Brassica Napus ◽

Oilseed Rape ◽

Southern China ◽

Disease Incidence ◽

Morphological Characteristics ◽

Gansu Province ◽

Bootstrap Support ◽

First Report ◽

Fungal Isolates ◽

Leptosphaeria Biglobosa

Oilseed rape (Brassica napus L.) is one of the most important oilseed crops in China. It is widely cultivated in China, with winter oilseed rape in Yangtze River basin and in southern China, and spring oilseed rape in northern China. In August 2017, a survey for Leptosphaeria spp. on spring oilseed rape was conducted in Minle county, Zhangye city, Gansu Province, China. The symptoms typical of blackleg on basal stems of oilseed rape were observed in the field. A large number of black fruiting bodies (pycnidia) were present on the lesions (Fig. 1A). The disease incidence of basal stem infection in the surveyed field was 19%. A total of 19 diseased stems were collected to isolate the pathogen. After surface sterilizing (75% ethanol for 30 s, 5% NaOCl for 60 s, followed by rinsing in sterilized water three times), diseased tissues were cultured on acidified potato dextrose agar (PDA) plates at 20°C for 7 days. Twelve fungal isolates were obtained. All fungal isolates produced typical tan pigment on PDA medium, and produced pycnidia after two weeks (Fig. 1B). Colony morphological characteristics indicated that these isolates might belong to Leptosphaeria biglobosa. To confirm identification, multiple PCR was conducted using the species-specific primers LmacF, LbigF, LmacR (Liu et al. 2006). Genomic DNA of each isolate was extracted using the cetyltrimethylammonium bromide (CTAB) method. DNA samples of L. maculans isolate UK-1 and L. biglobosa isolate W10 (Cai et al. 2015) were used as references. Only a 444-bp DNA band was detected in all 12 isolates and W10, whereas a 333-bp DNA band was detected only in the UK-1 isolate (Fig. 1C). PCR results suggested that these 12 isolates all belong to L. biglobosa. In addition, the internal transcribed spacer (ITS) region of these 12 isolates was analyzed for subspecies identification (Vincenot et al. 2008). Phylogenetic analysis based on ITS sequence showed that five isolates (Lb1134, Lb1136, Lb1138, Lb1139 and Lb1143) belonged to L. biglobosa ‘brassicae’ (Lbb) with 78% bootstrap support, and the other seven isolates (Lb1135, Lb1137, Lb1140, Lb1141, Lb1142, Lb1144 and Lb1145) belonged to L. biglobosa ‘canadensis’ (Lbc) with 95% bootstrap support (Fig. 1D). Two Lbb isolates (Lb1134 and Lb1136) and two Lbc isolates (Lb1142 and Lb1144) were randomly selected for pathogenicity testing on B. napus cultivar Zhongshuang No. 9 (Wang et al. 2002). Conidial suspensions (10 μL, 1 × 107 conidia mL-1) of these four isolates were inoculated on needle-wounded cotyledons (14-day-old seedling), with 10 cotyledons (20 wounded sites) per isolate. A further 10 wounded cotyledons were inoculated with water and served as controls. Seedlings were maintained in a growth chamber at 20°C with 100% relative humidity and a 12-h photoperiod. After 7 days, cotyledons inoculated with the four isolates showed necrotic lesions in the inoculated wounds. Control cotyledons had no symptoms (Fig. 2). Fungi re-isolated from the infected cotyledons showed similar colony morphology as the original isolates. Therefore, L. biglobosa ‘brassicae’ and L. biglobosa ‘canadensis’ appear to be the pathogens causing the observed blackleg symptoms on spring oilseed rape in Gansu, China. In previous studies, L. biglobosa ‘brassicae’ has been found in many crops in China, including oilseed rape (Liu et al. 2014; Cai et al. 2015), Chinese radish (Raphanus sativus) (Cai et al. 2014a), B. campestris ssp. chinensis var. purpurea (Cai et al. 2014b), broccoli (B. oleracea var. italica) (Luo et al. 2018), ornamental kale (B. oleracea var. acephala) (Zhou et al. 2019a), B. juncea var. multiceps (Zhou et al. 2019b), B. juncea var. tumida (Deng et al. 2020) and Chinese cabbage (B. rapa subsp. pekinensis) (Yu et al. 2021 accepted). To the best of our knowledge, this is the first report of L. biglobosa ‘canadensis’ causing blackleg on B. napus in China.

Download Full-text

First report of Curvularia plantarum causing leaf spot on sweet potato (Ipomoea batatas) in China

Plant Disease ◽

10.1094/pdis-08-21-1665-pdn ◽

2021 ◽

Author(s):

Jiahao Lai ◽

Tongke Liu ◽

Bing Liu ◽

Weigang Kuang ◽

Shuilin Song

Keyword(s):

Sweet Potato ◽

Molecular Identification ◽

Leaf Spot ◽

Ipomoea Batatas ◽

Morphological Characteristics ◽

Distilled Water ◽

Gene Sequences ◽

First Report ◽

Potted Plants ◽

Fungal Isolates

Sweet potato [Ipomoea batatas (L.) Lam], is an extremely versatile vegetable that possesses high nutritional values. It is also a valuable medicinal plant having anti-cancer, antidiabetic, and anti-inflammatory activities. In July 2020, leaf spot was observed on leaves of sweet potato in Nanchang, China (28°45'51"N, 115°50'52"E), which affected the growth and development of the crop and caused tuberous roots yield losses of 25%. The disease incidence (total number of diseased plants / total number of surveyed plants × 100%) was 57% from a sampled population of 100 plants in the field. Symptomatic plants initially exhibited small, light brown, irregular-shaped spots on the leaves, subsequently coalescing to form large irregular brown lesions and some lesions finally fell off. Fifteen small pieces (each 5 mm2) of symptomatic leaves were excised from the junction of diseased and healthy tissue, surface sterilized in 75% ethanol solution for 30 sec and 0.1% mercuric chloride solution for 2 min, rinsed three times with sterile distilled water and incubated on potato dextrose agar (PDA) plates at 28°C in darkness. A total of seven fungal isolates with similar morphological characteristics were obtained as pure cultures by single-spore isolation. After 5 days of cultivation at 28°C, dark brown or blackish green colonies were observed, which developed brown, thick-walled, simple, or branched, and septate conidiophores. Conidia were 18.28 to 24.91 × 7.46 to 11.69 µm (average 21.27 × 9.48 µm, n = 100) in size, straight or slightly curved, middle cell unequally enlarged, brown to dark brown, apical, and basal cells slightly paler than the middle cells, with three septa. Based on morphological characteristics, the fungal isolates were suspected to be Curvularia plantarum (Raza et al. 2019). To further confirm the identification, three isolates (LGZ1, LGZ4 and LGZ5) were selected for molecular identification. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and translation elongation factor 1-alpha (EF1-α) genes were amplified and sequenced using primers ITS1/ITS4 (Peever et al. 2004), gpd1/gpd2 (Berbee et al. 1999), EF-983F/EF-2218R (Rehner and Buckley 2005), respectively. The sequences of ITS region of the three isolates (accession nos. MW581905, MZ209268, and MZ227555) shared 100% identity with those of C. plantarum (accession nos. MT410571-72, MN044754-55). Their GAPDH gene sequences were identical (accession nos. MZ224017-19) and shared 100% identity with C. plantarum (accession nos. MN264120, MT432926, and MN053037-38). Similarly, EF1-α gene sequences were identical (accession nos. MZ224020-22) and had 100% identity with C. plantarum (accession nos. MT628901, MN263982-83). A maximum likelihood phylogenetic tree was built based on concatenated data from the sequences of ITS, GAPDH, and EF-1α by using MEGA 5. The three isolates LGZ1, LGZ4, and LGZ5 clustered with C. plantarum. The fungus was identified as C. plantarum by combining morphological and molecular characteristics. Pathogenicity tests were conducted by inoculating a conidial suspension (106 conidia/ml) on three healthy potted I. batatas plants (five leaves wounded with sterile needle of each potted plant were inoculated). In addition, fifteen wounded leaves of three potted plants were sprayed with sterile distilled water as a control. All plants were maintained in a climate box (12 h light/dark) at 25°C with 80% relative humidity. All the inoculated leaves started showing light brown flecks after 7 days, whereas the control leaves showed no symptoms. The pathogenicity test was conducted three times. The fungus was reisolated from all infected leaves of potted plants and confirmed as C. plantarum by morphological and molecular identification, fulfilling Koch’s postulates. To our knowledge, this is the first report of C. plantarum causing leaf spot on sweet potato in China. The discovery of this new disease and the identification of the pathogen will contribute to the disease management, provide useful information for reducing economic losses caused by C. plantarum, and lay a foundation for the further research of resistance breeding.

Download Full-text

First Report of Pestalotiopsis mangiferae and P. vismiae Causing Twig Dieback of Myrica rubra in China

Plant Disease ◽

10.1094/pdis-12-11-1054-pdn ◽

2012 ◽

Vol 96 (4) ◽

pp. 588-588 ◽

Cited By ~ 6

Author(s):

F. Y. Chen ◽

L. M. Lu ◽

H. Z. Ni ◽

Y. Wang ◽

Y. G. Wang ◽

...

Keyword(s):

Basal Cell ◽

Southern China ◽

Apical Cell ◽

Morphological Characteristics ◽

Fluorescent Light ◽

Water Control ◽

First Report ◽

Myrica Rubra ◽

Potted Plants ◽

Detached Leaves

Chinese bayberry (Myrica rubra Siebold & Zucc.), an evergreen fruit tree, is widely grown in southern China. In 1999, severe twig dieback was observed on M. rubra in Taizhou and it spread to several major M. Rubra-producing areas of Zhejiang covering more than 6,000 ha by 2011. Symptoms were usually observed from June to November and first appeared as chlorosis of leaves and leaf drop, followed by the formation of dark brown lesions covered with white mycelia surrounding leaf scars. The lesions can extend to the whole twig and tree causing discoloration of the xylem. In most cases, infected trees die within 1 to 4 years. Two distinct fungi totaling 46 isolates were isolated from the surface-disinfested diseased twigs and cultured on potato dextrose agar (PDA) at 28°C. An isolate of each fungus, designated as C1 and B1, was characterized further following 10 days of growth on PDA at 28°C. C1 formed zonate, white colonies and black, acervular conidiomata with the conidia aggregated on acervuli as a creamy mass. Isolate B1 formed nonzonate, white colonies and black, acervular conidiomata with the conidia aggregated on acervuli as droplets. Conidia for each isolate were fusiform with five cells; one hyaline apical cell, one hyaline basal cell, and three, dark brown median cells. Conidia ranged from 17.8 to 25.2 × 6.7 to 9.2 μm for C1 and 21.2 to 27.8 × 4.3 to 7.5 μm for B1. There were two to three hyaline, filamentous appendages (9.8 to 23.5 μm long for C1 and 10.5 to 25.5 μm long for B1) attached to each apical cell, and one hyaline appendage (3.5 to 7.2 μm long for C1 and 3.0 to 6.8 μm long for B1) attached to each basal cell. The cultural and morphological characteristics of C1 (16 isolates) matched the description for Pestalotiopsis mangiferae while B1 (27 isolates) matched the description for P. vismiae (2). The PCR-amplified and sequenced internal transcribed spacer (ITS) region of the ribosomal DNA (ITS1-5.8S-ITS2) for isolate C1 (GenBank Accession No. JQ281542) and B1 (GenBank Accession No. JQ281543) were 99 and 100% homologous to that of the P. mangiferae isolate MM 102 (GenBank Accession No. GU722595) and P. vismiae isolate xsd08116 (GenBank Accession No. FJ481027), respectively. For pathogenicity tests, nine healthy detached leaves and 12 potted plants of M. rubra were wound inoculated with sterile water (control) or conidial suspensions (105 conidia per ml; 20 μl on each site) of C1 and B1, respectively, and maintained with relative humidity of more than 90% under fluorescent light at 28°C. Tests were performed twice. Necrotic lesions, resembling those that occurred in the field, were observed on all inoculated detached leaves and 33.3% of C1 and 25% of B1 inoculated potted plants 10 and 30 days following inoculation, respectively, while the controls remained healthy. Two fungi were reisolated from the lesions with identical morphology to the initial C1 and B1 inoculums. Therefore, P. mangiferae and P. vismiae were determined to be the causal agent for twig dieback of M. rubra in China. Pestalotiopsis spp. were previously reported as pathogens of loquat (4), mango (3), and blueberry (1) causing economic loss. To our knowledge, this is the first report of twig dieback disease of M. rubra caused by P. mangiferae and P. vismiae. References: (1) J. G. Espinoza et al. Plant Dis. 92:1407, 2008. (2) Q. X. Ge et al. Flora Fungorum Sinicorum. Vol. 38, Pestalotiopsis. Science Press, Beijing, 2009. (3). Y. Ko et al. Plant Dis. 91:1684, 2007. (4). A. E. Perelló and S. Larran. Plant Dis. 83:695, 1999.

Download Full-text

First Report of Multiple Species of the Botryosphaeriaceae Causing Bot Canker Disease of Indian Laurel-Leaf Fig in California

Plant Disease ◽

10.1094/pdis-08-11-0714 ◽

2012 ◽

Vol 96 (3) ◽

pp. 459-459 ◽

Cited By ~ 7

Author(s):

J. S. Mayorquin ◽

A. Eskalen ◽

A. J. Downer ◽

D. R. Hodel ◽

A. Liu

Keyword(s):

Los Angeles ◽

Fungal Pathogens ◽

Southern California ◽

Morphological Characteristics ◽

Vascular Lesion ◽

Site Location ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Nattrassia Mangiferae ◽

Β Tubulin

Indian laurel-leaf fig (Ficus microcarpa L.) is a commonly used indoor and outdoor ornamental tree. F. microcarpa is most frequently encountered as lining city streets, especially in warmer southern California climates. A disease known as ‘Sooty Canker,' caused by the fungus Nattrassia mangiferae (Syd. & P. Syd) B. Sutton & Dyko, is particularly devastating on F. microcarpa. Disease symptoms are characterized by branch dieback, crown thinning, and if the disease progresses to the trunk, eventual tree death (2). Recent taxonomic revisions have renamed Nattrassia mangiferae as Neofusicoccum mangiferae (Syd. & P. Syd.) Crous, Slippers & A. J. L. Phillips (1). An initial survey conducted during the spring of 2011 across four cities in Los Angeles County included, Culver City, Lakewood, Santa Monica, and Whittier. Five symptomatic branches per city were collected from trees showing branch cankers and dieback. Pieces of symptomatic tissue (2 mm2) were plated onto one-half-strength potato dextrose agar. Most isolates initially identified by morphological characteristics, such as growth pattern, speed of growth, and colony color, resembled those in the Botryosphaeriaceae (4). Two representative isolates from each site location were sequenced. Sequences obtained from amplification of the internal transcribed spacer region (ITS1-5.8rDNA-ITS2) and the β-tubulin gene were compared in a BLAST search in GenBank. Results identified isolates as Botryosphaeria dothidea (identity of 99% to EF638767 and 100% to JN183856.1 for ITS and β-tubulin, respectively); Neofusicoccum luteum (100% to EU650669 and 100% to HQ392752); N. mediterraneum (100% to HM443605 and 99% to GU251836); and N. parvum (100% to GU188010 and 100% to HQ392766) and have been deposited in GenBank with the following accession numbers: JN543668 to JN543671 (ITS) and JQ080549 to JQ080552 (β-tubulin). Pathogenicity tests were conducted in the greenhouse on 6-month-old F. microcarpa with one isolate from each previously listed fungal species. Five plants per isolate were stem-wound inoculated with mycelial plugs and wrapped with Parafilm. Uncolonized agar plugs were used as a control. Inoculations were later repeated a second time in the same manner for a total of 10 plants per isolate. Plants were observed for 6 weeks and destructively sampled to measure vascular lesion lengths. Mean vascular lesion lengths were 26, 22, 54, and 46 mm for B. dothidea, N. luteum, N. mediterraneum, and N. parvum, respectively. The mean lesion lengths for all isolates were significantly different (P = 0.05) from the control. Each species was consistently recovered from inoculated plants, except the control, thus fulfilling Koch's postulates. To our knowledge, this is the first report on the pathogenicity of multiple Botryosphaeriaceae species causing branch canker and dieback on F. microcarpa in California. These results are significant since trees along sidewalks in southern California are often crowded and undergo extensive root and branch pruning and some Botryosphaeriaceae spp. are known to enter its host through wounds caused by pruning or mechanical injury (2,3). Further sampling is imperative to better assess the distribution of these canker-causing fungal pathogens on F. microcarpa. References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) D. R. Hodel et al. West. Arborist 35:28, 2009. (3) V. McDonald et al. Plant Dis. 93:967, 2009. (4) B. Slippers et al. Fungal Biol. Rev. 21:90, 2007.

Download Full-text

First Report of Fusarium Maize Ear Rot Caused by Fusarium kyushuense in China

Plant Disease ◽

10.1094/pdis-05-13-0558-pdn ◽

2014 ◽

Vol 98 (2) ◽

pp. 279-279 ◽

Cited By ~ 2

Author(s):

J.-H. Wang ◽

H.-P. Li ◽

J.-B. Zhang ◽

B.-T. Wang ◽

Y.-C. Liao

Keyword(s):

Fusarium Species ◽

Morphological Characteristics ◽

Distilled Water ◽

Ear Rot ◽

Tubulin Gene ◽

Average Growth ◽

First Report ◽

Maize Ear Rot ◽

Maize Ear ◽

Β Tubulin

From September 2009 to October 2012, surveys to determine population structure of Fusarium species on maize were conducted in 22 provinces in China, where the disease incidence ranged from 5 to 20% in individual fields. Maize ears with clear symptoms of Fusarium ear rot (with a white to pink- or salmon-colored mold at the ear tip) were collected from fields. Symptomatic kernels were surface-sterilized (1 min in 0.1% HgCl2, and 30 s in 70% ethanol, followed by three rinses with sterile distilled water), dried, and placed on PDA. After incubation for 3 to 5 days at 28°C in the dark, fungal colonies displaying morphological characteristics of Fusarium spp. (2) were purified by transferring single spores and identified to species level by morphological characteristics (2), and DNA sequence analysis of translation elongation factor-1α (TEF) and β-tubulin genes. A large number of Fusarium species (mainly F. graminearum species complex, F. verticillioides, and F. proliferatum) were identified. These Fusarium species are the main causal agents of maize ear rot (2). Morphological characteristics of six strains from Anhui, Hubei, and Yunnan provinces were found to be identical to those of F. kyushuense (1), which was mixed with other Fusarium species in the natural infection in the field. Colonies grew fast on PDA with reddish-white and floccose mycelia. The average growth rate was 7 to 9 mm per day at 25°C in the dark. Reverse pigmentation was deep red. Microconidia were obovate, ellipsoidal to clavate, and 5.4 to 13.6 (average 8.8) μm in length. Macroconidia were straight or slightly curved, 3- to 5-septate, with a curved and acute apical cell, and 26.0 to 50.3 (average 38.7) μm in length. No chlamydospores were observed. Identity of the fungus was further investigated by sequence comparison of the partial TEF gene (primers EF1/2) and β-tubulin gene (primers T1/22) of one isolate (3). BLASTn analysis of the TEF amplicon (KC964133) and β-tubulin gene (KC964152) obtained with cognate sequences available in GenBank database revealed 99.3 and 99.8% sequence identity, respectively, to F. kyushuense. Pathogenicity tests were conducted twice by injecting 2 ml of a prepared spore suspension (5 × 105 spores/ml) into maize ears (10 per isolate of cv. Zhengdan958) through silk channel 4 days post-silk emergence under field conditions in Wuhan, China. Control plants were inoculated with sterile distilled water. The ears were harvested and evaluated 30 days post-inoculation. Reddish-white mold was observed on inoculated ears and the infected kernels were brown. No symptoms were observed on water controls. Koch's postulates were fulfilled by re-isolating the pathogen from infected kernels. F. kyushuense, first described on wheat in Japan (1), has also been isolated from rice seeds in China (4). It was reported to produce both Type A and Type B trichothecene mycotoxins (1), which cause toxicosis in animals. To our knowledge, this is the first report of F. kyushuense causing maize ear rot in China and this disease could represent a serious risk of yield losses and mycotoxin contamination in maize and other crops. The disease must be considered in existing disease management practices. References: (1) T. Aoki and K. O'Donnell. Mycoscience 39:1, 1998. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006. (3) F. Van Hove et al. Mycologia 103:570, 2011. (4) Z. H. Zhao and G. Z. Lu. Mycotaxon 102:119, 2007.

Download Full-text

First Report of Alternaria heveae Causing Black Leaf Spot of Rubber Tree in China

Plant Disease ◽

10.1094/pdis-01-14-0065-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1011-1011 ◽

Cited By ~ 1

Author(s):

Z. Y. Cai ◽

Y. X. Liu ◽

G. X. Huang ◽

M. Zhou ◽

G. Z. Jiang ◽

...

Keyword(s):

Rubber Tree ◽

Morphological Characteristics ◽

Black Spot ◽

Its Region ◽

Post Inoculation ◽

First Report ◽

Leaf Spots ◽

Plastic Bags ◽

Manual Pressure ◽

Tree Leaf

Rubber tree (Hevea brasiliensis Muell. Arg.) is an important industrial crop of tropical areas for natural rubber production. In October 2013, foliar spots (0.1 to 0.4 mm in diameter), black surrounded by a yellow halo, and with lesions slightly sunken were observed on the rubber tree leaf in a growing area in Heikou County of Yunnan Province. Lesion tissues removed from the border between symptomatic and healthy tissue were surface sterilized in 75% ethanol and air-dried, plated on PDA plates, and incubated at 28°C with alternating day/night cycles of light. The pathogen was observed growing out of many of the leaf pieces, and produced abundant conidia. Colonies 6.1 cm in diameter developed on potato carrot agar (PCA) after 7 days, with well-defined concentric rings of growth. Colonies on PCA were composed of fine, dark, radiating, surface and subsurface hyphae. Conidia produced in PCA culture were mostly solitary or in short chains of 2 to 5 spores, long ovoid to clavate, and light brown, 40 to 81.25 × 8 to 20 μm (200 colonies were measured), with 3 to 6 transverse septa and 0 to 2 longitudinal or oblique septa. Morphological characteristics were similar to those described for Alternaria heveae (3,4). A disease of rubber tree caused by Alternaria sp. had been reported in Mexico in 1947 (2). DNA of Ah01HK13 isolate was extracted for PCR and sequencing of the ITS region with ITS1 and ITS4 primers was completed. From the BLAST analysis, the sequence of Ah01HK13 (GenBank Accession No. KF953884), had 97% similarity to A. dauci, 96% identical to A. macrospora (AY154701.1 and DQ156342.1, respectively), indicating the pathogen belonged to Alternaria genus. According to morphological characteristics, this pathogen was identified as A. heveae. Pathogenicity of representative isolate, Ah01HK13 was confirmed using a field rubber tree inoculation method. Three rubber plants (the clone of rubber tree Yunyan77-4) were grown to the copper-colored leaf stage and inoculated by spraying spore suspension (concentration = 104 conidia/ml) to the copper-colored leaves until drops were equally distributed on it using manual pressure sprayer. Three rubber plants sprayed with sterile distilled water were used as controls. After inoculation, the plants were covered with plastic bags. The plastic bags were removed after 2 days post-inoculation (dpi) and monitored daily for symptom development (1). The experiment was repeated three times. The typical 0.1 to 0.4 mm black leaf spots were observed 7 dpi. No symptoms were observed on control plants. A fungus with the same colony and conidial morphology as A. heveae were re-isolated from leaf lesions on inoculated rubber plants, but not from asymptomatic leaves of control plants, fulfilling Koch's postulates. Based on these results, the disease was identified as black spot of rubber tree caused by A. heveae. To our knowledge, this is the first report of A. heveae on rubber tree in China. References: (1) Z. Y. Cai et al. Microbiol Res. 168:340, 2013. (2) W. J. Martin. Plant Dis. Rep. 31:155, 1947. (3) E. G. Simmons. Mycotaxon 50:262, 1994. (4) T. Y. Zhang. Page 111 in: Flora Fungorum Sinicorum: Alternaria, Science Press, Beijing, 2003.

Download Full-text

First report of Fusarium incarnatum causing fruit rot of litchi in China

Plant Disease ◽

10.1094/pdis-11-20-2393-pdn ◽

2021 ◽

Author(s):

Zhaoyin Gao ◽

Jiaobao Wang ◽

Zhengke Zhang ◽

Min Li ◽

Deqiang Gong ◽

...

Keyword(s):

Southern China ◽

Fusarium Species ◽

Morphological Characteristics ◽

Fruit Rot ◽

Conidial Suspension ◽

Single Spore ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Litchi Fruit ◽

His3 Gene

Litchi (Litchi chinensis Sonn.) is an indigenous tropical and subtropical fruit in Southern China with an attractive appearance, delicious taste, and good nutritional value (Jiang et al. 2003). In March 2020, brown rots were observed on nearly ripe litchi fruits (cv. Guihuaxiang) in an orchard of Lingshui county, Hainan province of China (18.615877° N, 109.948871° E). About 5% fruits were symptomatic in the field, and the disease caused postharvest losses during storage. The initial infected fruits had no obvious symptoms on the outer pericarp surfaces, but appeared irregular, brown to black-brown lesions in the inner pericarps around the pedicels. Then lesions expanded and became brown rots. Small tissues (4 mm × 4 mm) of fruit pericarps were cut from symptomatic fruits, surface-sterilized in 1% sodium hypochlorite for 3 min, rinsed in sterilized water three times, plated on potato dextrose agar (PDA) and incubated at 28℃ in the darkness. Morphologically similar colonies were isolated from 85% of 20 samples after 4 days of incubation. Ten isolates were purified using a single-spore isolation method. The isolates grown on PDA had abundant, fluffy, whitish to yellowish aerial mycelia, and the reverse side of the Petri dish was pale brown. Morphological characteristics of conidia were further determined on carnation leaf-piece agar (CLA) (Leslie et al. 2006). Macroconidia were straight to slightly curved, 3- to 5-septates with a foot-shaped basal cell, tapered at the apex, 2.70 to 4.43 µm × 18.63 to 37.58 µm (3.56 ± 0.36 × 28.68 ± 4.34 µm) (n = 100). Microconidia were fusoid to ovoid, 0- to 1-septate, 2.10 to 3.57 µm × 8.18 to 18.20 µm (2.88 ± 0.34 × 11.71 ± 1.97 µm) (n = 100). Chlamydospores on hyphae singly or in chains were globose, subglobose, or ellipsoidal. Based on cultural features and morphological characteristics, the fungus was identified as a Fusarium species (Leslie et al. 2006). To further confirm the pathogen, DNA was extracted from the 7-day-old aerial mycelia of three isolates (LZ-1, LZ-3, and LZ-5) following Chohan et al. (2019). The sequences of the internal transcribed spacer region of rDNA (ITS), translation elongation factor-1 alpha (tef1) gene, and histone H3 (his3) gene were partially amplified using primers ITS1/ITS4, EF1-728F/EF1-986R, and CYLH3F/CYLH3R, respectively (Funnell-Harris et al. 2017). The nucleotide sequences were deposited in GenBank (ITS: 515 bp, MW029882, 533 bp, MW092186, and 465 bp, MW092187; tef1: 292 bp, MW034437, 262 bp, MW159143, and 292 bp, MW159141; his3: 489 bp, MW034438, 477 bp, MW159142, and 474 bp, MW159140). The ITS, tef1, and his3 genes showed 99-100% similarity with the ITS (MH979697), tef1 (MH979698), and his3 (MH979696) genes, respectively of Fusarium incarnatum (TG0520) from muskmelon fruit. The phylogenetic analysis of the tef1 and his3 gene sequences showed that the three isolates clustered with F. incarnatum. Pathogenicity tests were conducted by spraying conidial suspension (1×106 conidia/ml) on wounded young fruits in the orchid. Negative controls were sprayed with sterilized water. Fruits were bagged with polythene bags for 24 hours and then unbagged for 10 days. Each treatment had 30 fruits. The inoculated fruits developed symptoms similar to those observed in the orchard and showed light brown lesions on the outer pericarp surfaces and irregular, brown to black-brown lesions in the inner pericarps, while the fruits of negative control remained symptomless. The same fungus was successfully recovered from symptomatic fruits, and thus, the test for the Koch’s postulates was completed. F. semitectum (synonym: F. incarnatum) (Saha et al. 2005), F. oxysporum (Bashar et al. 2012), and F. moniliforme (Rashid et al. 2015) have been previously reported as pathogens causing litchi fruit rots in India and Bangladesh. To our knowledge, this is the first report of Fusarium incarnatum causing litchi fruit rot in China.

Download Full-text