First Report of Root-Knot Nematodes (Meloidogyne spp.) on Sunflowers in Mozambique

Sunflower (Helianthus annuus L.) recently was reintroduced to Mozambique because of renewed interest in oil-seed production for domestic consumption. In April 1997, disease surveys were carried out in two fields in southern Mozambique (Maputo region). Several plants of Pan 735, a South African cultivar, showed yellowing of the leaves and stunting. These plants wilted during the day but recovered their turgidity at night. Diseased plants were easily pulled from the soil due to almost complete destruction of the root system. Numerous galls were found on affected roots, compared with healthy plants. Meloidogyne javanica (Treub) Chitwood and M. incognita (Kofoid & White) Chitwood were identified by M. Di Vito (personal communication) based on 20 female perineal patterns observed with a light microscope. M. incognita was more prevalent than M. javanica. Also observed were Alternaria helianthi (Hansf.) Tubaki & Nishihara and Sclerotium bataticola Taub. Root-knot nematodes (Meloidogyne spp.), common on sunflower, cause severe damage and reduce both seed yield and seed oil content (1). These two nematode species have also been observed on sunflower in other African countries (Zambia, South Africa, Egypt) but this is the first report of root-knot nematode on sunflower in Mozambique. Reference: (1) M. Di Vito et al. Nematol. Medit. 24:109, 1996.

Download Full-text

First Report of the Root-Knot Nematode Meloidogyne floridensis on Tomato (Lycopersicon esculentum) in Florida

Plant Disease ◽

10.1094/pd-89-0527b ◽

2005 ◽

Vol 89 (5) ◽

pp. 527-527

Author(s):

G. T. Church

Keyword(s):

Lycopersicon Esculentum ◽

Field Experiments ◽

The United States ◽

The State ◽

Bromophenol Blue ◽

Root Knot Nematode ◽

Fresh Market ◽

Root Knot Nematodes ◽

First Report ◽

Meloidogyne Spp

The state of Florida is the largest producer of fresh market tomato (Lycopersicon esculentum L.) in the United States with 2003 yields of 634 million kg on 17,700 ha valued at 516 million dollars. Effective crop management is essential for production of vegetables in Florida because of the presence of intense pest pressure. The identification of the pests present is the first step in the development of a successful IPM (integrated pest management) program. Root-knot nematodes (Meloidogyne spp.) are common nematodes that parasitize vegetables in Florida and cause significant yield reductions when not properly managed. In 2003 field experiments, soil was collected from two research farms in Saint Lucie and Seminole counties in Florida. Galling caused by root-knot nematode was observed on tomato at both locations. Since females suitable for identification are difficult to obtain from field-grown roots, field soil was placed in pots in the greenhouse and planted with Lycopersicon esculentum cv. Rutgers. Standard morphological techniques, differential host tests, and isozyme phenotypes were used in nematode identification. Female root-knot nematodes were extracted from tomato roots and placed in extraction buffer (10% wt/vol sucrose, 2% vol/vol Triton X-100, 0.01% wt/vol bromophenol blue). The females were crushed, loaded on a polyacrylamide gel, and separated by electrophoresis using the PhastSystem (Amersham Biosciences, Piscataway, NJ). The activities of malate dehydrogenase and esterase enzymes were detected using standard techniques. Isozyme phenotypes consistent with Meloidogyne incognita (Kofoid and White) Chitwood and M. javanica (Treub) Chitwood as well as with the newly described M. floridensis Handoo (1) were observed at both locations. To our knowledge, this is the first report of M. floridensis naturally occurring on tomato in Florida. The identification and distribution of M. floridensis in vegetable production fields is important for disease management throughout the state since the host range is likely different from other Meloidogyne spp. Reference: (1) Z. A. Handoo et al. J. Nematol. 36:20, 2004.

Download Full-text

First Report of the Root Knot Nematode, Meloidogyne inornata, on Common Bean in Paraná State, Brazil

Plant Disease ◽

10.1094/pdis-09-12-0832-pdn ◽

2013 ◽

Vol 97 (3) ◽

pp. 431-431 ◽

Cited By ~ 3

Author(s):

A. C. Z. Machado ◽

O. F. Dorigo ◽

D. Mattei

Keyword(s):

Common Bean ◽

Nematode Species ◽

State University ◽

Root Knot Nematode ◽

First Report ◽

North Carolina State University ◽

Adult Females ◽

Bean Plants ◽

Meloidogyne Spp ◽

Species Specific

Common bean (Phaseolus vulgaris F.) is one of the most important crops in Paraná State, which is responsible for almost 10% of the Brazilian production (4). Root knot nematodes, Meloidogyne spp., are common parasites of this crop worldwide, but damage caused by Meloidogyne inornata has not been reported. During a survey of nematode species present on common bean fields in Paraná State, Brazil, galled root samples of cultivars Tuiuiú and Eldorado were submitted, in June 2012, in the Nematology Laboratory from IAPAR, collected in the municipalities of Araucária (25°35′34″S, 49°24′36″W) and Santana do Itararé (23°45′18″S, 49°37′44″W). Plants did not exhibit any above-ground symptoms. The specimens were identified through perineal patterns and esterase phenotypes of 20 adult females extracted from dissected roots (2,3). The population densities observed in the samples were 140 and 700 J2 and eggs per gram of roots, respectively, for both samples. Characteristics were consistent with those described for M. inornata. For example, perineal patterns of M. inornata showed a high dorsal arch, with smooth to wavy striae, similar to those of M. incognita; but no punctate markings between anus and tail terminus were observed. However, from the esterase electrophoresis we obtained the I3 (Rm = 0.83, 1.15, and 1.32) phenotype, typical of M. inornata, a species-specific phenotype used to differentiate this species from M. incognita (1). Moreover, the excretory pore of adult females was located 32.1 (± 5.4) μm from the anterior end, consistent with the M. inornata description (25 to 53 μm) (1). To the best of our knowledge, this is the first report of M. inornata parasitizing common bean roots. This finding has great importance for Brazilian agriculture, since this nematode may damage common bean plants and become an additional problem for this crop. Additional work is necessary in order to elucidate the losses caused by M. inornata on common bean. References: (1) R. M. D. G. Carneiro et al. Nematology 10:123, 2008. (2) P. R. Esbenshade and A. C. Triantaphyllou J. Nematol. 22:10, 1990. (3) K. M. Hartman and J. N. Sasser. Page 115 in: An Advanced Treatise on Meloidogyne, Volume II Methodology. K. R. Barker et al., eds. Raleigh: North Carolina State University Graphics, 1985. (4) MAPA. Feijão, Ministério da Agricultura, Brasil. Retrieved from http://www.agricultura.gov.br/vegetal/culturas/feijao September 05, 2012.

Download Full-text

First Report of Meloidogyne graminicola Infecting Banana in China

Plant Disease ◽

10.1094/pdis-08-14-0810-pdn ◽

2015 ◽

Vol 99 (3) ◽

pp. 420-420 ◽

Cited By ~ 2

Author(s):

X. Zhou ◽

G. K. Liu ◽

S. Xiao ◽

S. S. Zhang

Keyword(s):

Natural Infection ◽

Its Region ◽

Nematode Species ◽

Original Description ◽

Root Surface ◽

Mature Female ◽

Root Knot Nematode ◽

Population Densities ◽

Root Knot Nematodes ◽

First Report

Bananas (Musa spp.) are one of world's most popular fruits, and China is the third largest banana-producing country in the world. Root-knot nematodes, Meloidogyne spp., are common pests of banana worldwide, but damage to this crop caused by M. graminicola has not been reported up to now. During a survey of root-knot nematode species infecting banana in Fujian Province, China, swollen, galled primary and secondary root samples of Musa nana cv. Tianbao (AAA) were collected from two commercial fields in Nanjing County in May 2013. The affected plants did not exhibit obvious above-ground symptoms. Seriously infected roots were malformed and dehiscent, with the tissue discolored and rotting. Examination of symptomatic roots revealed one to several females of Meloidogyne sp. within each gall, with egg masses that were often completely embedded within the gall without protruding through the root surface, and with second-stage juveniles (J2) hatched inside the galls. Population densities of this nematode ranged from 452 to 2,056 eggs and J2 per 5 g of fresh roots. Males were rarely observed. Morphological measurements of 25 females and 20 J2 matched the original description of M. graminicola (1). The perineal patterns of females were dorsoventrally ovoid, with low to moderately high and round dorsal arches and lacking obvious lateral lines; striae were smooth and some were broken by a few obvious irregular, zig-zag striae in the dorsal part of the pattern; phasmids were close together (13.1 to 19.7 μm). The J2 had long tapered tails (63.4 to 75.5 μm), with long narrow hyalines (13.1 to 19.9 μm) and marked clavate termini. DNA was extracted from one mature female. The ITS1-5.8S-ITS2 rDNA region was amplified with V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (2) and the COII and IRNA mtDNA genes were amplified with C2F3/MRH106 (GGTCAATG TTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTAGT) (3) and then sequenced. The sequences were subjected to a database search using BLAST to verify the identity. Sequences from the ITS region were 788 bp (GenBank Accession Nos. KM111531 and KM236560) and were 96.8 to 99.1% identical to the known sequences of M. graminicola in Genbank. Sequences from the mtDNA were 666 bp (KM111533 and KM236559) and showed 99.1 to 99.4% homology with the known sequences of M. graminicola (KJ139963 and HG529223). In glasshouse tests, banana plantlets (M. nana cv. Tianbao) about 20 cm high were transplanted in 25-cm-diameter pots and inoculated with 5,000 J2 of each collected population of M. graminicola replicated six times; a noninoculated control was included. After 15 weeks, all inoculated plants were stunted and chlorotic. Galling symptoms on roots were similar to those in the field, and dissection of galled root tissue revealed that different life stages of the nematode were present, with population densities ranging from 1,238 to 6,562 eggs and J2 per 5 g of fresh roots. The noninoculated control plants grew well and had no galling symptoms on the roots. These results confirmed the nematodes' pathogenicity on banana. On the basis of these results, the root-knot nematodes isolated from banana in Nanjing County were confirmed as M. graminicola. To our knowledge, this is the first report of a natural infection of banana with M. graminicola. References: (1) A.M. Golden and W. Birchfield. Plant Dis. Rep. 52:423, 1968. (2) T. C. Vrain et al. Fund. Appl. Nematol. 15:565, 1992. (3) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004.

Download Full-text

First Report of Root-Knot Nematode Meloidogyne javanica on Chrysanthemum in Colombia

Plant Disease ◽

10.1094/pd-90-0828a ◽

2006 ◽

Vol 90 (6) ◽

pp. 828-828 ◽

Cited By ~ 2

Author(s):

P. A. Agudelo ◽

S. A. Lewis ◽

M. A. Abril

Keyword(s):

Morphological Characteristics ◽

Meloidogyne Javanica ◽

Nematode Species ◽

Wide Distribution ◽

Economic Losses ◽

Cut Flower ◽

Root Knot Nematode ◽

Root Knot Nematodes ◽

First Report ◽

Phenotype Analysis

Severe plant stunting, chlorosis, and extensive root galling were observed on chrysanthemum (Dendrathema grandiflora cv. Yellow Vero) in a commercial cut-flower production facility in Rionegro, Antioquia, northwestern Colombia. Examination of the root samples from selected infected plants revealed the presence of abundant root-knot nematodes. Juveniles, males, and females were extracted for species identification using morphological characteristics. Identification was confirmed by perineal patterns and esterase phenotype analysis of females. All methods of identification were consistent with typical Meloidogyne javanica. No other root-knot nematode species were found on this farm, but the presence of other Meloidogyne species in the region is possible. Root-knot nematodes have been reported to cause economic losses in cut-flower plantations in Colombia (1), but there are no reports of the species involved. M. javanica has an extensive host range and wide distribution. The identification and distribution of M. javanica in chrysanthemum production is relevant because nematode-fungus interactions may depend on the nematode species involved. Only M. javanica, and not M. hapla or M. incognita, has been found to increase the severity of Fusarium wilt on chrysanthemum (2). To our knowledge, this is the first report of M. javanica on chrysanthemum in Colombia. References: (1) G. Arbeláez. Acta Hortic. 482:91, 1999. (2) A. W. Johnson and R. H. Littrell. J. Nematol. 1:122. 1969.

Download Full-text

Short Communication: The prevalence and species of root-knot nematode which infect on potato seed in Central Java, Indonesia

Biodiversitas Journal of Biological Diversity ◽

10.13057/biodiv/d200102 ◽

2018 ◽

Vol 20 (1) ◽

pp. 11-16

Author(s):

MUTALA’LIAH MUTALA’LIAH ◽

SIWI INDARTI ◽

ARIF WIBOWO

Keyword(s):

Short Communication ◽

Nematode Species ◽

Potato Production ◽

Potato Seed ◽

Morphological Identification ◽

Root Knot Nematode ◽

Pcr Assay ◽

Root Knot Nematodes ◽

Central Java ◽

Meloidogyne Spp

Mutala’liah, Indarti S , Wibowo A. 2019. Short Communication: The prevalence and species of root-knot nematode which infect on potato seed in Central Java, Indonesia. Biodiversitas 20: 11-16. Root-knot nematodes are considered as one of the most destructive pathogens of potatoes, especially on tuber seed. Infected potato seed will cause tuber malformation and the most important thing is as the main spreading source of Meloidogyne spp. The objective of this research was to know the prevalence and identify the species of root-knot nematode which attack the potato seed in four sub-districts of potato production centre in Central Java, Indonesia. Molecular and morphological identification was conducted for the nematode species identification. PCR assay using MIG primer to detect three tropical root-knot nematodes followed by sequencing was conducted for molecular detection, while the perennial pattern was conducted for morphological detection. Results showed that root-knot nematodes on potato seed were generally distributed in Central Java with the prevalence percentage between 14.28-88.23% on the three from four sampling area. The molecular and morphological identification show that species of root-knot nematodes identified on potato seeds were Meloidogyne javanica, M. incognita, and M. arenaria.

Download Full-text

Cuticle heterogeneity as exhibited by Pasteuria spore attachment is not linked to the phylogeny of parthenogenetic root-knot nematodes (Meloidogyne spp.)

Parasitology ◽

10.1017/s0031182000006958 ◽

2001 ◽

Vol 122 (1) ◽

pp. 111-120 ◽

Cited By ~ 37

Author(s):

K.G. DAVIES ◽

M. FARGETTE ◽

G. BALLA ◽

A. DAUDI ◽

R. DUPONNOIS ◽

...

Keyword(s):

Nematode Species ◽

Pasteuria Penetrans ◽

Root Knot Nematode ◽

Root Knot Nematodes ◽

Major Barrier ◽

The Face ◽

Meloidogyne Spp ◽

Spore Attachment ◽

Micro Organisms ◽

High Degree

The cuticle is a major barrier prohibiting the infection of nematodes against micro-organisms. The attachment of bacterial spores of the nematode hyperparasite Pasteuria penetrans (PP1) to field populations of root-knot nematodes (RKN, Meloidogyne spp.) from Burkino Faso, Ecuador, Greece, Malawi, Senegal and Trinidad and Tobago were assayed in standard attachment tests. The attachment of spore population PP1 to different field populations of root-knot nematode showed that the rates of attachment differed between countries. Similar tests were also undertaken on P. penetrans spores from these countries against 2 species of RKN, M. incognita and M. arenaria. The results showed a high degree of variability in spore attachment with no clear distinction between the 2 species of nematode. It has been hypothesized that Pasteuria spore attachment is linked to nematode species designations and this study clearly shows that this is not the case. Further tests showed that variation in spore attachment was not linked to nematode phylogeny. The results therefore beg the question of how do parthenogenetic root-knot nematodes maintain cuticle variability in the face of such an aggressive hyperparasite.

Download Full-text

Histological Characterization of Resistance to Different Root-Knot Nematode Species Related to Phenolics Accumulation in Capsicum annuum

Phytopathology ◽

10.1094/phyto-95-0158 ◽

2005 ◽

Vol 95 (2) ◽

pp. 158-165 ◽

Cited By ~ 80

Author(s):

A. Pegard ◽

G. Brizzard ◽

A. Fazari ◽

O. Soucaze ◽

P. Abad ◽

...

Keyword(s):

Resistance Gene ◽

Capsicum Annuum ◽

High Performance ◽

Nematode Species ◽

Susceptible Cultivar ◽

Resistant Line ◽

Root Knot Nematode ◽

Resistance Response ◽

Root Knot Nematodes ◽

Chromatography Analysis

In the pepper Capsicum annuum CM334, which is used by breeders as a source of resistance to Phytophthora spp. and potyviruses, a resistance gene entirely suppresses reproduction of the root-knot nematode (Meloidogyne spp.). The current study compared the histological responses of this resistant line and a susceptible cultivar to infection with the three most damaging root-knot nematodes: M. arenaria, M. incognita, or M. javanica. Resistance of CM334 to root-knot nematodes was associated with unidentified factors that limited nematode penetration and with post-penetration biochemical responses, including the hypersensitive response, which apparently blocked nematode migration and thereby prevented juvenile development and reproduction. High-performance liquid chromatography analysis suggested that phenolic compounds, especially chlorogenic acid, may be involved in CM334 resistance. The response to infection in the resistant line varied with root-knot nematode species and was correlated with nematode behavior and pathogenicity in the susceptible cultivar: nematode species that quickly reached the vascular cylinder and initiated feeding sites in the susceptible cultivar were quickly recognized in CM334 and stopped in the epidermis or cortex. After comparing our data with those from other resistant pepper lines, we suggest that timing of the resistance response and the mechanism of resistance vary with plant genotype, resistance gene, and root-knot nematode species.

Download Full-text

Genetic diversity of Meloidogyne spp. parasitising potato in Brazil and aggressiveness of M. javanica populations on susceptible cultivars

Nematology ◽

10.1163/15685411-00003032 ◽

2017 ◽

Vol 19 (1) ◽

pp. 69-80 ◽

Cited By ~ 9

Author(s):

Israel L. Medina ◽

Cesar B. Gomes ◽

Valdir R. Correa ◽

Vanessa S. Mattos ◽

Philippe Castagnone-Sereno ◽

...

Keyword(s):

Genetic Diversity ◽

Rapd Markers ◽

Potato Production ◽

Potato Cultivars ◽

Root Knot Nematode ◽

Root Knot Nematodes ◽

Nematode Reproduction ◽

Meloidogyne Spp ◽

Prevalent Species ◽

Reproduction Factor

Root-knot nematodes (Meloidogyne spp.) significantly impact potato production worldwide and in Brazil they are considered one of the most important group of nematodes affecting potatoes. The objectives of this study were to survey Meloidogyne spp. associated with potatoes in Brazil, determine their genetic diversity and assess the aggressiveness of M. javanica on two susceptible potato cultivars. Fifty-seven root-knot nematode populations were identified using esterase phenotyping, including Meloidogyne javanica, M. incognita, M. arenaria and M. ethiopica. Overall, root-knot nematodes were present in ca 43% of sampled sites, in which M. javanica was the most prevalent species, and the phenotypes Est J3, J2a and J2 occurred in 91.2, 6.7 and 2.1% of the positive samples, respectively. Other species, such as M. incognita, M. arenaria and M. ethiopica, were found less frequently and occurred at rates of 6.4, 4.3 and 2.1% of the samples, respectively. Sometimes, M. javanica was found in mixtures with other root-knot nematodes in ca 10.6% of sites containing Meloidogyne. After confirming the identification of 17 isolates of M. javanica and one isolate each of M. incognita, M. arenaria and M. ethiopica by SCAR markers, the populations were used to infer their genetic diversity using RAPD markers. Results revealed low intraspecifc genetic diversity among isolates (13.9%) for M. javanica. Similarly, M. javanica sub-populations (J2a) clustered together (81% of bootstrap), indicating subtle variation from typical J3 populations. The aggressiveness of four populations of M. javanica from different Brazilian states on two susceptible potato cultivars was tested under glasshouse conditions. Results indicated differences in aggressiveness among these populations and showed that potato disease was proportional to nematode reproduction factor.

Download Full-text

First Report of the Root-Knot Nematode Meloidogyne artiellia in Belgium

Plant Disease ◽

10.1094/pdis-08-12-0720-pdn ◽

2013 ◽

Vol 97 (1) ◽

pp. 152-152 ◽

Cited By ~ 1

Author(s):

N. Damme ◽

L. Waeyenberge ◽

N. Viaene ◽

T. van Hoenselaar ◽

G. Karssen

Keyword(s):

Arable Land ◽

Morphological Characteristics ◽

Egg Laying ◽

Proteinase K ◽

Morphological Observation ◽

Root Knot Nematode ◽

Isozyme Electrophoresis ◽

First Report ◽

Rdna Sequencing ◽

Meloidogyne Spp

In 2011, second-stage juveniles (J2) of an unknown root-knot nematode (Meloidogyne spp.) were detected during a routine survey for root-knot nematodes on arable land in Harveng, Belgium, after a crop of wheat. Most of the loamy soil samples (36 out of 42) contained J2 of the common root-knot nematode M. naasi Franklin, 1965 (1), while 15 of these also contained the unknown species, albeit in lower densities (22 J2/100 ml vs. 157 J2/100 ml soil). After detailed morphological observation of the unknown J2, they were until further notice identified as Meloidogyne artiellia Franklin, 1961 (2), the British root-knot nematode. To confirm the identification, a pure culture of M. artiellia was established by adding nematode suspensions to pots planted with kale (Brassica oleracea var. laciniata), a non-host for M. naasi (3). After 2 months, Meloidogyne spp. females, males, and J2 were isolated from galled kale roots. Morphological characteristics (n = 25) from the perineal pattern (rounded with fine striae, lateral area with coarse ridges, angular dorsal arch) and stylet knobs (small, ovoid, and backwardly sloping) for the females, the head shape (set off with distinct head cap) and stylet knobs (small, ovoid and backwardly sloping) for the males, the hemizonid position (anterior, adjacent to S to E pore), tail shape (conical), and short tail length (18 to 27 μm) for the J2, fit with previous observed populations of M. artiellia (3). Young egg-laying females were used for isozyme electrophoresis, and showed typical malate dehydrogenase (N1b) and esterase (M2-VF1) patterns (3). Additionally, DNA was extracted from single juveniles by incubating them in a lysis buffer (200 mM NaCl, 200 mM Tris-HCl (pH 8), 1% β-mercaptoethanol and 800 μg/ml Proteinase K) during 1.5 h at 65°C and 5 min at 99°C in a thermocycler. One microliter of crude DNA extract was used for PCR. ITS-rDNA sequencing (GenBank Accession Numbers JX393299 and JX393300) confirmed the identity, showing a 98 to 100% homology with other M. artiellia sequences (AY150368 and AF248478). To our knowledge, this is the first report of the root-knot nematode, M. artiellia, in Belgium. This nematode has been reported from the Mediterranean area, where it causes damage on chickpea and wheat (4), as well as from the U.K. Its finding in Harveng, close to the French border, suggests a more extensive geographical distribution. References: (1) M. T. Franklin. Nematologica 11:79, 1965. (2) M. T. Franklin et al. Suppl.:85, 1961. (3) G. Karssen. Pages 93-97 in: The Plant-Parasitic Nematode Genus Meloidogyne Göldi, 1892 (Tylenchida) in Europe, Brill Leiden, The Netherlands, 2002. (4) M. Di Vito and N. Greco. Revue Nématol. 11:223, 1988.

Download Full-text

Differences in Feeding Sites Induced by Root-Knot Nematodes, Meloidogyne spp., in Chickpea

Phytopathology ◽

10.1094/phyto-95-0368 ◽

2005 ◽

Vol 95 (4) ◽

pp. 368-375 ◽

Cited By ~ 19

Author(s):

Nicola Vovlas ◽

Hava F. Rapoport ◽

Rafael M. Jiménez Díaz ◽

Pablo Castillo

Keyword(s):

Giant Cell ◽

Faba Bean ◽

Nematode Species ◽

Giant Cells ◽

The Other ◽

Root Knot Nematodes ◽

Feeding Site ◽

Feeding Sites ◽

Meloidogyne Spp ◽

Meloidogyne Species

Root-knot nematodes (Meloidogyne spp.) are sedentary, obligate endoparasites in plants, where they induce specialized feeding sites. The feeding sites act as strong metabolic sinks to which photosynthates are mobilized. The histopathological modifications in the nematode-induced feeding sites of artificially inoculated chickpea cv. UC 27 were qualitatively and quantitatively compared using five isolates of M. artiellia and one isolate each of M. arenaria, M. incognita, and M. javanica. All Meloidogyne isolates infected chickpea plants, but root gall thickening was significantly less for M. artiellia isolates than for the other Meloidogyne species. Nevertheless, neither the number of giant cells in the feeding site (averaging four to six) nor the area of individual giant cells was influenced by nematode species or isolate. However, the number of nuclei per giant cell was significantly smaller, and the maximum diameters of nuclei and nucleoli were significantly greater, in giant cells induced by M. artiellia isolates than in those induced by M. arenaria, M. incognita, or M. javanica. In a second experiment, M. artiellia-induced giant cells in faba bean and rapeseed also contained a small number of large nuclei.

Download Full-text