scholarly journals First Report of Root-Knot Nematode Meloidogyne javanica on Chrysanthemum in Colombia

Plant Disease ◽  
2006 ◽  
Vol 90 (6) ◽  
pp. 828-828 ◽  
Author(s):  
P. A. Agudelo ◽  
S. A. Lewis ◽  
M. A. Abril
Keyword(s):  
Morphological Characteristics ◽  
Meloidogyne Javanica ◽  
Nematode Species ◽  
Wide Distribution ◽  
Economic Losses ◽  
Cut Flower ◽  
Root Knot Nematode ◽  
Root Knot Nematodes ◽  
First Report ◽  
Phenotype Analysis

Severe plant stunting, chlorosis, and extensive root galling were observed on chrysanthemum (Dendrathema grandiflora cv. Yellow Vero) in a commercial cut-flower production facility in Rionegro, Antioquia, northwestern Colombia. Examination of the root samples from selected infected plants revealed the presence of abundant root-knot nematodes. Juveniles, males, and females were extracted for species identification using morphological characteristics. Identification was confirmed by perineal patterns and esterase phenotype analysis of females. All methods of identification were consistent with typical Meloidogyne javanica. No other root-knot nematode species were found on this farm, but the presence of other Meloidogyne species in the region is possible. Root-knot nematodes have been reported to cause economic losses in cut-flower plantations in Colombia (1), but there are no reports of the species involved. M. javanica has an extensive host range and wide distribution. The identification and distribution of M. javanica in chrysanthemum production is relevant because nematode-fungus interactions may depend on the nematode species involved. Only M. javanica, and not M. hapla or M. incognita, has been found to increase the severity of Fusarium wilt on chrysanthemum (2). To our knowledge, this is the first report of M. javanica on chrysanthemum in Colombia. References: (1) G. Arbeláez. Acta Hortic. 482:91, 1999. (2) A. W. Johnson and R. H. Littrell. J. Nematol. 1:122. 1969.

scholarly journals Host Status of Lisianthus `Mariachi Lime Green' for Three Species of Root-knot Nematodes

HortScience ◽  
2004 ◽  
Vol 39 (1) ◽  
pp. 120-123 ◽  
Author(s):  
Martin Schochow ◽  
Steven A. Tjosvold ◽  
Antoon T. Ploeg
Keyword(s):  
Nematode Species ◽  
Meloidogyne Hapla ◽  
Cut Flower ◽  
Root Knot Nematode ◽  
Eustoma Grandiflorum ◽  
Root Knot Nematodes ◽  
Tomato Plants ◽  
Flower Production ◽  
Significant Damage ◽  
Host Status

Lisianthus [Eustoma grandiflorum (Raf.) Shinn.] plants were grown in soil infested with increasing densities of Meloidogyne hapla Chitwood, M. incognita (Kofoid & White) Chitwood, or M. javanica (Treub) Chitwood, root-knot nematodes. Compared to tomato plants grown in soil with the same nematode numbers and species, lisianthus had less severe root symptoms, suffered less damage, and resulted in lower nematode multiplication rates. Lisianthus was a better host for M. javanica than for M. incognita, and a poor host for M. hapla. Lisianthus shoot weights were significantly reduced after inoculation with M. javanica or M. hapla, but not after M. incognita inoculation. The number of flowers produced per lisianthus plant was reduced by all three nematode species. The results show that the root-knot nematode species that are most common in California may cause significant damage in the cut-flower production of lisianthus.

scholarly journals Community Analysis of Nematodes Associated with Banana, Identification of root knot nematode and Evaluation the Susceptibility of Some Cultivars to Infection

2021 ◽  
Author(s):  
Radwa G. Mostafa ◽  
Aida M. El-Zawahry ◽  
Ashraf E. M. Khalil ◽  
Ameer E. Elfarash ◽  
Ali D. A. Allam
Keyword(s):  
Meloidogyne Javanica ◽  
Nematode Species ◽  
Common Species ◽  
Molecular Techniques ◽  
Control Measures ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Root Knot Nematode ◽  
Root Knot Nematodes ◽  
Plant Parasitic

Abstract Background Plant-parasitic nematodes are extremely dangerous pests in a variety of economically important crops. The purpose of this study was a survey of all nematode species existing in banana from three sites in Assiut Governorate, Egypt and to characterize the most common species by morphological, morphometric and molecular techniques (PCR with species-specific primers). Then, study of resistance or sensitivity of some banana cultivars to root-knot nematodes.Methods and Results Four nematodes, Meloidogyne, Rotylenchulus reniformis, Helicotylenchus and Pratylenchus were isolated and identified from soil and root samples collected from banana plants. Most frequently occurring of plant parasitic nematode species in banana was Meloidogyne. Former research found differences in species and in resistance to root-knot nematodes among the examined plant cultivars. Identification of Root-knot nematodes by Characterize of morphometric, molecularly, morphological isolate of Meloidogyne related to banana plants. The results revealed that the identified nematode species, Meloidogyne javanica, is the most common plant-parasitic nematodes in all locations. Data on the susceptibility of the tested banana cultivars to M. javanica revealed that Grand Naine was highly susceptible (HS) however, Magraby was susceptible (S) but Williams and Hindi cultivars were moderately resistant (MR).Conclusions we concluded that a survey revealed the significant prevalence of Meloidogyne javanica, the most important nematodes on banana in Assiut. The morphometric, morphological, and molecular identification were harmonic with one another. In addition to the host response of certain banana cultivars, to M. javanica that resistance is of significance and can be helpful to incorporate through planning control measures for root- knot nematodes.

scholarly journals First Report of the Root-Knot Nematode, Meloidogyne hispanica, Infecting Sunflower in Greece

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 703-703 ◽  
Author(s):  
E. A. Tzortzakakis ◽  
A. I. Anastasiadis ◽  
K. B. Simoglou ◽  
C. Cantalapiedra-Navarrete ◽  
J. E. Palomares-Rius ◽  
...  
Keyword(s):  
Phylogenetic Analyses ◽  
Original Description ◽  
Economic Losses ◽  
State University ◽  
Root Knot Nematode ◽  
Root Knot Nematodes ◽  
First Report ◽  
North Carolina State University ◽  
Helianthus Annus ◽  
Prunus Spp

Severe plant stunting, chlorosis, and extensive root galling were observed on sunflower (Helianthus annus Pioneer Hi-bred PR64LE19, Dupont) in a commercial field at Agios Athanasios, Drama Province, northeastern Greece at the end of May 2013. Disease symptoms were observed about 1.5 months after planting, and were distributed in patches that covered approximately 2% of the whole cultivated area. Examination of the soil and root samples from selected infected plants revealed the presence of abundant root-knot nematodes. Juveniles, males, and females were extracted by sieving, decanting, and root dissection for identification using morphological traits. Nematode population densities ranging from 100 to 150 J2s per 100 cm3 of soil, and 150 to 3,000 eggs per g of fresh sunflower roots were observed. Identification was confirmed by perineal patterns of females and by sequencing of the D2-D3 expansion segments of 28S ribosomal RNA gene (1,3,4). All identification methods were consistent with typical Meloidogyne hispanica. Morphology of perineal patterns of females and measurements of the second-stage juveniles (J2s) matched those of the original description of M. hispanica (3). Alignment indicated that the D2-D3 sequence (GenBank Accession No. KF501128) was 99% homologous to other sequences of M. hispanica deposited in GenBank from Brazil, Portugal, and Spain (EU443606, EU443608, and GQ375158, respectively), differing in only one nucleotide. Phylogenetic analyses using maximum likelihood of this sequence placed the Meloidogyne sp. in a highly supported (100%) clade that included all M. hispanica sequences available from the GenBank database (4). Root-knot nematodes in general have been reported to cause economic losses in sunflower in Europe (2), but there are no reports of M. hispanica. M. hispanica was first found in Seville Province, southern Spain, infecting rootstocks of Prunus spp. (3). Its distribution has been confirmed worldwide on different agricultural crops. However, to our knowledge, this is the first report of M. hispanica infecting sunflower in Europe and the first report of this species on any crop for Greece. The identification of M. hispanica in sunflower is relevant because it may represent a threat for sunflower production in Greece. Research to develop sunflower varieties resistant to root-knot nematodes should now also consider M. hispanica along with other species of Meloidogyne. References: (1) K. R. Barker. Page 19 in: An Advanced Treatise on Meloidogyne. Vol. II, Methodology. K. R. Barker et al., eds. North Carolina State University Graphics, Raleigh, NC, 1985. (2) M. Di Vito et al. Nematol. Mediterr. 24:109, 1996. (3) H. Hirschmann. J. Nematol. 18:520, 1986. (4) B. B. Landa et al. Plant Dis. 92:1104, 2008.

scholarly journals First Report of Root-Knot Nematodes (Meloidogyne spp.) on Sunflowers in Mozambique

Plant Disease ◽  
1997 ◽  
Vol 81 (11) ◽  
pp. 1333-1333 ◽  
Author(s):  
A. Zazzerini ◽  
L. Tosi ◽  
P. M. Vicente
Keyword(s):  
South African ◽  
Personal Communication ◽  
Nematode Species ◽  
Root Knot Nematode ◽  
African Countries ◽  
Root Knot Nematodes ◽  
First Report ◽  
Alternaria Helianthi ◽  
Disease Surveys ◽  
Meloidogyne Spp

Sunflower (Helianthus annuus L.) recently was reintroduced to Mozambique because of renewed interest in oil-seed production for domestic consumption. In April 1997, disease surveys were carried out in two fields in southern Mozambique (Maputo region). Several plants of Pan 735, a South African cultivar, showed yellowing of the leaves and stunting. These plants wilted during the day but recovered their turgidity at night. Diseased plants were easily pulled from the soil due to almost complete destruction of the root system. Numerous galls were found on affected roots, compared with healthy plants. Meloidogyne javanica (Treub) Chitwood and M. incognita (Kofoid & White) Chitwood were identified by M. Di Vito (personal communication) based on 20 female perineal patterns observed with a light microscope. M. incognita was more prevalent than M. javanica. Also observed were Alternaria helianthi (Hansf.) Tubaki & Nishihara and Sclerotium bataticola Taub. Root-knot nematodes (Meloidogyne spp.), common on sunflower, cause severe damage and reduce both seed yield and seed oil content (1). These two nematode species have also been observed on sunflower in other African countries (Zambia, South Africa, Egypt) but this is the first report of root-knot nematode on sunflower in Mozambique. Reference: (1) M. Di Vito et al. Nematol. Medit. 24:109, 1996.

scholarly journals First Report of Meloidogyne incognita on Cardamine Violifohia in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Rui Liu ◽  
Hongqing Yin ◽  
Lin Li ◽  
Kaiwei Huang ◽  
Huixia Li ◽  
...  
Keyword(s):  
Body Length ◽  
Meloidogyne Incognita ◽  
Uv Light ◽  
Morphological Characteristics ◽  
Tail Length ◽  
Nematode Species ◽  
Economic Losses ◽  
Egg Masses ◽  
First Report ◽  
Stylet Length

Cardamine violifohia is an economically-important medicinal plant, and also a valuable plant for strong ability to accumulate selenium (Se) (Ebba et al. 2020). It is not only be used to extract selenium protein and selenium polysaccharide, but also widely used to develop selenium-supplement reagent. In September 2020, root-knot nematodes (RKN; Meloidogyne spp.) infection experiments showed that galls and egg masses were observed on the roots of numerous C. violifolia plants in Enshi (30°32′25.67″ N; 109°48′48.46″ E), Hubei Province, China. Meanwhile, the overground plants of C. violifohia were stunted and leaves were yellow. Almost 5% C. violifohia plants were affected by the disease. The roots with galls were collected, and nematodes were dissected and extracted (Fig. S1). Based on phytopathological clinic, the number of galls on each plant was 91.87 ± 19.01, and egg masses was 15.27 ± 5.36 (n = 15). Nematodes and galls were collected from soil and infected roots (Barker 1985). The morphological diagnostic of the nematode species was measured as follows. Measurements of adult females (n=20), body length = 628.15 ± 73.69 μm, width = 356.77 ± 36.72 μm, stylet length = 15.58 ±0.93 μm. Meanwhile, a high and trapezoidal dorsal arch with thick striations was observed in the perineal region of females. Second-stage juveniles (J2s) (n=20): body length = 377.09 ± 18.19 μm, body width = 15.64 ± 1.24 μm, stylet length = 13.31 ± 1.04 μm, tail length = 42.49 ± 4.64 μm, hyaline tail terminus = 12.35 ± 2.02 μm and presented well developed esophageal glands. Eggs (n=20): length = 80.81 ± 3.47 μm, and width = 37.09 ± 2.98 μm. All the morphological characteristics of the identified species were consistent with the descriptions of Meloidogyne incognita (Kofoid & White, 1919) Chitwood, 1949 (Whitehead, 1968). Molecular identification was carried out by PCR with the M. incognita-specific primers Mi-F/Mi-R (Meng et al. 2004) and 28S rDNA D2/D3 region primers MF/MR (Hu et al. 2011). The target fragments of 955 bp and 478 bp amplified by of the primer pairs Mi-F/Mi-R and MF/MR were observed under a UV light, which confirmed that these nematodes collected from C. violifohia were M. incognita (Fig. S2). Fragments were, sequenced (MZ596342 and MZ566843, respectively) and aligned with available sequences on NCBI, which were 100% identical to the MK410954, MN728679, and MK410953, MF177882 M. incognita sequences, respectively. Pathogenicity testing was conducted to perform Koch’s postulates in a greenhouse by inoculation of 500 J2s from the original population into C. violifohia seedlings (n = 30, 5-6 leaves stage). After 7 weeks, all inoculated plants exhibited the same symptoms that observed in the field initially. Different life stages of M. incognita were observed in dissected galled tissues. The average reproductive factor was 37.30 ± 6.13, which is considered as the pathogenicity of M. incognita to C. violifohia. Therefore, C. violifohia is a suitable host for M. incognita in China. The growers should be informed of the current findings to avoid serious economic losses that might be caused by this pathogenic nematode, and prepare for proper management action. To our knowledge, this is the first report of M. incognita infecting C. violifohia in China.

scholarly journals First Report of Meloidogyne graminicola Infecting Banana in China

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 420-420 ◽  
Author(s):  
X. Zhou ◽  
G. K. Liu ◽  
S. Xiao ◽  
S. S. Zhang
Keyword(s):  
Natural Infection ◽  
Its Region ◽  
Nematode Species ◽  
Original Description ◽  
Root Surface ◽  
Mature Female ◽  
Root Knot Nematode ◽  
Population Densities ◽  
Root Knot Nematodes ◽  
First Report

Bananas (Musa spp.) are one of world's most popular fruits, and China is the third largest banana-producing country in the world. Root-knot nematodes, Meloidogyne spp., are common pests of banana worldwide, but damage to this crop caused by M. graminicola has not been reported up to now. During a survey of root-knot nematode species infecting banana in Fujian Province, China, swollen, galled primary and secondary root samples of Musa nana cv. Tianbao (AAA) were collected from two commercial fields in Nanjing County in May 2013. The affected plants did not exhibit obvious above-ground symptoms. Seriously infected roots were malformed and dehiscent, with the tissue discolored and rotting. Examination of symptomatic roots revealed one to several females of Meloidogyne sp. within each gall, with egg masses that were often completely embedded within the gall without protruding through the root surface, and with second-stage juveniles (J2) hatched inside the galls. Population densities of this nematode ranged from 452 to 2,056 eggs and J2 per 5 g of fresh roots. Males were rarely observed. Morphological measurements of 25 females and 20 J2 matched the original description of M. graminicola (1). The perineal patterns of females were dorsoventrally ovoid, with low to moderately high and round dorsal arches and lacking obvious lateral lines; striae were smooth and some were broken by a few obvious irregular, zig-zag striae in the dorsal part of the pattern; phasmids were close together (13.1 to 19.7 μm). The J2 had long tapered tails (63.4 to 75.5 μm), with long narrow hyalines (13.1 to 19.9 μm) and marked clavate termini. DNA was extracted from one mature female. The ITS1-5.8S-ITS2 rDNA region was amplified with V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (2) and the COII and IRNA mtDNA genes were amplified with C2F3/MRH106 (GGTCAATG TTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTAGT) (3) and then sequenced. The sequences were subjected to a database search using BLAST to verify the identity. Sequences from the ITS region were 788 bp (GenBank Accession Nos. KM111531 and KM236560) and were 96.8 to 99.1% identical to the known sequences of M. graminicola in Genbank. Sequences from the mtDNA were 666 bp (KM111533 and KM236559) and showed 99.1 to 99.4% homology with the known sequences of M. graminicola (KJ139963 and HG529223). In glasshouse tests, banana plantlets (M. nana cv. Tianbao) about 20 cm high were transplanted in 25-cm-diameter pots and inoculated with 5,000 J2 of each collected population of M. graminicola replicated six times; a noninoculated control was included. After 15 weeks, all inoculated plants were stunted and chlorotic. Galling symptoms on roots were similar to those in the field, and dissection of galled root tissue revealed that different life stages of the nematode were present, with population densities ranging from 1,238 to 6,562 eggs and J2 per 5 g of fresh roots. The noninoculated control plants grew well and had no galling symptoms on the roots. These results confirmed the nematodes' pathogenicity on banana. On the basis of these results, the root-knot nematodes isolated from banana in Nanjing County were confirmed as M. graminicola. To our knowledge, this is the first report of a natural infection of banana with M. graminicola. References: (1) A.M. Golden and W. Birchfield. Plant Dis. Rep. 52:423, 1968. (2) T. C. Vrain et al. Fund. Appl. Nematol. 15:565, 1992. (3) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004.

scholarly journals First Report of Meloidogyne javanica Parasitizing Duboisia sp. in Paraná State, Brazil

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1745-1745
Author(s):  
A. C. Z. Machado ◽  
O. F. Dorigo ◽  
A. Boss ◽  
P. Tironi
Keyword(s):  
Morphological Characteristics ◽  
Tail Length ◽  
Nematode Species ◽  
Eastern Coast ◽  
State University ◽  
Root Knot Nematode ◽  
First Report ◽  
North Carolina State University ◽  
Tail Tip ◽  
And Control

Duboisia sp. is a small tree belonging to the family Solanaceae originating from the rainforest areas of the eastern coast of Australia. Dried leaves are used for the extraction of pharmaceutical alkaloids, making this a commercially viable crop. The root-knot nematode Meloidogyne incognita has been reported parasitizing Duboisia myoporoides (5); however, no information of other root-knot nematode species associated with this plant was found. Duboisia sp. is cultivated at Solana Farm, near Arapongas (23°25′08″ S, 51°25′26″ W), Paraná State, Brazil. During the renovation of a production field in this municipality, galled roots were observed on plants and samples were submitted to the Nematology Laboratory at Instituto Agronômico do Paraná, IAPAR, on December 2013. Plants did not exhibit any above-ground symptoms. The specimens were identified through perineal patterns and esterase phenotypes of 20 adult females extracted from dissected roots (2,3) and morphometrics of 10 second-stage juveniles extracted from roots using the blender-sieving method (1). Morphological characteristics were consistent with those described for M. javanica (4). Females had rounded perineal patterns with low, trapezoid shape dorsal arch, striae smooth interrupted by a pair of incisures on both sides, corresponding to lateral fields, clearly demarcated from striae by more or less parallel lines, tail whorl often distinct (4). The juvenile mean body length was 459.9 ± 28.7 μm and tail length averaged 51.6 ± 5.1 μm, with 10 to 16 μm long hyaline region and finely rounded tail tip (4). Results from the esterase electrophoresis were typical of M. javanica (2) with the J3 (Rm = 1.0, 1.3, and 1.4) phenotype being obtained. To our knowledge, this is the first report of M. javanica on Duboisia sp. in Brazil. This finding has great importance for Brazilian production since this nematode may damage plants, reduce yields, and control of this nematode on Duboisia sp. is difficult (5). Additional work is necessary in order to elucidate the losses caused by M. javanica on Duboisia sp. References: (1) J. I. Bonetti and S. Ferraz. Fitopatol. Bras. 6:533, 1981. (2) P. R. Esbenshade and A. C. Triantaphyllou. J. Nematol. 22:10, 1990. (3) K. M. Hartman and J. N. Sasser. Page 115 in: An Advanced Treatise on Meloidogyne. Volume II Methodology. K. R. Barker et al., eds. North Carolina State University Graphics, Raleigh, 1985. (4) D. J. Hunt and Z. A. Handoo. Page 55 in: Root-Knot Nematodes. R. N. Perry et al., eds. CABI International, Wallingford, UK, 2010. (5) A. M. Mello et al. Nematol. Bras. 22(2):12, 1998.

scholarly journals First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jujube in China

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1451-1451 ◽  
Author(s):  
H. B. Long ◽  
C. Bai ◽  
J. Peng ◽  
F. Y. Zeng
Keyword(s):  
Morphological Characteristics ◽  
Nematode Species ◽  
First Record ◽  
Reproduction Rate ◽  
Root Knot Nematode ◽  
Mt Dna ◽  
First Report ◽  
Intergenic Spacers ◽  
Traditional Chinese Herbal Medicine ◽  
Meloidogyne Enterolobii

Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China. References: (1) P. Castagnone-Sereno. Nematology 14:133, 2002. (2) H. Long et al. Acta Phytopathol. Sinica 36:109, 2006. (3) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

scholarly journals Histological Characterization of Resistance to Different Root-Knot Nematode Species Related to Phenolics Accumulation in Capsicum annuum

2005 ◽  
Vol 95 (2) ◽  
pp. 158-165 ◽  
Author(s):  
A. Pegard ◽  
G. Brizzard ◽  
A. Fazari ◽  
O. Soucaze ◽  
P. Abad ◽  
...  
Keyword(s):  
Resistance Gene ◽  
Capsicum Annuum ◽  
High Performance ◽  
Nematode Species ◽  
Susceptible Cultivar ◽  
Resistant Line ◽  
Root Knot Nematode ◽  
Resistance Response ◽  
Root Knot Nematodes ◽  
Chromatography Analysis

In the pepper Capsicum annuum CM334, which is used by breeders as a source of resistance to Phytophthora spp. and potyviruses, a resistance gene entirely suppresses reproduction of the root-knot nematode (Meloidogyne spp.). The current study compared the histological responses of this resistant line and a susceptible cultivar to infection with the three most damaging root-knot nematodes: M. arenaria, M. incognita, or M. javanica. Resistance of CM334 to root-knot nematodes was associated with unidentified factors that limited nematode penetration and with post-penetration biochemical responses, including the hypersensitive response, which apparently blocked nematode migration and thereby prevented juvenile development and reproduction. High-performance liquid chromatography analysis suggested that phenolic compounds, especially chlorogenic acid, may be involved in CM334 resistance. The response to infection in the resistant line varied with root-knot nematode species and was correlated with nematode behavior and pathogenicity in the susceptible cultivar: nematode species that quickly reached the vascular cylinder and initiated feeding sites in the susceptible cultivar were quickly recognized in CM334 and stopped in the epidermis or cortex. After comparing our data with those from other resistant pepper lines, we suggest that timing of the resistance response and the mechanism of resistance vary with plant genotype, resistance gene, and root-knot nematode species.

scholarly journals First report of Coniella castaneicola causing leaf blight on blueberry (Vaccinium virgatum) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jiahao Lai ◽  
Guihong Xiong ◽  
Bing Liu ◽  
Weigang Kuang ◽  
Shuilin Song
Keyword(s):  
Molecular Identification ◽  
Morphological Characteristics ◽  
Leaf Blight ◽  
Yield Potential ◽  
Effective Control ◽  
Economic Losses ◽  
Distilled Water ◽  
First Report ◽  
Fungal Isolates ◽  
Blight Disease

Blueberry (Vaccinium virgatum), an economically important small fruit crop, is characterized by its highly nutritive compounds and high content and wide diversity of bioactive compounds (Miller et al. 2019). In September 2020, an unknown leaf blight disease was observed on Rabbiteye blueberry at the Agricultural Science and Technology Park of Jiangxi Agricultural University in Nanchang, China (28°45'51"N, 115°50'52"E). Disease surveys were conducted at that time, the results showed that disease incidence was 90% from a sampled population of 100 plants in the field, and this disease had not been found at other cultivation fields in Nanchang. Leaf blight disease on blueberry caused the leaves to shrivel and curl, or even fall off, which hindered floral bud development and subsequent yield potential. Symptoms of the disease initially appeared as irregular brown spots (1 to 7 mm in diameter) on the leaves, subsequently coalescing to form large irregular taupe lesions (4 to 15 mm in diameter) which became curly. As the disease progressed, irregular grey-brown and blighted lesion ran throughout the leaf lamina from leaf tip to entire leaf sheath and finally caused dieback and even shoot blight. To identify the causal agent, 15 small pieces (5 mm2) of symptomatic leaves were excised from the junction of diseased and healthy tissue, surface-sterilized in 75% ethanol solution for 30 sec and 0.1% mercuric chloride solution for 2 min, rinsed three times with sterile distilled water, and then incubated on potato dextrose agar (PDA) at 28°C for 5-7 days in darkness. Five fungal isolates showing similar morphological characteristics were obtained as pure cultures by single-spore isolation. All fungal colonies on PDA were white with sparse creeping hyphae. Pycnidia were spherical, light brown, and produced numerous conidia. Conidia were 10.60 to 20.12 × 1.98 to 3.11 µm (average 15.27 × 2.52 µm, n = 100), fusiform, sickle-shaped, light brown, without septa. Based on morphological characteristics, the fungal isolates were suspected to be Coniella castaneicola (Cui 2015). To further confirm the identity of this putative pathogen, two representative isolates LGZ2 and LGZ3 were selected for molecular identification. The internal transcribed spacer region (ITS) and large subunit (LSU) were amplified and sequenced using primers ITS1/ITS4 (Peever et al. 2004) and LROR/LR7 (Castlebury and Rossman 2002). The sequences of ITS region (GenBank accession nos. MW672530 and MW856809) showed 100% identity with accessions numbers KF564280 (576/576 bp), MW208111 (544/544 bp), MW208112 (544/544 bp) of C. castaneicola. LSU gene sequences (GenBank accession nos. MW856810 to 11) was 99.85% (1324/1326 bp, 1329/1331 bp) identical to the sequences of C. castaneicola (KY473971, KR232683 to 84). Pathogenicity was tested on three blueberry varieties (‘Rabbiteye’, ‘Double Peak’ and ‘Pink Lemonade’), and four healthy young leaves of a potted blueberry of each variety with and without injury were inoculated with 20 μl suspension of prepared spores (106 conidia/mL) derived from 7-day-old cultures of LGZ2, respectively. In addition, four leaves of each variety with and without injury were sprayed with sterile distilled water as a control, respectively. The experiment was repeated three times, and all plants were incubated in a growth chamber (a 12h light and 12h dark period, 25°C, RH greater than 80%). After 4 days, all the inoculated leaves started showing disease symptoms (large irregular grey-brown lesions) as those observed in the field and there was no difference in severity recorded between the blueberry varieties, whereas the control leaves showed no symptoms. The fungus was reisolated from the inoculated leaves and confirmed as C. castaneicola by morphological and molecular identification, fulfilling Koch’s postulates. To our knowledge, this is the first report of C. castaneicola causing leaf blight on blueberries in China. The discovery of this new disease and the identification of the pathogen will provide useful information for developing effective control strategies, reducing economic losses in blueberry production, and promoting the development of the blueberry industry.

Sign in / Sign up

Export Citation Format

Share Document