scholarly journals Molecular Identification of Paracoccidioides brasiliensis by PCR Amplification of Ribosomal DNA

2000 ◽  
Vol 38 (8) ◽  
pp. 3106-3109 ◽  
Author(s):  
Andrea B. Motoyama ◽  
Emerson J. Venancio ◽  
Gilberto O. Brandão ◽  
Silvana Petrofeza-Silva ◽  
Ildinete S. Pereira ◽  
...  
Keyword(s):  
Latin America ◽  
Molecular Marker ◽  
Molecular Identification ◽  
Ribosomal Dna ◽  
Paracoccidioides Brasiliensis ◽  
Pcr Amplification ◽  
Pathogenic Fungi ◽  
Epidemiological Studies ◽  
Intergenic Regions ◽  
28S Ribosomal Dna

We have amplified and sequenced the 5.8S and 28S ribosomal DNA genes and intergenic regions of Paracoccidioides brasiliensis, strain Pb01. Using primers specifically designed for both ribosomal DNA regions, we were able to discriminate betweenP. brasiliensis and other human pathogenic fungi by PCR. The use of this molecular marker could be important for paracoccidiodomycosis diagnosis and ecological and molecular epidemiological studies of P. brasiliensis in Latin America.

scholarly journals Paracoccidioides brasiliensis Isolated from Nine-Banded Armadillos (Dasypus novemcinctus) Reveal Population Structure and Admixture in the Amazon Basin

2021 ◽  
Vol 7 (1) ◽  
pp. 54
Author(s):  
Eduardo Bagagli ◽  
Daniel Ricardo Matute ◽  
Hans Garcia Garces ◽  
Bernardo Guerra Tenório ◽  
Adalberto Garcia Garces ◽  
...  
Keyword(s):  
Population Structure ◽  
Latin America ◽  
Endemic Area ◽  
Amazon Basin ◽  
Paracoccidioides Brasiliensis ◽  
Pathogenic Fungi ◽  
Sensu Stricto ◽  
Species Level ◽  
Dasypus Novemcinctus ◽  
Show Evidence

Paracoccidioidomycosis is an endemic fungal disease to Latin America caused by at least five species-level genotypes of Paracoccidioides, named P. lutzii, P. brasiliensis (S1a and S1b populations), P. americana, P. restrepiensis, and P. venezuelensis. In this manuscript, we report on Paracoccidioides sp. sampling efforts in armadillos from two different areas in Brazil. We sequenced the genomes of seven Paracoccidioides isolates and used phylogenomics and populations genetics for genotyping. We found that P. brasiliensis and P. lutzii are both present in the Amazon region. Additionally, we identified two Paracoccidioides isolates that seem to be the result of admixture between divergent populations within P. brasiliensis sensu stricto. Both of these isolates were recovered from armadillos in a P. lutzii endemic area in Midwestern Brazil. Additionally, two isolates from human patients also show evidence of resulting from admixture. Our results suggest that the populations of P. brasiliensis sensu stricto exchange genes in nature. More generally, they suggest that population structure and admixture within species is an important source of variation for pathogenic fungi.

scholarly journals Analysis of the genetic polymorphism of Paracoccidioides brasiliensis and Paracoccidioides cerebriformis "Moore" by random amplified polymorphic DNA (RAPD) and 28S ribosomal DNA sequencing: Paracoccidioides cerebriformis revisited

2005 ◽  
Vol 47 (3) ◽  
pp. 119-123 ◽  
Author(s):  
Sarah Desirée Barbosa Cavalcanti ◽  
José Eduardo Levi ◽  
Kátia Cristina Dantas ◽  
José Eduardo Costa Martins
Keyword(s):  
Genetic Polymorphism ◽  
Dna Sequence ◽  
Ribosomal Dna ◽  
Dna Analysis ◽  
Paracoccidioides Brasiliensis ◽  
Random Amplified Polymorphic Dna ◽  
Distinct Species ◽  
De Medicina ◽  
28S Ribosomal Dna ◽  
Mycological Laboratory

Our purpose was to compare the genetic polymorphism of six samples of P. brasiliensis (113, 339, BAT, T1F1, T3B6, T5LN1), with four samples of P. cerebriformis (735, 741, 750, 361) from the Mycological Laboratory of the Instituto de Medicina Tropical de São Paulo, using Random Amplified Polymorphic DNA Analysis (RAPD). RAPD profiles clearly segregated P. brasiliensis and P. cerebriformis isolates. However, the variation on band patterns among P. cerebriformis isolates was high. Sequencing of the 28S rDNA gene showed nucleotide conservancy among P. cerebriformis isolates, providing basis for taxonomical grouping, and disclosing high divergence to P. brasiliensis supporting that they are in fact two distinct species. Moreover, DNA sequence suggests that P. cerebriformis belongs in fact to the Aspergillus genus.

Recognition of Fungal Components by the Host Immune System

2020 ◽  
Vol 21 (3) ◽  
pp. 245-264 ◽  
Author(s):  
Laura C. García-Carnero ◽  
José A. Martínez-Álvarez ◽  
Luis M. Salazar-García ◽  
Nancy E. Lozoya-Pérez ◽  
Sandra E. González-Hernández ◽  
...  
Keyword(s):  
Immune System ◽  
Histoplasma Capsulatum ◽  
Paracoccidioides Brasiliensis ◽  
Sporothrix Schenckii ◽  
Clinical Importance ◽  
Pathogenic Fungi ◽  
Diagnostic Tools ◽  
Future Research ◽  
Host Immune System ◽  
Fungal Antigens

: By being the first point of contact of the fungus with the host, the cell wall plays an important role in the pathogenesis, having many molecules that participate as antigens that are recognized by immune cells, and also that help the fungus to establish infection. The main molecules reported to trigger an immune response are chitin, glucans, oligosaccharides, proteins, melanin, phospholipids, and others, being present in the principal pathogenic fungi with clinical importance worldwide, such as Histoplasma capsulatum, Paracoccidioides brasiliensis, Aspergillus fumigatus, Candida albicans, Cryptococcus neoformans, Blastomyces dermatitidis, and Sporothrix schenckii. Knowledge and understanding of how the immune system recognizes and responds to fungal antigens are relevant for the future research and development of new diagnostic tools and treatments for the control of mycosis caused by these fungi.

scholarly journals Molecular Subtyping of Blastocystis sp. Isolated from Farmed Animals in Southern Italy

2021 ◽  
Vol 9 (8) ◽  
pp. 1656
Author(s):  
Simona Gabrielli ◽  
Marialetizia Palomba ◽  
Federica Furzi ◽  
Emanuele Brianti ◽  
Gabriella Gaglio ◽  
...  
Keyword(s):  
Current Knowledge ◽  
Pcr Amplification ◽  
Epidemiological Studies ◽  
Fallow Deer ◽  
Small Subunit ◽  
Zoonotic Transmission ◽  
Ssu Rrna ◽  
Molecular Approaches ◽  
Wide Range ◽  
Blastocystis Sp

Blastocystis is a common intestinal protist distributed worldwide, infecting humans and a wide range of domestic and wild animals. It exhibits an extensive genetic diversity and, so far, 25 distinct small subunit ribosomal RNA (SSU rRNA) lineages termed subtypes (STs)) have been characterized; among them, 12 have thus far been reported in humans. The aims of the present study were to detect and genetically characterize Blastocystis sp. in synantropic animals to improve our current knowledge on the distribution and zoonotic transmission of Blastocystis STs in Italy. Samples were collected from N = 193 farmed animals and submitted to DNA extraction and PCR amplification of the SSU rRNA. Blastocystis was detected in 60 samples (31.08%) and successfully subtyped. Phylogenetic analysis evidenced that the isolates from fallow deer, goats, and pigs (N = 9) clustered within the ST5; those from pheasants (N = 2) in the ST6; those from chickens (N = 8) in the ST7; those from sheep (N = 6) in the ST10; and those from water buffaloes (N = 9) in the ST14 clade. The comparison between the present isolates from animals and those previously detected in humans in Italy suggested the animal-to-human spillover for ST6 and ST7. The present study represents the widest Blastocystis survey performed thus far in farmed animals in Italy. Further epidemiological studies using molecular approaches are required to determine the occurrence and distribution of Blastocystis STs in other potential animal reservoirs in Italy and to define the pathways of zoonotic transmission.

scholarly journals An overview of the epidemiology of periodontal diseases in Latin America

2007 ◽  
Vol 21 (spe) ◽  
pp. 8-15 ◽  
Author(s):  
Rui Vicente Oppermann
Keyword(s):  
Risk Factors ◽  
Latin America ◽  
Latin American ◽  
Oral Hygiene ◽  
Periodontal Diseases ◽  
Aggressive Periodontitis ◽  
Epidemiological Studies ◽  
Socioeconomic Background ◽  
Industrialized Countries ◽  
Modifiable Factors

The aim of the present review was to identify the presence of periodontal diseases and the relative importance of known risk factors in Latin American countries. The retrieved data are sparse and inconsistent, lacking information for the majority of the countries. Gingivitis is ubiquitous in the region, affecting all ages independently of the socioeconomic background. The extension of bleeding may vary greatly, ranging from 40% to 70% of sites. The prevalence of aggressive periodontitis is higher in Latin America than in industrialized countries. Prevalence ranges from 0.3% to 4.5%, and the localized form is the less prevalent. The prevalence of chronic periodontitis is high, with a large variation (40-80%) probably due to differences in methodology and diagnostic criteria. Regional differences may be relevant. Known risk factors are present in the populations studied. Non-modifiable factors such as age, gender and genetics have been associated in Brazilian and Chilean populations. Tobacco smoking and diabetes are relevant risk factors. The importance of socioeconomic status, although present as a risk factor, has been largely underestimated. Oral hygiene is extremely deficient in the area although it is a cultural habit in most populations. It can be concluded that periodontal diseases are highly prevalent in Latin American populations. Its prevalence and extent are associated with known risk factors. Oral hygiene habits are deficient. Well designed epidemiological studies with external validity are needed.

scholarly journals Molecular Identification of Aflatoxigenic Fungi in Some Foods from Selected Markets in Lagos

2020 ◽  
pp. 42-50
Author(s):  
Oluwatosin Bidemi Ajiboye ◽  
Wahab Oluwanisola Okunowo ◽  
Emmanuel Gboyega Ajiboye ◽  
Abiola Olajumoke Oyedeji
Keyword(s):  
Molecular Identification ◽  
Genomic Dna ◽  
Regulatory Gene ◽  
Pcr Amplification ◽  
High Specificity ◽  
Food Samples ◽  
Local Market ◽  
Nested Polymerase Chain Reaction ◽  
Aflatoxigenic Fungi ◽  
Food Commodities

Aflatoxigenic fungi are species of fungi that produce aflatoxins in food commodities. This study was aimed at screening different food samples in our local market for aflatoxigenic fungi using the aflatoxin regulatory gene (aflR gene). Six food samples (wheat, cowpea, rice, maize, melon and groundnut), were sourced from three different markets in Lagos metropolis (Mushin, Oyingbo and Mile 12). Fungi were isolated from these food samples and identified morphologically and microscopically. The genomic DNA was obtained using DNA isolation kits. The aflR gene was amplified from genomic DNA, nested, subjected to agarose gel electrophoresis and gel imaging. The Internal Transcribed Spacer (ITS) was also amplified from the genomic DNA for molecular identification of the organisms. The results showed that Aspergillus flavus were isolated from all the food samples from the three markets, while Aspergillus niger was present in rice, melon and wheat from Mile 12 market, maize and groundnut from Mushin market, rice and cowpea from Oyingbo market. A. flavus and A.niger were isolated from all the food samples when similar food samples from different market were mixed together. Only A. flavus amplicon from the nested polymerase chain reaction (PCR) showed approximately 400bp DNA fragment on the gel. This study has shown that PCR amplification of aflR gene has high specificity for detection of aflatoxigenic fungi in food samples thus, may be employed in screening food samples for contamination by aflatoxigenic fungi.

FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL

Jurnal BIOMA ◽  
2017 ◽  
Vol 13 (1) ◽  
pp. 33-36
Author(s):  
Rini Puspitaningrum ◽  
Ria Amelia ◽  
Adisyahputra Adisyahputra
Keyword(s):  
Molecular Markers ◽  
Glycine Max ◽  
Molecular Marker ◽  
Pcr Amplification ◽  
Housekeeping Gene ◽  
Descriptive Study ◽  
Gene Fragment ◽  
Lectin Gene ◽  
Glycine Max L

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.

Paracoccidioides brasiliensis

2012 ◽  
pp. 171-173
Author(s):  
Janis E Blair
Keyword(s):  
Latin America ◽  
South America ◽  
Central America ◽  
Paracoccidioides Brasiliensis ◽  
Skin Lesions ◽  
Diagnosis And Treatment ◽  
Subtropical Forests ◽  
Mucosal Lesions

Paracoccidioides brasiliensis is found only in Latin America. It is endemic in Mexico, Central America, and South America. Most cases (80%) have been reported from Brazil, followed by Venezuela, Colombia, Ecuador, and Argentina. Most cases occur in tropical and subtropical forests, where temperatures are mild and humidity is high throughout the year. Infection can be asymptomatic or can cause mucosal lesions involving the mouth, lips, tongue or nose. It can also cause lymphadenopathy, dyspnea, cough, and skin lesions. Diagnosis and treatment are also reviewed.

Sign in / Sign up

Export Citation Format

Share Document