Productivity of three varieties of local upland rice on swidden agriculture field in Setulang village, North Kalimantan, Indonesia

2019 ◽  
Vol 21 (1) ◽  
Author(s):  
OKTIANI PERIDA MERANG ◽  
Abubakar M. Lahjie ◽  
SYAHRIR YUSUF ◽  
YOSEP RUSLIM
Keyword(s):  
Sampling Method ◽  
Upland Rice ◽  
Total Production ◽  
Swidden Agriculture ◽  
Rice Varieties ◽  
Dry Land ◽  
Cultivation System ◽  
Fallow Period ◽  
Maximum Production ◽  
One Year

Abstract. Merang OP, Lahjie AM, Yusuf S, Ruslim Y. 2020. Productivity of three varieties of local upland rice on swidden agriculture field in Setulang village, North Kalimantan, Indonesia. Biodiversitas 21: 49-56. Swidden agriculture field is a dry land used by traditional farmers to cultivate some varieties of local upland rice intercropped with vegetables, tubers, and fruits. This rotational cultivation system utilizes the land for planting such food crops in one year period before it is left for fallow periods for years. This study aimed to assess the productivity of local upland rice varieties (i.e. Langsat rice, Telang Usan rice, and Pimping rice) cultivated on swidden agriculture field in regard to the fallow periods. This study was conducted in Setulang village, Malinau District, North Kalimantan Province and employed purposive sampling method using interviews of selected respondents and field observation. Among three varieties of rice in this study, Langsat rice had the longest fallow period with 17 years while Pimping rice had the shortest fallow period with 13 years, with the maximum production were 2,635 kg ha-1 and 1,670 kg ha-1, respectively. Meanwhile, Telang Usan rice reached the maximum production on fallow period of 15 years with the total production of 2,208 kg ha-1. Overall, of the three types of rice planted, the results show that the longer the fallow period, the higher the rice production and the shorter the fallow period, the lower the production. Each type of rice has a different amount of production, although it is planted during the same fallow period.

scholarly journals Study on the Adaptation of Superior and Local Upland Rice Varieties (Oriza sativa) in Dry Climate of West Southeast Moluccas Border Region of Country

2019 ◽  
Vol 7 (1) ◽  
pp. 163
Author(s):  
Sheny S. Kaihatu ◽  
Wahid Wahid ◽  
Edwen D. Waas ◽  
Marthen P. Sirappa
Keyword(s):  
Plant Density ◽  
Upland Rice ◽  
Block Design ◽  
Border Region ◽  
The West ◽  
Rice Varieties ◽  
Local Varieties ◽  
Dry Land ◽  
Yield Increase ◽  
New Varieties

This study on the adaptation of superior and local upland rice on dry climate was carried out from July to October 2017 at the West Southeast Moluccas Main Seed Center involving 15 members of the Webat Farmer Groups. The aim of this study was to obtain adaptive superior and local varieties that could potentially be developed in dry climates (dry land) in the region. Field assessments were done usinged a Randomized Block Design with eight treatments (superior and local varieties of upland rice) and repeated three times. The five superior varieties assessed were Towuti, Inpago 8, Inpago 9, Inpago 10, and Inpago 11 and the three local varieties used were Red Tanimbar, White Tanimbar, and Black Tanimbar. The results of the study showed that the average productivity of superior new varieties of upland rice higher yields (2.03 t ha-1) compared to local varieties (1.24 t ha-1), revealing a yield increase of 63.71 %. Results suggest that there are five varieties of upland rice that have potential to be developed in the West Southeast Moluccas Border Region, namely Inpago 9, Inpago 10, and Inpago 11 (superior new varieties), and Red Tanimbar and White Tanimbar (local varieties). However, the yields obtained in this assessment are still low because the number of productive tillers is also low. This could be due to low plant density caused by the very small number of seeds used per planting hole, and the effect of legowo 2: 1 planting system with a very wide.

scholarly journals PENGARUH BIAYA PRODUKSI TERHADAP PENDAPATAN USAHATANI PADI LADANG DI KAMPUNG LINGGANG MELAPEH KECAMATAN LINGGANG BIGUNG KABUPATEN KUTAI BARAT (The Influence of Production Cost to Swidden Cultivation Income in Linggang Melapeh Village Linggang Bigung Subdistrict West Kutai District)

2018 ◽  
Vol 1 (1) ◽  
pp. 54
Author(s):  
WENI ATPRIANI ◽  
SYARIFAH AIDA ◽  
NDAN IMANG
Keyword(s):  
Random Sampling ◽  
Production Cost ◽  
Sampling Method ◽  
Secondary Data ◽  
Simple Random Sampling ◽  
Swidden Agriculture ◽  
Swidden Cultivation ◽  
Average Income ◽  
Crop Season ◽  
Dry Land

Swidden agriculture is a kind of agricultural attempt to function the dry land, without using too much water. This research attempted to discover the production cost, income, and profit of the unirrigated ricefield and to discover the effect of production cost on profit of unirrigated agricultural ricefields. Sampling method in this research was simple random sampling, the total respondents is 38 farmers who use the method of unirrigated agricultural ricefield. Data that have been taken in this research were primary and secondary data. The results of this research shows the profit of unirrigated ricefield farming was IDR193,788,583.32 crop season-1 with the average profit of IDR4,680,321.22 ha-1. The income of farmers was IDR522,047,500.00 crop season-1 with the average income of IDR12,621,208.26 ha-1. The production cost was IDR328,273,916.68 crop season-1 with average cost of IDR7,941,133.75 ha-1. The conclusion of this research was the production cost influences the profit of unirrigated agricultural ricefield as much as 54.9%, meanwhile 45.1% was influenced by other factors.

scholarly journals Verifikasi Lokus Aluminum Tolerance (Alt) pada Tiga Populasi BC3F1 Padi

2019 ◽  
Vol 47 (1) ◽  
pp. 9-17
Author(s):  
Muhammad Rauful Mizan ◽  
Desta Wirnas ◽  
Dan Joko Prasetiyono
Keyword(s):  
Upland Rice ◽  
Aluminum Tolerance ◽  
Al Toxicity ◽  
Marginal Lands ◽  
Rice Varieties ◽  
Dry Land ◽  
P Deficiency ◽  
Materials Used ◽  
Nutrient Solutions ◽  
Recipient Parent

Most of marginal lands in Indonesia are in the form of acid dry land with low available P and high Al concentrations. Development of tolerant rice varieties to P deficiency and Al toxicity is one way to increase rice production. This study aimed to select BC3F1-Pup1+Alt genotypes from three crosses based on foreground and background markers. This research was conducted at the Indonesian Center for Agricultural Biotechnology and Genetic Resources Research and Development, Bogor, from August to December 2015. The materials used were 300 genotypes of BC3F1 Dodokan-Pup1+Alt, BC3F1 Situ Bagendit-Pup1+Alt, BC3F1 Batur-Pup1+Alt, and the parents. The research included selection in modified Yoshida’s nutrient solutions (0.5 ppm P dan 60 ppm Al) followed by foreground selection and background selection. Selection using Yoshida’s nutrient solution resulted in 150 genotypes with longer root than the recipient parent in each of the BC3F1 populations. Selection with foreground markers using markers RM1361 and RM12031 produced 85 genotypes of BC3F1 Dodokan-Pup1+Alt (56.6%), 105 genotypes of BC3F1 Situ Bagendit-Pup1+Alt (70%), and 77 genotypes of BC3F1 Batur-Pup1+Alt (51.33%). Selection using background markers revealed that genotype number 116 (BC3F1 Dodokan-Pup1+Alt), number 2 (BC3F1 Situ Bagendit-Pup1+Alt), and number 129 (BC3F1 Batur-Pup1+Alt) were the best genotypes with percentage of parent recovery of 95%, 90%, and 90.5%, respectively. These three genotypes were verified to have Alt loci and had the largest genetic proportion of restoring parents. Keywords: Alt, background markers, foreground markers, Pup1, upland rice

scholarly journals PENGARUH BIAYA PRODUKSI TERHADAP PENDAPATAN USAHATANI PADI LADANG DI KAMPUNG LINGGANG MELAPEH KECAMATAN LINGGANG BIGUNG KABUPATEN KUTAI BARAT (The Influence of Production Cost to Swidden Cultivation Income in Linggang Melapeh Village Linggang Bigung Subdistrict West Kutai District)

2018 ◽  
Vol 1 (1) ◽  
pp. 54
Author(s):  
WENI ATPRIANI ◽  
SYARIFAH AIDA ◽  
NDAN IMANG
Keyword(s):  
Random Sampling ◽  
Production Cost ◽  
Sampling Method ◽  
Secondary Data ◽  
Simple Random Sampling ◽  
Swidden Agriculture ◽  
Swidden Cultivation ◽  
Average Income ◽  
Crop Season ◽  
Dry Land

Swidden agriculture is a kind of agricultural attempt to function the dry land, without using too much water. This research attempted to discover the production cost, income, and profit of the unirrigated ricefield and to discover the effect of production cost on profit of unirrigated agricultural ricefields. Sampling method in this research was simple random sampling, the total respondents is 38 farmers who use the method of unirrigated agricultural ricefield. Data that have been taken in this research were primary and secondary data. The results of this research shows the profit of unirrigated ricefield farming was IDR193,788,583.32 crop season-1 with the average profit of IDR4,680,321.22 ha-1. The income of farmers was IDR522,047,500.00 crop season-1 with the average income of IDR12,621,208.26 ha-1. The production cost was IDR328,273,916.68 crop season-1 with average cost of IDR7,941,133.75 ha-1. The conclusion of this research was the production cost influences the profit of unirrigated agricultural ricefield as much as 54.9%, meanwhile 45.1% was influenced by other factors.

scholarly journals Produktivitas Tumpangsari Kedelai dengan Jagung pada Akhir Musim Hujan di Lahan Kering Beriklim Kering (Productivity of Soybean Intercropping with Maize at the End of Rainy Season in Dry Land with Dry Climate )

JURNAL PANGAN ◽  
2021 ◽  
Vol 29 (3) ◽  
pp. 197-210
Author(s):  
Afandi Kristiono ◽  
Siti Muzaiyanah ◽  
Dian Adi Anggraeni Elisabeth ◽  
Arief Harsono
Keyword(s):  
Rainy Season ◽  
Upland Rice ◽  
Cropping Pattern ◽  
Total Production ◽  
Double Row ◽  
Dry Land ◽  
Land Equivalent Ratio ◽  
Self Sufficiency ◽  
Planting Method ◽  
Low Precipitation

ABSTRAK Luas panen kedelai di Indonesia pada 2017 hanya mencapai 355.799 ha dengan produksi 538.728 ton. Untuk mencapai swasembada, luas panen tersebut harus dapat ditingkatkan menjadi 1,2 juta ha dengan produktivitas 1,6 ton/ha. Peningkatan luas panen kedelai dapat dilakukan pada lahan kering dan iklim kering yang pemanfaatannya belum maksimal. Penelitian ini bertujuan untuk mengevaluasi produktivitas dan kelayakan teknis paket teknologi budidaya kedelai tumpang sari dengan jagung di lahan kering beriklim kering. Penelitian dilaksanakan pada musim hujan (MH) 2017/2018 di Kecamatan Tegaldlimo, Kabupaten Banyuwangi, Jawa Timur pada zona iklim D3 (3–4 bulan basah/tahun) dengan jenis tanah vertisol, mengikuti pola tanam padi gogo – jagung. Hasil penelitian menunjukkan bahwa cara tanam tumpang sari kedelai dengan jagung baris ganda setelah panen padi gogo, mampu memberikan hasil biji jagung kering 2,03 ton/ha dan kedelai 1,50 ton/ha. Cara tanam ini lebih menguntungkan daripada tanam jagung atau kedelai monokultur yang berturut-turut memberikan hasil 3,50 ton/ha dan 1,85 ton/ha biji kering. Hasil kedelai dan jagung pada saat penelitian tidak maksimal karena selama pertumbuhan curah hujan hanya 194 mm, sehingga tanaman terutama jagung mengalami cekaman kekeringan. Keuntungan usahatani kedelai monokultur, jagung monokultur, dan kedelai tumpang sari dengan jagung berturut-turut adalah Rp8.633.500,00; Rp5.039.400,00; dan Rp11.090.600,00 per ha. Tumpang sari kedelai dengan jagung mampu memanfaatkan lahan lebih efisien dengan Nilai Kesetaraan Lahan (NKL) 1,39. kata kunci: jagung, kedelai, lahan kering beriklim kering, tumpang sari ABSTRACT Soybean harvested area in Indonesia in 2017 only reached 356,799 ha with a total production of 538,728 tons. To achieve self-sufficiency, the harvested area must be increased to 1.2 million ha with a productivity of 1.6 tons/ha. To increase the harvested area, soybean can be developed in a dry land with dry climate that has not been utilized optimally. The study aimed to evaluate the productivity and technical feasibility of soybean intercropping with maize in a dry land with a dry climate. The study was conducted in the rainy season of 2017/2018 at Tegaldlimo Sub-district, Banyuwangi Regency, East Java Province in the D3 climate zone (3–4 wet months/year) at vertisol soil using the cropping pattern of upland rice-maize.The results indicated that soybean is intercropping with maize in a double row after upland rice harvesting was able to provide the dry seeds yield of maize 2.03 tons/ha and soybean 1.50 tons/ha. This planting method was more profitable compared to maize monoculture yielding 3.50 tons/ha or soybean monoculture yielding 1.85 tons/ha dry seeds yield. The yields of soybean and maize in the study were not optimal due to low precipitation to only 194 mm during the plant growth, so the crops, particularly the maize experienced drought stress. The benefits of soybean monoculture, maize monoculture, and soybean intercropping with maize farming were 8,633,500 IDR, 5,039,400 IDR, and 11,090,600 IDR per ha, respectively. The soybean intercropping with maize was also able to utilize land more efficiently with a Land Equivalent Ratio (LER) of 1.39. keywords: maize, soybean, dry land with dry climate, intercropping

scholarly journals Agronomic Response of Local Upland Rice Cultivars on Growing under Two Cultivation Systems

2021 ◽  
Author(s):  
La Ode Afa ◽  
Arsyi Aysya Anas ◽  
Laode Sabaruddin ◽  
Andi Bahrun ◽  
Made Widana Arsana ◽  
...  
Keyword(s):  
Food Security ◽  
Rice Field ◽  
Upland Rice ◽  
Rice Cultivars ◽  
Production Potential ◽  
Dry Land ◽  
Cultivation System ◽  
Cultivation Systems ◽  
Self Sufficiency ◽  
System L

Background: This study aimed to observe the agronomic response of 18 Southeast Sulawesi local upland rice cultivars that were grown under two cultivation systems (dry land and wet rice field) and optimize local potential to support self-sufficiency and food security. Methods: The research used a split-plot design with the following main plot: cultivation system (L) including upland (L1) and rice field cultivation system (L2). The subplots were 18 local upland rice cultivars such as Wangkomina (K1), Wuna Lapodidi (K2), Waburi-buri (K3), Wapantoga (K4), Nggalaru (K5), Wuna Parigi (K6), Bakala (K7), Biu (K8), Ikulaku (K9), Bou (K1), Momea (K11), Daindomoronene (K12), Konkep (K13), Tinangge (K14), Ndoamoito (K15), Uwa (K16), Ndowatu (K17) and Indalibana (K18). Result: The local upland rice responded better to the wetland cultivation system than the upland cultivation system. The local upland rice cultivar Ndowatu showed the highest production potential, which was statistically similar to the Biu, Ikulaku, Momea, Konkep and Uwa cultivars. Ndowatu cultivar showed high production potential (842.80 g.m-2). Thus, this cultivar can be considered suitable for development in the rainfed lowlands to increase the planting index and to support the self-sufficiency and food security of the region.

scholarly journals Identification of Drought Tolerant and Molecular Analysis of DREB2A and BADH2 Genes and Yield Potensial of Lines from Single Crossing Bengkulu Local Rice Varieties

2021 ◽  
Vol 22 (2) ◽  
Author(s):  
Reny Herawati ◽  
ALNOPRI ALNOPRI ◽  
MASDAR MASDAR ◽  
MARULAK SIMARMATA ◽  
SIPRIYADI SIPRIYADI ◽  
...  
Keyword(s):  
Molecular Analysis ◽  
Evaluation System ◽  
Upland Rice ◽  
Pcr Amplification ◽  
Severe Drought ◽  
Potential Yield ◽  
Rice Varieties ◽  
Dry Land ◽  
Oligonucleotide Primers ◽  
Drought Tolerant

Screening in the seedling stage of 39 progeny of F6 lines to drought stress was carried out in the greenhouse.  Drought tolerant and sensitive varieties of IR 20 and Salumpikit, respectively, were used as control plants.  The methods for traits identification of leaf curled, dried, and recovery ability after exposure to severe drought for two weeks was following the Standard Evaluation System (SES) developed by IRRI.  Molecular analysis to detect the presence of the DREB2A gene was carried out by PCR amplification of genomic DNA using forward- and reverse- oligonucleotide primers of CCTCATTGGGTCAGGAAGAA and GGATCTCAGCCACCCACTTA, respectively, while for BADH2 gene using forward- and reverse- oligonucleotide primers of GGCCAAGTACCTCAAGGCGA and TGTCCCCAGCTGCTTCATCC, respectively.  Molecular markers of DREB2A and BADH2 genes were also identified in 39 tested lines with approximately 250 and 2300 bp length, respectively.  This study concluded that the progeny of F6 lines generating from the crossing of local varieties of IR7858 and IR148 is the potential to become a drought-tolerant variety of upland rice. Line numbers BKL2 B-2-264-6 and BKL4 B-1-268-10 have a potential yield of more than 12 tonnes/ha. These line has the potential to be developed on rainfed lowland rice or dry land because it has drought resistance.

scholarly journals Physiological Response of Upland Rice Varieties to Furrow with Organic Matter on Agroforestry System with Kayu Putih (Melaleuca leucadendra L.)

2019 ◽  
Vol 34 (2) ◽  
pp. 223
Author(s):  
Puji Lestari Tarigan ◽  
Tohari Tohari ◽  
Priyono Suryanto
Keyword(s):  
Plant Physiology ◽  
Organic Matter ◽  
Drought Stress ◽  
Upland Rice ◽  
Agroforestry System ◽  
Rice Varieties ◽  
Dry Land ◽  
Organic Matters ◽  
Water Transportation ◽  
Significant Difference

<p>Drought is one of the major limitations in dry land cultivation. Drought affects plant physiology processes such as photosynthesis, respiration, mineral and water transportation, and transpiraton, briefly called drought stress. Drought stress can be avoided by managing environment. Furrow containing organic matter for rain fed rice has been the subject of many studies, with special emphasis on soil moisture. This research is aimed to know the effects of the furrow containing organic matter on physiological responses of several upland rice varieties on agroforestry system based on <em>k</em><em>ayu putih</em> (cajuput). The experimental design applied the strip plot design. The vertical factor is the furrow system of treatment consisting of 2 levels i.e. without furrow + without organic matter and furrow + organic matters. The horizontal factors are the upland rice varieties consisting of 3 varieties i.e. Situ Patenggang, Situ Bagendit and Ciherang. The collected data were analyzed by Analysis of Variance (ANOVA) applying a level of significance α = 5%. Whenever significant differences among treatments were found, further analysis was carried out by applying the Tukey's HSD (Honestly Significant Difference) test α = 5% levels. The result shows that drought affects plant physiology and can be avoided by using furrow containing organic matters. Situ Patenggang with furrow containing organic matters has the higher physiology capability, it had photosynthesis 387.18 µmol CO<sub>2 </sub>per clump s<sup>-1</sup>, transpiration 3038.50 mg per clump per secondand CO<sub>2 </sub>721.11 mol CO<sub>2</sub> clump per mol. There different plant requirements for Cu between varieties.</p>

scholarly journals Upland rice productivity and farming feasibility between the palm oil plant in dry land on Jambi Province

2021 ◽  
Vol 232 ◽  
pp. 01015
Author(s):  
Jumakir ◽  
Julistia Bobihoe ◽  
Waluyo ◽  
Endrizal
Keyword(s):  
Drought Stress ◽  
Palm Oil ◽  
Oil Palm ◽  
Financial Analysis ◽  
Upland Rice ◽  
Growth And Yield ◽  
Rice Varieties ◽  
Dry Land ◽  
Oil Plant ◽  
C Value

The objectives of the study are (1) to find out the growth and productivity of upland rice, (2) to find out high upland rice varieties and the feasibility of farming between upland oil palm plants. This activity was carried out in the area of young oil palm plantations aged 2 years in Pelayangan Village, Muara Tembesi sub District, Batanghari District, Jambi Province from May to August 2016. The rice varieties were Inpago 5, Inpago 8, Inpago 9 and local upland rice with 1 ha area. The results of the study showed that the Inpago 9 variety gave the highest yield of 3.53 t/ha. The results of financial analysis show that Inpago 9 variety provides the highest income with an R/C value of 1.54. Inpago 9 variety has better growth and yield and resistance to drought stress than other varieties and is suitable for development in dry land. Inpago 9 variety has better growth and yield and resistance to drought stress than other varieties and is suitable for development in dry land.

Sign in / Sign up

Export Citation Format

Share Document