scholarly journals Assessment of Arbuscular Mycorrhizal Association in Some Fruit Plants in Bangladesh

1970 ◽  
Vol 24 (1) ◽  
pp. 34-37 ◽  
Author(s):  
Delowara Khanam
Keyword(s):  
Arbuscular Mycorrhiza ◽  
Agricultural Research ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Citrus Limon ◽  
Syzygium Jambos ◽  
Mycorrhizal Association ◽  
Spore Population ◽  
Fruit Plants ◽  
Annona Reticulata

 Rhizosphere soils of 19 fruit plants from horticultural farm of Bangladesh Agricultural Research Institute (BARI), Joydebpur, Gazipur were assessed for arbuscular mycorrhiza (AM) spore population and determining colonization in their roots. The spore numbers recorded ranged from 48.0 (Citrus limon) to 1,050 (Annona reticulata) per 100 g soil in 2004, 41.0 (Citrus grandis) to 916.7 (Phyllanthus emblica) in 2005 and 44.3 (Citrus grandis) to 575.0 (Syzygium samarangense, white) in 2006. A considerable variation was observed in average spore numbers recorded in three consecutive years. Different fruit plants showed different percentages of root colonization by AM fungi. Among all the fruit plants, the highest colonization (86.7%) was found in Syzygium jambos and Elaeocarpus floribundus and the lowest colonization (20.0%) was recorded in Syzygium samarangense (red). Keywords: Arbuscular mycorrhiza (AM), Colonization, Spore population, Fruit plantsDOI: http://dx.doi.org/10.3329/bjm.v24i1.1234 Bangladesh J Microbiol, Volume 24, Number 1, June 2007, pp 34-37

scholarly journals Assessment of arbuscular mycorrhizal association in some fruit and spice plants of Rangamati hill district

2017 ◽  
Vol 42 (2) ◽  
pp. 221-232 ◽  
Author(s):  
MAH Bhuiyan ◽  
MB Banu ◽  
M Rahman
Keyword(s):  
Rhizosphere Soil ◽  
Agricultural Research ◽  
Spherical Shape ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Research Station ◽  
Mycorrhizal Association ◽  
Fungal Structure ◽  
Hill District ◽  
Spore Population

Rhizosphere soils of some fruit and spice plants from the Hill Agricultural Research Station, Bangladesh Agricultural Research Institute, Raikhali, Rangamati were collected during 2011-12 and 2012-13 for counting Arbuscular Mycorrhizal (AM) spore population, determining colonization (%) in their roots and studying AM structure. Assessment of spore population was done by following the Wet Sieving and Decanting Method. The percentage of AM infection was estimated by root slide technique. The spore number of 100g rhizosphere soil was recorded ranging from 120 in rhizosphere soil of Malta plant to a maximum of 410 in Atafal and Sofeda plants during 2011-12 and from 75 in rhizosphere soil of Phalsa plant to a maximum of 327 in Amlaki plant during 2012-13. Different fruit and spice plants showed different percentages of root colonization by AM fungi. Among the fruit and spice plants, the highest colonization (40%) was found in Jabotica, Phalsa and Sofeda plant, and the lowest colonization (6.6%) was found in Rambutan plant during 2011-12, but in 2012-13 the highest (61.3%) was result was observed in Bilatigab plant and the lowest (18.7%) was in Misti lebu, Malta and Tetul plant. The AM fungal structure in the root system of the selected fruit and spice plants varied in irrespective of fruit and spice species. Some plants had vesicles. Hyphae were present in most of the plants. Some plant species recorded Arbuscules. Both oval and spherical shape vesicles were found in this study.Bangladesh J. Agril. Res. 42(2): 221-232, June 2017

scholarly journals Mycorrhizal association and influence on growth of Asian pigeonwings (Clitoria ternatea L.)

2017 ◽  
Vol 6 (06) ◽  
pp. 5415
Author(s):  
Mane S. R. ◽  
Kumbhar V. R. ◽  
Birajdar G. M. ◽  
Naryankar R. S. ◽  
Gavali M. T. ◽  
...  
Keyword(s):  
Root Colonization ◽  
Biomass Productivity ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Spore Density ◽  
Clitoria Ternatea ◽  
Treated Condition ◽  
Mycorrhizal Association ◽  
Maximum Root ◽  
Herbal Medicinal

Clitoria ternatea L. is an excellent herbal medicinal plant. Arbusular Mycorrhizal fungal (AMF) colonization and biomass of three different tested conditions of Clitoria ternatea plant was investigated. Inoculums of indigenous AMF and Trichoderma harzianum was tested greenhouse experiment and compared with natural condition after 60th days of treatment. Percentage of Arbuscular mycorrhizal (AM) infection, number of resting spores and AM fungi species varies in different land. Among three different conditions, natural conditions showed maximum root colonization (75.89%) than treated one but minimum spore density (358.8/100gsoil). Highest spore density (481.6/100g soil) was found in T. harzianum treated condition followed by indigenous AMF treatment Acaulospora Glomus and Sclerocystis these three genera were found frequently. AMF inoculums and T.harzianum treatments conditions were observed promising biomass data of 60th days after treatment (DAT).When AMF are more colonized to plants then enhanced the biomass productivity.

scholarly journals Carbon investment into mobilization of mineral and organic phosphorus by arbuscular mycorrhiza

2020 ◽  
Vol 57 (1) ◽  
pp. 47-64
Author(s):  
Alberto Andrino ◽  
Georg Guggenberger ◽  
Leopold Sauheitl ◽  
Stefan Burkart ◽  
Jens Boy
Keyword(s):  
Fatty Acid ◽  
Arbuscular Mycorrhiza ◽  
Mycorrhizal Fungi ◽  
Organic Phosphorus ◽  
Phospholipid Fatty Acid ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
P Availability ◽  
Organic C ◽  
P Deficiency

AbstractTo overcome phosphorus (P) deficiency, about 80% of plant species establish symbiosis with arbuscular mycorrhizal fungi (AMF), which in return constitute a major sink of photosynthates. Information on whether plant carbon (C) allocation towards AMF increases with declining availability of the P source is limited. We offered orthophosphate (OP), apatite (AP), or phytic acid (PA) as the only P source available to arbuscular mycorrhiza (AM) (Solanum lycopersicum x Rhizophagus irregularis) in a mesocosm experiment, where the fungi had exclusive access to each P source. After exposure, we determined P contents in the plant, related these to the overall C budget of the system, including the organic C (OC) contents, the respired CO2, the phospholipid fatty acid (PLFA) 16:1ω5c (extraradical mycelium), and the neutral fatty acid (NLFA) 16:1ω5c (energy storage) at the fungal compartment. Arbuscular mycorrhizal (AM) plants incorporated P derived from the three P sources through the mycorrhizal pathway, but did this with differing C-P trading costs. The mobilization of PA and AP by the AM plant entailed larger mycelium infrastructure and significantly larger respiratory losses of CO2, in comparison with the utilization of the readily soluble OP. Our study thus suggests that AM plants invest larger C amounts into their fungal partners at lower P availability. This larger C flux to the AM fungi might also lead to larger soil organic C contents, in the course of forming larger AM biomass under P-limiting conditions.

scholarly journals Response of Arbuscular Mycorrhizal Fungi to Hydrologic Gradients in the Rhizosphere ofPhragmites australis(Cav.) Trin ex. Steudel Growing in the Sun Island Wetland

2015 ◽  
Vol 2015 ◽  
pp. 1-9 ◽  
Author(s):  
Li Wang ◽  
Jieting Wu ◽  
Fang Ma ◽  
Jixian Yang ◽  
Shiyang Li ◽  
...  
Keyword(s):  
Host Plant ◽  
Mycorrhizal Fungi ◽  
Plant Biomass ◽  
Growth Parameters ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
The Sun ◽  
Vegetative Period ◽  
Hydrologic Gradients ◽  
Mycorrhizal Association

Within the rhizosphere, AM fungi are a sensitive variable to changes of botanic and environmental conditions, and they may interact with the biomass of plant and other microbes. During the vegetative period of thePhragmites australisgrowing in the Sun Island Wetland (SIW), the variations of AM fungi colonization were studied. Root samples of three hydrologic gradients generally showed AM fungi colonization, suggesting that AM fungi have the ability for adaptation to flooded habitats. There were direct and indirect hydrological related effects with respect to AM fungi biomass, which interacted simultaneously in the rhizosphere. Though water content in soil and reed growth parameters were both positively associated with AM fungi colonization, only the positive correlations between reed biomass parameters and the colonization could be expected, or both the host plant biomass and the AM fungi could be beneficial. The variations in response of host plant to the edaphic and hydrologic conditions may influence the effectiveness of the plant-mycorrhizal association. This study included a hydrologic component to better assess the role and distribution of AM fungi in wetland ecosystems. And because of that, the range of AM fungi was extended, since they actually showed a notable adaptability to hydrologic gradients.

scholarly journals Performances of different sources of arbuscular mycorrhiza on tomato (Lycopersicon esculentum) seedlings

2014 ◽  
Vol 39 (1) ◽  
pp. 23-31
Author(s):  
MAH Bhuiyan ◽  
ME Ali ◽  
MR Khatun ◽  
F Alam ◽  
MB Banu
Keyword(s):  
Lycopersicon Esculentum ◽  
Arbuscular Mycorrhiza ◽  
Nutrient Uptake ◽  
Growth And Development ◽  
Biomass Yield ◽  
Agricultural Research ◽  
Am Fungi ◽  
Agricultural Research Institute ◽  
Tomato Seedlings ◽  
Different Sources

An experiment on the effect of different sources of Arbuscular mycorrhiza (AM) fungi on tomato seedlings (var. Roma VF) was conducted at the Bangladesh Agricultural Research Institute, Gazipur during rabi 2007-08 and 2008-09. Eight sources of AM fungi viz., AM-01 (Jessore), AM-02 (Rahmatpur), AM-03 (Joydebpur), AM-04 (Ullapara), AM-05 (Jamalpur), AM-06 (Hathazari), AM-07 (Ishurdi), and AM-08 (Rajshahi) were studied along with a control and mixed sources on tomato seedlings. Soil based AM inoculum at the rate of 2.0 kg/m2 was used. Biomass yield of tomato (Roma VF) increased from 14.8% to 53.6% in 2007-08 and 32.1% to 58.4% in 2008-09 over control by inoculation with different sources of AM. The highest biomass yield (301 mg/seedling) of tomato (Roma VF) was observed with AM-05 (Jamalpur source), which was higher to all AM sources except AM-07 (Ishurdi source). Nutrient uptake by tomato seedlings was improved by inoculation with AM fungi. The AM fungi from all the sources appeared to be effective in enhancing the growth and development of tomato seedlings. DOI: http://dx.doi.org/10.3329/bjar.v39i1.20067 Bangladesh J. Agril. Res. 39(1): 23-31, March 2014

scholarly journals First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

2016 ◽  
Vol 5 (1) ◽  
pp. 53-53
Author(s):  
Antonios Zambounis ◽  
Aliki Xanthopoulou ◽  
Filippos A. Aravanopoulos ◽  
Athanasios Tsaftaris ◽  
Evaggelos Barbas
Keyword(s):  
Mycorrhizal Fungi ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
First Record ◽  
Thuja Plicata ◽  
Allium Porrum ◽  
Northern Greece ◽  
Funneliformis Mosseae ◽  
Mycorrhizal Association

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

scholarly journals STUDIES ON THE ARBUSCULAR MYCORRHIZAL FUNGAL DIVERSITY OF SELECTED MEDICINAL PLANT SPECIES FROM KODIKUTHIMALA, MALAPPURAM, KERALA

2017 ◽  
Vol 4 (3) ◽  
pp. 51-58
Author(s):  
Aiswarya N.K ◽  
Muthuraj K ◽  
Siva Priya K.T ◽  
Krishnan E ◽  
Nagarajan N
Keyword(s):  
Plant Species ◽  
Arbuscular Mycorrhizal ◽  
Fungal Species ◽  
Commelina Benghalensis ◽  
Mycorrhizal Association ◽  
Spore Population ◽  
Fungal Association ◽  
Arbuscular Mycorrhizal Fungal ◽  
Sida Rhombifolia ◽  
Rhizophagus Fasciculatus

The present investigation has brought out the AM fungal association in some plant species of Kodikuthimala, Malappuram district Kerala. Totally, 25 plant species belongs to 15 families were analyzed for arbuscular mycorrhizal association. The root samples of all collected plant species showed mycorrhizal infection. The percentage of colonization was varied with plant species and it ranges from 12 (Commelina benghalensis) to 79% (Sida rhombifolia). Maximum spore population was observed in Gloriosa superba (574/100g of soil) and minimum in Euphorbia hirta (143/10g of soil). Totally 26 AM fungal species belongs to 13 genera were found. Among this Glomus was most dominated. In most of the plants, spores of Rhizophagus fasciculatus are seen. Present study confirms the Arbuscular Mycorrhizal association in the collected plant species.

scholarly journals Nitrogen Fertilisation Increases Specific Root Respiration in Ectomycorrhizal but Not in Arbuscular Mycorrhizal Plants: A Meta-Analysis

2021 ◽  
Vol 12 ◽  
Author(s):  
Bahareh Bicharanloo ◽  
Timothy R. Cavagnaro ◽  
Claudia Keitel ◽  
Feike A. Dijkstra
Keyword(s):  
Root Respiration ◽  
Meta Analysis ◽  
Soil Nutrient ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
P Uptake ◽  
N Availability ◽  
Mycorrhizal Associations ◽  
Mycorrhizal Association ◽  
Multi Level

Plants spend a high proportion of their photosynthetically fixed carbon (C) belowground to support mycorrhizal associations in return for nutrients, but this C expenditure may decrease with increased soil nutrient availability. In this study, we assessed how the effects of nitrogen (N) fertiliser on specific root respiration (SRR) varied among mycorrhizal type (Myco type). We conducted a multi-level meta-analysis across 1,600 observations from 32 publications. SRR increased in ectomycorrhizal (ECM) plants with more than 100 kg N ha−1 applied, did not change in arbuscular mycorrhizal (AM) and non-mycorrhizal (NM) plants, but increased in plants with a dual mycorrhizal association in response to N fertilisation. Our results suggest that high N availability (>100 kg N ha−1) could disadvantage the growth of ECM plants because of increased C costs associated with maintaining higher root N concentrations, while the insensitivity in SRR by AM plants to N fertilisation may be because AM fungi are more important for phosphorus (P) uptake.

Arbuscular mycorrhiza on root-organ cultures

2002 ◽  
Vol 80 (1) ◽  
pp. 1-20 ◽  
Author(s):  
J André Fortin ◽  
Guillaume Bécard ◽  
Stéphane Declerck ◽  
Yolande Dalpé ◽  
Marc St-Arnaud ◽  
...  
Keyword(s):  
Arbuscular Mycorrhiza ◽  
Culture Media ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Extraradical Mycelium ◽  
Organ Cultures ◽  
Similar System ◽  
Inoculation Techniques ◽  
Potential Use

The study of arbuscular mycorrhizal (AM) fungi and the AM symbiosis formed with host plant roots is complicated by the biotrophic and hypogeous nature of the mycobionts involved. To overcome this, several attempts have been made during the last three decades to obtain this symbiosis in vitro. The use of root-organ cultures has proved particularly successful. In this review, we describe the method by which root-organ cultures (transformed and nontransformed) have been obtained, together with the choice of host species, inoculation techniques, and culture media. We also outline the potential use of continuous cultures and cryopreservation of in vitro produced spores for long-term germ plasm storage. Furthermore, this review highlights the considerable impact that in vitro root-organ cultures have had on studies of AM fungal morphology, taxonomy, and phylogeny and how they have improved our understanding of the processes leading to root colonization and development of the extraradical mycelium. This is supported by a summary of some of the most important findings, regarding this symbiosis, that have been made at the physiological, biochemical, and molecular levels. We also summarize results from studies between AM fungi and certain pathogenic and nonpathogenic soil microorganisms. We describe some of the limitations of this in vitro system and propose diverse avenues of AM research that can now be undertaken, including the potential use of a similar system for ectomycorrhizal research.Key words: arbuscular mycorrhiza, root-organ cultures, Glomales, in vitro, root symbioses, source of inoculum, cryopreservation, intraradical and extraradical mycelium, mycorrhizosphere.

scholarly journals Influence of Flooding on the Survival of Arbuscular Mycorrhiza

1970 ◽  
Vol 25 (2) ◽  
pp. 111-114
Author(s):  
Delowara Khanam
Keyword(s):  
Arbuscular Mycorrhiza ◽  
Mycorrhizal Fungi ◽  
Arbuscular Mycorrhizal ◽  
Soil Samples ◽  
Flooded Soil ◽  
Rhizosphere Soils ◽  
The Status ◽  
Spore Population ◽  
Flooded Area ◽  
Keywords Arbuscular Mycorrhiza

A study was conducted for two consecutive years (2004-2005 and 2005-2006) at Ullapara, Shirajgonj particularly in onion growing flooded area to know the status of arbuscular mycorrhizal fungi (AM) in flooded soil. Twenty farmers were selected for two years who cultivated onion in their fields after flood. Soil samples were collected just after removing of flood water. Again rhizosphere soils with roots of onion were collected from the same plots. After assessment of these samples, two years' results indicate that there is a plenty of AM spores in flooded soil. It proves their ability to survive in flooded condition and after flooding heavy colonization in onion roots was observed. Higher spore population was also recorded from the rhizosphere soils of onion. Keywords: Arbuscular mycorrhiza; flooding; survivabilityDOI: http://dx.doi.org/10.3329/bjm.v25i2.4872 Bangladesh J Microbiol, Volume 25, Number 2, December 2008, pp 111-114  

Sign in / Sign up

Export Citation Format

Share Document