scholarly journals Assessment of arbuscular mycorrhizal association in some fruit and spice plants of Rangamati hill district

2017 ◽  
Vol 42 (2) ◽  
pp. 221-232 ◽  
Author(s):  
MAH Bhuiyan ◽  
MB Banu ◽  
M Rahman
Keyword(s):  
Rhizosphere Soil ◽  
Agricultural Research ◽  
Spherical Shape ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Research Station ◽  
Mycorrhizal Association ◽  
Fungal Structure ◽  
Hill District ◽  
Spore Population

Rhizosphere soils of some fruit and spice plants from the Hill Agricultural Research Station, Bangladesh Agricultural Research Institute, Raikhali, Rangamati were collected during 2011-12 and 2012-13 for counting Arbuscular Mycorrhizal (AM) spore population, determining colonization (%) in their roots and studying AM structure. Assessment of spore population was done by following the Wet Sieving and Decanting Method. The percentage of AM infection was estimated by root slide technique. The spore number of 100g rhizosphere soil was recorded ranging from 120 in rhizosphere soil of Malta plant to a maximum of 410 in Atafal and Sofeda plants during 2011-12 and from 75 in rhizosphere soil of Phalsa plant to a maximum of 327 in Amlaki plant during 2012-13. Different fruit and spice plants showed different percentages of root colonization by AM fungi. Among the fruit and spice plants, the highest colonization (40%) was found in Jabotica, Phalsa and Sofeda plant, and the lowest colonization (6.6%) was found in Rambutan plant during 2011-12, but in 2012-13 the highest (61.3%) was result was observed in Bilatigab plant and the lowest (18.7%) was in Misti lebu, Malta and Tetul plant. The AM fungal structure in the root system of the selected fruit and spice plants varied in irrespective of fruit and spice species. Some plants had vesicles. Hyphae were present in most of the plants. Some plant species recorded Arbuscules. Both oval and spherical shape vesicles were found in this study.Bangladesh J. Agril. Res. 42(2): 221-232, June 2017

scholarly journals Assessment of Arbuscular Mycorrhizal Association in Some Fruit Plants in Bangladesh

1970 ◽  
Vol 24 (1) ◽  
pp. 34-37 ◽  
Author(s):  
Delowara Khanam
Keyword(s):  
Arbuscular Mycorrhiza ◽  
Agricultural Research ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Citrus Limon ◽  
Syzygium Jambos ◽  
Mycorrhizal Association ◽  
Spore Population ◽  
Fruit Plants ◽  
Annona Reticulata

 Rhizosphere soils of 19 fruit plants from horticultural farm of Bangladesh Agricultural Research Institute (BARI), Joydebpur, Gazipur were assessed for arbuscular mycorrhiza (AM) spore population and determining colonization in their roots. The spore numbers recorded ranged from 48.0 (Citrus limon) to 1,050 (Annona reticulata) per 100 g soil in 2004, 41.0 (Citrus grandis) to 916.7 (Phyllanthus emblica) in 2005 and 44.3 (Citrus grandis) to 575.0 (Syzygium samarangense, white) in 2006. A considerable variation was observed in average spore numbers recorded in three consecutive years. Different fruit plants showed different percentages of root colonization by AM fungi. Among all the fruit plants, the highest colonization (86.7%) was found in Syzygium jambos and Elaeocarpus floribundus and the lowest colonization (20.0%) was recorded in Syzygium samarangense (red). Keywords: Arbuscular mycorrhiza (AM), Colonization, Spore population, Fruit plantsDOI: http://dx.doi.org/10.3329/bjm.v24i1.1234 Bangladesh J Microbiol, Volume 24, Number 1, June 2007, pp 34-37

scholarly journals Performance Of Bilati Dhonia (Eryngium Foetidum L.) Under The Canopy Of Different Tree Species

1970 ◽  
Vol 36 (2) ◽  
pp. 255-262
Author(s):  
M Moniruzzaman ◽  
AKM Qamruzzaman
Keyword(s):  
Tree Species ◽  
Agricultural Research ◽  
Leaf Length ◽  
Research Station ◽  
Direct Sunlight ◽  
Hill District ◽  
Eryngium Foetidum ◽  
Number Of Leaves ◽  
Sun Light ◽  
Growth Characters

Performance of ‘Bilati Dhonia’ (Eryngium foetidum L.) grown under the shades of different tree species, namely guava, jackfruit, mango, jujube, and farmers’ practice (grown under artificial shade) was evaluated at the Agricultural Research Station, Raikhali, Rangainati Hill District during two consecutive years of 2004-05 and 2005-06. The results revealed that plant height, leaf length, number of leaves per plant and fresh weight per plant were significantly higher under the canopies of various trees and farmers’ practice than those grown under direct sun light. Different growth characters were better under the shades of jackfruit and guava trees than those of other species. Periods to first and 50% flowering under tree species were longer than that under direct sunlight. The highest fresh yield (mean of two years) of ‘Bilati Dhonia’ was found in the farmers’ practice (27.58 t/ha), which was similar to those under guava (27.31 t/ha) and jackfruit trees (27.51 t/ha). Keywords: Bilati Dhonia (Eryngium foetidum L.); tree shades; hilly area. DOI: http://dx.doi.org/10.3329/bjar.v36i2.9252 BJAR 2011; 36(2): 255-262

scholarly journals Studies on the arbuscular mycorrhizal fungal association in some medicinal plant species of paithal hills, western ghats kannur district, kerala

2020 ◽  
Vol 7 (2) ◽  
pp. 30-38
Author(s):  
Santhoshkumar S ◽  
Nagarajan N ◽  
Sree Priya S
Keyword(s):  
Plant Species ◽  
Root Colonization ◽  
Rhizosphere Soil ◽  
Fungal Spores ◽  
Arbuscular Mycorrhizal ◽  
Soil Samples ◽  
Fungal Colonization ◽  
The Family ◽  
Spore Population ◽  
Arbuscular Mycorrhizal Fungal

In the present study to analyzed that the arbuscular mycorrhizal fungal spores in root colonization and spore population in rhizosphere soils samples in various medicinal at Paithal hills,Western Ghats of Kannur district, Kerala, India. Root and rhizosphere soil samples were collected during the month of August, 2018-March, 2019 from the surface to 30 cm depth as well as pH were also recorded. Totally 30 plant species belonging to 19 families were collected and identified. The present result showed arbuscular mycorrhizal spore population in the rhizosphere soil and root colonization of all the plant species. A total of 19 AM fungal spores were recovered from the rhizosphere soil samples in this study region. The Glomus was dominant had seen in rhizosphere soil samples in all the medicinal plant species. The maximum spore population was found in the rhizosphere soil samples of Mimosa pudica (590/100g of soil) which belongs to the family Mimosaceae and the lowest spore population was observed in the Terminalia bellirica 135/100g of soil) belongs to Combretaceae family. The highest  78 % AM fungal colonization was found in roots of Euphorbia hirta belongs to the family Euphorbiaceae. While the lowest 11 % AM fungal colonization was found in the root of Sida acuta belongs to the family Malvaceae.

scholarly journals Mycorrhizal association and influence on growth of Asian pigeonwings (Clitoria ternatea L.)

2017 ◽  
Vol 6 (06) ◽  
pp. 5415
Author(s):  
Mane S. R. ◽  
Kumbhar V. R. ◽  
Birajdar G. M. ◽  
Naryankar R. S. ◽  
Gavali M. T. ◽  
...  
Keyword(s):  
Root Colonization ◽  
Biomass Productivity ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Spore Density ◽  
Clitoria Ternatea ◽  
Treated Condition ◽  
Mycorrhizal Association ◽  
Maximum Root ◽  
Herbal Medicinal

Clitoria ternatea L. is an excellent herbal medicinal plant. Arbusular Mycorrhizal fungal (AMF) colonization and biomass of three different tested conditions of Clitoria ternatea plant was investigated. Inoculums of indigenous AMF and Trichoderma harzianum was tested greenhouse experiment and compared with natural condition after 60th days of treatment. Percentage of Arbuscular mycorrhizal (AM) infection, number of resting spores and AM fungi species varies in different land. Among three different conditions, natural conditions showed maximum root colonization (75.89%) than treated one but minimum spore density (358.8/100gsoil). Highest spore density (481.6/100g soil) was found in T. harzianum treated condition followed by indigenous AMF treatment Acaulospora Glomus and Sclerocystis these three genera were found frequently. AMF inoculums and T.harzianum treatments conditions were observed promising biomass data of 60th days after treatment (DAT).When AMF are more colonized to plants then enhanced the biomass productivity.

scholarly journals Response of Arbuscular Mycorrhizal Fungi to Hydrologic Gradients in the Rhizosphere ofPhragmites australis(Cav.) Trin ex. Steudel Growing in the Sun Island Wetland

2015 ◽  
Vol 2015 ◽  
pp. 1-9 ◽  
Author(s):  
Li Wang ◽  
Jieting Wu ◽  
Fang Ma ◽  
Jixian Yang ◽  
Shiyang Li ◽  
...  
Keyword(s):  
Host Plant ◽  
Mycorrhizal Fungi ◽  
Plant Biomass ◽  
Growth Parameters ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
The Sun ◽  
Vegetative Period ◽  
Hydrologic Gradients ◽  
Mycorrhizal Association

Within the rhizosphere, AM fungi are a sensitive variable to changes of botanic and environmental conditions, and they may interact with the biomass of plant and other microbes. During the vegetative period of thePhragmites australisgrowing in the Sun Island Wetland (SIW), the variations of AM fungi colonization were studied. Root samples of three hydrologic gradients generally showed AM fungi colonization, suggesting that AM fungi have the ability for adaptation to flooded habitats. There were direct and indirect hydrological related effects with respect to AM fungi biomass, which interacted simultaneously in the rhizosphere. Though water content in soil and reed growth parameters were both positively associated with AM fungi colonization, only the positive correlations between reed biomass parameters and the colonization could be expected, or both the host plant biomass and the AM fungi could be beneficial. The variations in response of host plant to the edaphic and hydrologic conditions may influence the effectiveness of the plant-mycorrhizal association. This study included a hydrologic component to better assess the role and distribution of AM fungi in wetland ecosystems. And because of that, the range of AM fungi was extended, since they actually showed a notable adaptability to hydrologic gradients.

scholarly journals First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

2016 ◽  
Vol 5 (1) ◽  
pp. 53-53
Author(s):  
Antonios Zambounis ◽  
Aliki Xanthopoulou ◽  
Filippos A. Aravanopoulos ◽  
Athanasios Tsaftaris ◽  
Evaggelos Barbas
Keyword(s):  
Mycorrhizal Fungi ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
First Record ◽  
Thuja Plicata ◽  
Allium Porrum ◽  
Northern Greece ◽  
Funneliformis Mosseae ◽  
Mycorrhizal Association

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

scholarly journals STUDIES ON THE ARBUSCULAR MYCORRHIZAL FUNGAL DIVERSITY OF SELECTED MEDICINAL PLANT SPECIES FROM KODIKUTHIMALA, MALAPPURAM, KERALA

2017 ◽  
Vol 4 (3) ◽  
pp. 51-58
Author(s):  
Aiswarya N.K ◽  
Muthuraj K ◽  
Siva Priya K.T ◽  
Krishnan E ◽  
Nagarajan N
Keyword(s):  
Plant Species ◽  
Arbuscular Mycorrhizal ◽  
Fungal Species ◽  
Commelina Benghalensis ◽  
Mycorrhizal Association ◽  
Spore Population ◽  
Fungal Association ◽  
Arbuscular Mycorrhizal Fungal ◽  
Sida Rhombifolia ◽  
Rhizophagus Fasciculatus

The present investigation has brought out the AM fungal association in some plant species of Kodikuthimala, Malappuram district Kerala. Totally, 25 plant species belongs to 15 families were analyzed for arbuscular mycorrhizal association. The root samples of all collected plant species showed mycorrhizal infection. The percentage of colonization was varied with plant species and it ranges from 12 (Commelina benghalensis) to 79% (Sida rhombifolia). Maximum spore population was observed in Gloriosa superba (574/100g of soil) and minimum in Euphorbia hirta (143/10g of soil). Totally 26 AM fungal species belongs to 13 genera were found. Among this Glomus was most dominated. In most of the plants, spores of Rhizophagus fasciculatus are seen. Present study confirms the Arbuscular Mycorrhizal association in the collected plant species.

scholarly journals Investigating the diversity of arbuscular mycorrhizal fungi from Gymnema sylvestre and Curcuma longa in Vietnam

2020 ◽  
Vol 16 (4) ◽  
pp. 697-703
Author(s):  
Hoang Kim Chi ◽  
Tran Thi Nhu Hang ◽  
Tran Thi Hong Ha ◽  
Le Huu Cuong ◽  
Tran Ho Quang ◽  
...  
Keyword(s):  
Medicinal Plants ◽  
Host Plants ◽  
Rhizosphere Soil ◽  
Curcuma Longa ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Fungal Species ◽  
Soil Samples ◽  
Rrna Gene ◽  
Gymnema Sylvestre

Arbuscular mycorrhizal (AM) fungi are soil eukaryotes that belong to phylum Glomeromycota and have symbiosis with the vast majority of higher plants’ roots. AM fungi are believed to be coevolved with terrestrial plants, the abundance and diversity of AM fungal communities as a result are host plant dependent. A survey of AM fungi from the rhizospheres of medicinal plants in Northern Vietnam including gurma Gymnema sylvestre and turmeric Curcuma longa was carried out. From the extracted total DNAs of the medicinal plants’ rhizosphere soil samples, 35 mycorrhizal fungal species were identified by analyzing small subunit rRNA gene sequences. Result revealed that genus Glomus is the most abundant in the AM communities of G. sylvestre and C. longa, followed by Gigaspora and Acaulospora. Besides, AM species belonging to genera Scutellospora, Diversispora and Rhizophagus were observed in almost all rhizosphere soil samples. The spore counting by wet sieving and decanting method uncovered a variation in AM spore density of gurma and turmeric rhizosphere. In general, AM species were found more abundantly and more diverse in collected rhizome soil samples of C. longa (27 species belonging to 10 genera) than of G. sylvestre (17 species found belonging to 7 genera). The observed difference in AM communities of G. sylvestre and C. longa supports evidence for the dependence of AM fungal species on host plants, and indicates that AM fungi may have relation to the host plants’ secondary metabolite production.

scholarly journals Effect Of Plant Spacings On The Performance Of Hybrid Cabbage (Brassica Oleracea Var. Capitata) Varieties

1970 ◽  
Vol 36 (3) ◽  
pp. 495-506 ◽  
Author(s):  
M Moniruzzaman
Keyword(s):  
Brassica Oleracea ◽  
Agricultural Research ◽  
Pooled Analysis ◽  
Research Station ◽  
Plant Spacing ◽  
Head Weight ◽  
Hill District ◽  
Hybrid Variety ◽  
Head Height ◽  
Early Harvest

A field experiment on cabbage (Brassica oleracea var. capitata) comprising two plant spacings viz. 60 × 40 cm and 60 × 45 cm and ten hybrid cabbage varieties viz. Green Rich, Green-621, Green Coronet, Summer Warrior, Rare Ball, Atlas- 70, Southern treasure, Laurels, K-K Cross and K-S Cross was conducted during 15 October to 12 February of 2005-07 at the Agricultural Research Station, Raikhali, Rangamati Hill District to find out the optimum plant spacing and suitable cabbage variety(s). The wider spacing of 60 × 45 cm resulted in significantly maximum number of folded leaves and head weight (without unfolded leaves) in comparison to closer spacing of 60 × 30 cm. The variety Green Coronet showed the highest plant height, number of unfolded leaves, length of the biggest loose leaf, widest leaf, head height, and head weight (with unfolded leaves).This variety took the highest duration (119 days), while Green- 621 took the lowest duration for harvest (105 days). Although Green Coronet grew vigorously, it did not produce the highest head yield. All the varieties had good head compactness except Laurels and Green Coronet which had medium and less compactness, respectively. The combination of 60 × 30 cm spacing with variety Southern Treasure and K-S cross produced the highest head diameter, but wider spacing of 60 × 45 cm accompanied by Southern Treasure produced the highest head weight without unfolded leaves followed by K- K Cross in both the years. The pooled analysis showed the highest marketable head yield (73.32 t/ha) in the combination of 60 x 40 cm spacing with K- K Cross, which was closely followed by Southern Treasure (71.71 t/ha) and Laurels (71.56 t/ha). The variety Green-621 was found suitable for early harvest with reasonable yield (67.82 t/ha). Keywords: Cabbage; Brassica oleracea var. Capitata; hybrid variety; spacing; head yield; Rangamati. DOI: http://dx.doi.org/10.3329/bjar.v36i3.9277 BJAR 2011; 36(3): 495-506

scholarly journals Effects of Sulfur, Boron, Zinc and Molybdenum on Yield and Profitability of Broccoli (Brassica oleracea L. Var. italica)

1970 ◽  
Vol 6 (1) ◽  
pp. 43-53
Author(s):  
M Moniruzzaman ◽  
SN Mozumder ◽  
MR Islam
Keyword(s):  
Polynomial Regression ◽  
Agricultural Research ◽  
Growth Yield ◽  
Growth And Yield ◽  
Research Station ◽  
Gross Margin ◽  
Marginal Rate ◽  
Hill District ◽  
Marginal Rate Of Return ◽  
Four Levels

A field experiment on broccoli (var. Premium Crop) comprising four levels of each of sulfur (s) (0, 10, 20 and 30 Kg/ha), boron (B) (0, 1, 1.5, and 2.0 Kg/ha), zinc (Z) (0, 2.5, 5.0 and 7.5 Kg/ha) and five levels of molybdenum (Mo) (0, 0.4, 0.8, 1.2 and 1.6 Kg/ha) was conducted at the Agricultural Research Station, Raikhali, Rangamati Hill district during the rabi seasons of 2004-05 and 2005-2006 on the growth, yield and profitability of the crop. The fertilizer treatments had significant effects on growth and yield parameters viz. plant spread, numbers of leaves per plant, head diameter, main head weight and weight of secondary shoot per plant. Application of S, B, Zn and Mo increased head yield of broccoli significantly up to 20, 1.5, 5 and 0.8 kg/ha, respectively. The maximum head yields of 14.71 t/ha in 2004-05 and 18.61 t/ha in 2005-06 was obtained from the nutrient combination of 30: 1.5: 5: 0.8 kg S: B: Zn: Mo/ha with a blanket dose of 180: 43: 66 kg N: P: K /ha and cowdung @ 10 ton/ha identically followed by the yields obtained from the combinations of 20: 1.5: 5: 0.8 kg S: B: Zn: Mo/ha and 20: 2: 5: 0.8 kg S: B: Zn: Mo/ha. The S30B1.5Zn Mo0.8 kg/ha combination also caused the highest gross margin (TK. 243649) and marginal rate of return as high as 3020%. The calculated optimum and economic nutrient combinations from the polynomial regression equation were S35B2.8Zn4.23Mo0.9 kg/ha and S34.7B2.75Zn4.20Mo0.88 kg/ha, respectively. Key words: Broccoli, fertilizer, yield, profitability, Rangamati, Bangladesh. doi:10.3329/jard.v6i1.1657 J Agric Rural Dev 6(1&2), 55-61, June 2008

Sign in / Sign up

Export Citation Format

Share Document