scholarly journals On-Farm Trials Reveal Significant but Uncertain Control of Botrytis cinerea by Aureobasidium pullulans and Potassium Bicarbonate in Organic Grapevines

2021 ◽  
Vol 12 ◽  
Author(s):  
Anabelle Laurent ◽  
David Makowski ◽  
Nicolas Aveline ◽  
Séverine Dupin ◽  
Fernando E. Miguez
Keyword(s):  
Botrytis Cinerea ◽  
Aureobasidium Pullulans ◽  
Multilevel Models ◽  
Disease Incidence ◽  
Gray Mold ◽  
Potassium Bicarbonate ◽  
Economic Losses ◽  
Untreated Plot ◽  
Wine Quality ◽  
On Farm

Botrytis cinerea, a fungal pathogen that causes gray mold on grapes, can decrease yield, substantially reduce wine quality, and therefore cause significant economic losses. In a context of increasing awareness of environmental and human health, biopesticides are a potential alternative to synthetic chemical treatments to produce grapes and wine in compliance with high food standards. However, the effectiveness of biopesticides is not well known and more research is needed to help winegrowers assess their ability to control wine diseases. Our study aims to assess the efficacy of two commercial biopesticides, based on potassium bicarbonate and Aureobasidium pullulans, in reducing the incidence of gray mold (i.e., the proportion of grape bunches that are diseased). We use data from an on-farm trial network managed over 3 years (from 2014 to 2016) in a major wine producing region located in Southwestern France, and fit Bayesian generalized linear multilevel models able to take the variability of treatment effect across trials into account. The fitted models were then used to estimate the efficacy on incidence as a function of the severity (i.e., the proportion of diseased grape berries in a bunch) in an untreated plot in order to determine if the effectiveness of the treatments depends on the disease pressure. At average disease severity (i.e., 3%), the efficacy on disease incidence at the network level was equal to 20% [95% CI = (−0.1; 37.3)] and 13% [95% CI = (0.2; 24.7)] for potassium bicarbonate and A. pullulans, respectively. For both biopesticides, the efficacy on incidence for a new site-year is highly uncertain, but potassium bicarbonate had a lower uncertainty and a lower application cost compared to A. pullulans. Our results confirm that potassium bicarbonate is an interesting biopesticide under farming conditions in organic vineyards in southwestern France, but the amount of uncertainty points to the need for further research.

scholarly journals Characterization of Botrytis cinerea From Commercial Cut Flower Roses

Plant Disease ◽  
2019 ◽  
Vol 103 (7) ◽  
pp. 1577-1583 ◽  
Author(s):  
M. Muñoz ◽  
J. E. Faust ◽  
G. Schnabel
Keyword(s):  
Botrytis Cinerea ◽  
Fungicide Resistance ◽  
Management Practices ◽  
Cultural Practices ◽  
Disease Incidence ◽  
Resistance Management ◽  
Gray Mold ◽  
Economic Losses ◽  
Cut Flower ◽  
Aspergillus Brasiliensis

Botrytis cinerea Pers. infects cut flower roses (Rosa × hybrida L.) during greenhouse production and gray mold symptoms are often expressed in the postharvest environment, resulting in significant economic losses. Disease management is based on cultural practices and preventative chemical treatments; however, gray mold outbreaks continue to occur. Rose tissues from six commercial shipments from two greenhouses in Colombia were evaluated to determine the Botrytis species composition as well as identify other pathogens present, gray mold incidence and severity, and fungicide resistance profiles. Botrytis isolates (49 total) were grouped into six morphological phenotypes, and all were identified to be B. cinerea sensu stricto. Disease incidence was higher in the petals than in the stem, stamen, ovary, sepal, or leaf tissues. Other fungi were isolated infrequently and included Alternaria alternata, Cladosporium cladosporioides, Epicoccum nigrum, Penicillium citrinum, Aspergillus brasiliensis, and Diplodia sp. Fungicide resistance profiles were determined using previously established discriminatory doses. Isolates resistant to thiophanate-methyl, iprodione, boscalid, and cyprodinil were found frequently in all shipments and in both greenhouses. The frequency of resistance to penthiopyrad, fenhexamid, fluopyram, isofetamid, and fludioxonil varied between shipments and greenhouses. No resistance to pydiflumetofen was observed at the discriminatory doses tested. Isolates with resistance to multiple chemical classes were commonly found. These results indicate that fungicide resistance management practices may improve preharvest and postharvest gray mold control of cut flower roses.

scholarly journals Development of Vernonia amygdalina Leaf Extract Emulsion Formulations in Controlling Gray Mold Disease on Tomato (Lycopersicon esculentum Mill.)

Agronomy ◽  
2021 ◽  
Vol 11 (2) ◽  
pp. 373
Author(s):  
Siti Fairuz Yusoff ◽  
Farah Farhanah Haron ◽  
Norhayu Asib ◽  
Mahmud Tengku Muda Mohamed ◽  
Siti Izera Ismail
Keyword(s):  
Antifungal Activity ◽  
Leaf Extract ◽  
Fungicidal Activity ◽  
Disease Incidence ◽  
Gray Mold ◽  
Positive Control ◽  
Economic Losses ◽  
Vernonia Amygdalina ◽  
Emulsion Formulation

Postharvest fruits including tomatoes are commonly infected by gray mold disease resulting in significant economic losses in the fruit industry. Therefore, this study aimed to develop botanical fungicide derived from Vernonia amygdalina leaf extract to control gray mold on tomato. The emulsion formulation containing surfactant, oil carrier and water was optimized at different non-ionic alkyl polyglucoside surfactants through eleven combinations of oil to surfactant ratio (0:10, 1:9, 2:8, 3:7, 4:6, 5:5, 6:4, 7:3, 8:2, 9:1 and 10:0 w/w). From eight selected formulations, two formulations, F5 and F7 showed stable in storage, remarkable thermodynamic stability, smaller particle size (66.44 and 139.63 nm), highly stable in zeta potential (−32.70 and −31.70 mV), low in polydispersity index (0.41 and 0.40 PdI), low in viscosity (4.20 and 4.37 cP) and low in surface tension (27.62 and 26.41 mN/m) as compared to other formulations. In situ antifungal activity on tomato fruits showed F5 formulation had a fungicidal activity against B. cinerea with zero disease incidence and severity, whereas F7 formulation reduced 62.5% disease incidence compared to a positive control with scale 1. Based on these findings, F5 formulation exhibited pronounced antifungal activity and may contribute to the development of new and safe antifungal product against gray mold on tomato.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Streptomyces botrytidirepellens sp. nov., a novel actinomycete with antifungal activity against Botrytis cinerea

2021 ◽  
Vol 71 (9) ◽  
Author(s):  
Mengqi Jiang ◽  
Xi Xu ◽  
Jia Song ◽  
Dongmei Li ◽  
Liyuan Han ◽  
...  
Keyword(s):  
Antifungal Activity ◽  
Botrytis Cinerea ◽  
Gene Clusters ◽  
Gray Mold ◽  
Phytopathogenic Fungi ◽  
Antagonistic Effect ◽  
Economic Losses ◽  
Content Type ◽  
Desferrioxamine B ◽  
Cell Free Filtrate

The fungal pathogen Botrytis cinerea is the causal agent of devastating gray mold diseases in many economically important fruits, vegetables, and flowers, leading to serious economic losses worldwide. In this study, a novel actinomycete NEAU-LD23T exhibiting antifungal activity against B. cinerea was isolated, and its taxonomic position was evaluated using a polyphasic approach. Based on the genotypic, phenotypic and chemotaxonomic data, it is concluded that the strain represents a novel species within the genus Streptomyces , for which the name Streptomyces botrytidirepellens sp. nov. is proposed. The type strain is NEAU-LD23T (=CCTCC AA 2019029T=DSM 109824T). In addition, strain NEAU-LD23T showed a strong antagonistic effect against B. cinerea (82.6±2.5%) and varying degrees of inhibition on nine other phytopathogenic fungi. Both cell-free filtrate and methanol extract of mycelia of strain NEAU-LD23T significantly inhibited mycelial growth of B. cinerea. To preliminarily explore the antifungal mechanisms, the genome of strain NEAU-LD23T was sequenced and analyzed. AntiSMASH analysis led to the identification of several gene clusters responsible for the biosynthesis of bioactive secondary metabolites with antifungal activity, including 9-methylstreptimidone, echosides, anisomycin, coelichelin and desferrioxamine B. Overall, this research provided us an excellent strain with considerable potential to use for biological control of tomato gray mold.

scholarly journals Timing of Preharvest Infection of Pear Fruit by Botrytis cinerea and the Relationship to Postharvest Decay

Plant Disease ◽  
2004 ◽  
Vol 88 (5) ◽  
pp. 468-473 ◽  
Author(s):  
C. L. Lennox ◽  
R. A. Spotts
Keyword(s):  
Botrytis Cinerea ◽  
Gray Mold ◽  
Economic Losses ◽  
Pear Fruit ◽  
Full Bloom ◽  
Postharvest Decay ◽  
Poor Predictor ◽  
The Mean ◽  
Low Levels ◽  
The Relationship

Botrytis cinerea causes significant levels of postharvest decay in the winter pear cultivar d'Anjou. The objectives of this study were to determine the timing of B. cinerea infection of pear stems and calyxes in the orchard during the growing season, to investigate the development of gray mold in storage, and to determine whether preharvest levels of B. cinerea in pear stems and calyxes can be used as predictors of gray mold levels observed in storage. Very low levels of B. cinerea were isolated from stem tissue prior to harvest. In a single year repeat experiment, stems sampled at harvest had higher levels of infection than those sampled earlier in the season. Little or no stem end gray mold was detected in fruit after 3 months in air-storage; however, incidence increased between 6 and 8 months. Calyx end gray mold was detected at low levels in fruit stored for up to 8 months. The mean incidence of stem end gray mold was 3.6 and 2.0%, and incidence of calyx end gray mold was 1.2 and 0.2%, in 1996 and 1997, respectively. Calyxes were susceptible to infection soon after full bloom; however, inoculation of calyxes in April or May did not result in higher levels of calyx end gray mold in storage. Therefore, preharvest level of calyx infection is a poor predictor of calyx end gray mold in storage. In addition, application of benomyl in the orchard reduced the level of B. cinerea in blossoms but had no effect on levels of calyx end gray mold of fruit in storage. Packing and shipping fruit within 3 to 6 months of harvest may mitigate economic losses due to gray mold.

scholarly journals First Report of Botrytis Blight of Peanut Caused by Botrytis cinerea in Georgia

Plant Disease ◽  
2005 ◽  
Vol 89 (8) ◽  
pp. 910-910 ◽  
Author(s):  
J. E. Woodward ◽  
T. B. Brenneman ◽  
R. C. Kemerait ◽  
A. K. Culbreath ◽  
J. R. Clark
Keyword(s):  
Botrytis Cinerea ◽  
Disease Incidence ◽  
Block Design ◽  
Gray Mold ◽  
American Phytopathological Society ◽  
Breeding Programs ◽  
First Report ◽  
Tomato Spotted Wilt ◽  
Arachis Hypogaea L ◽  
Wilt Virus

Because of the importance of spotted wilt caused by Tomato spotted wilt virus (TSWV), most peanut (Arachis hypogaea L.) breeding programs in the southeastern United States are focusing on developing resistance to TSWV. Many of the cultivars with improved resistance to TSWV are late maturing, requiring 150 days to reach optimum maturity. This factor could greatly impact disease problems at harvest. During November of 2004, an unknown disease was observed on peanut cvs. Georgia 02-C and Hull in a commercial field in Appling County. Symptoms included wilting stems with water-soaked lesions and a dense, gray mold growing on infected tissues. Final disease incidence was less than 5%. For isolation, diseased tissue was surface sterilized by soaking in 0.5% sodium hypochlorite for 1 min, air dried, plated on potato dextrose agar (PDA), and incubated at 20°C. Botrytis cinerea Pers.:Fr., causal agent of Botrytis blight, was isolated from the margins of infected tissue. Mycelia were initially white but became gray after 72 h at which time tall, branched, septate conidiophores formed. Mature, unicellular, ellipsoid, hyaline conidia (8.9 × 10.4 μm) formed in botryose heads (1). Hard, black, irregular-shaped sclerotia formed after 2 weeks. Stems of greenhouse-grown peanut plants (cv. Georgia Green) were inoculated with PDA plugs colonized with either B. cinerea or B. allii Munn. Inoculations were made 3 cm below the last fully expanded leaf on wounded and nonwounded tissue. Noncolonized PDA plugs served as controls (n = 9). Plants were arranged in a dew chamber at 20°C in a randomized complete block design. Lesions and spore masses identical to those observed in the field appeared 3 to 5 days after being inoculated with B. cinerea. The B. allii inoculations caused only superficial lesions. After 5 days, mean lesion lengths for B. cinerea were 59 and 37 mm for wounded and nonwounded inoculations, respectively. B. cinerea was recovered from 100% of the symptomatic tissues. Botrytis blight is considered a late-season disease that occurs in cool, wet weather (3). Symptoms similar to those of Botrytis blight were observed on mature and over-mature peanut in Georgia and have been cited as “unpublished observations” (2); however, to our knowledge, this is the first report of the disease in Georgia. Although Botrytis blight is not considered a major peanut disease, it may become more prevalent at harvest as producers utilize late-maturing cultivars to manage spotted wilt. References: (1) H. L. Barnett and B. B. Hunter. Illustrated Guide of Imperfect Fungi. 4th ed. The American Phytopathological Society, St. Paul, MN, 1998. (2) K. H. Garren and C. Wilson. Peanut Diseases. Pages 262–333 in: The Peanut, the Unpredictable Legume. The National Fertilizer Assoc. Washington D.C. 1951. (3) D. M. Porter. Botrytis blight. Pages 10–11 in: Compendium of Peanut Diseases. 2nd ed. N. Kokalis-Burelle et al., eds. The American Phytopathological Society, St. Paul, MN. 1997.

scholarly journals Involvement of the Autophagy Protein Atg6 in Development and Virulence in the Gray Mold Fungus Botrytis cinerea

2021 ◽  
Vol 12 ◽  
Author(s):  
Na Liu ◽  
Shanyue Zhou ◽  
Baohua Li ◽  
Weichao Ren
Keyword(s):  
Botrytis Cinerea ◽  
Biological Function ◽  
Gray Mold ◽  
Economic Losses ◽  
Related Protein ◽  
Targeted Deletion ◽  
Cellular Processes ◽  
Mold Fungus ◽  
Evolutionarily Conserved ◽  
Sclerotial Formation

Gray mold caused by Botrytis cinerea is a devastating disease that leads to huge economic losses worldwide. Autophagy is an evolutionarily conserved process that maintains intracellular homeostasis through self-eating. In this study, we identified and characterized the biological function of the autophagy-related protein Atg6 in B. cinerea. Targeted deletion of the BcATG6 gene showed block of autophagy and several phenotypic defects in aspects of mycelial growth, conidiation, sclerotial formation and virulence. All of the phenotypic defects were restored by targeted gene complementation. Taken together, these results suggest that BcAtg6 plays important roles in the regulation of various cellular processes in B. cinerea.

scholarly journals A Botrytis cinerea Population from a Single Strawberry Field in Germany has a Complex Fungicide Resistance Pattern

Plant Disease ◽  
2015 ◽  
Vol 99 (8) ◽  
pp. 1078-1086 ◽  
Author(s):  
Anja Grabke ◽  
Gerd Stammler
Keyword(s):  
Amino Acid ◽  
Botrytis Cinerea ◽  
Amino Acid Change ◽  
Efflux Pump ◽  
Disease Incidence ◽  
Gray Mold ◽  
Resistance Pattern ◽  
Lower Sensitivity ◽  
Multidrug Efflux Pump ◽  
Site Specific

Gray mold, caused by the fungus Botrytis cinerea, is one of the most important diseases of strawberry in Germany. The application of site-specific fungicides remains the main strategy to reduce disease incidence and severity in the field. Isolates (n = 199) were collected from fungicide-treated strawberry fruit at a German research site with a long history of fungicide efficacy trials against gray mold. Sensitivities to the six site-specific botryticides registered in Germany were determined using microtiter assays. Values for the concentration of a fungicide at which fungal development is inhibited by 50% (EC50) ranged from 0.03 to ≥30 ppm for the succinate dehydrogenase inhibitor boscalid, 0.015 to ≥10 ppm for the hydroxyanilide fenhexamid, 0.009 to 0.739 ppm for the phenylpyrrole fludioxonil, 0.55 to 43.45 ppm for the dicarboximide iprodione, 0.021 to ≥3 ppm for the quinone outside inhibitor pyraclostrobin, and 0.106 to ≥30 ppm for the anilinopyrimidine pyrimethanil. Pyrosequencing revealed that amino acid substitutions in the target proteins Bos1 (I365S/N, V368F + Q369H), CytB (G143A), Erg27 (F412S), and SdhB (P225F, N230I, and H272R/Y) were associated with reduced sensitivity levels to the corresponding fungicide classes. In most cases, isolates with a decreased sensitivity to fludioxonil showed a reduced sensitivity to tolnaftate. This reduction is considered to be an indication of multidrug efflux pump activity. The amino acid change I365S, I365N, or V368F + Q369H in Bos1 and H272R in SdhB by itself showed EC50 values of 3.99 to 14.73 ppm, 3.87 to 5.37 ppm, 4.81 to 15.63 ppm, and 2.071 to ≥30 ppm, respectively. When isolates that contained one of these mutations were also multidrug resistant, the ranges of EC50 values shifted to 6.47 to 43.45 ppm for I365S, 7.28 to 29.84 ppm for I365N, 6.89 to 26.67 ppm for V368F + Q369H, and ≥30 ppm for H272R. The reported data suggest that the combination of multidrug resistance and an amino acid change in the target site may result in a lower sensitivity to the fungicides than one resistance mechanism by itself. Although 20% of the population analyzed was sensitive to all six different chemical classes, the majority showed reduced sensitivity to one (6%), two (13%), three (23%), four (17%), five (11%), and six (11%) different fungicides.

scholarly journals Identification of epiphytic yeasts and bacteria with potential for biocontrol of grey mold disease on table grapes caused by Botrytis cinerea

2018 ◽  
Vol 16 (1) ◽  
pp. e1002 ◽  
Author(s):  
Kazem Kasfi ◽  
Parissa Taheri ◽  
Behrooz Jafarpour ◽  
Saeed Tarighi
Keyword(s):  
Botrytis Cinerea ◽  
Disease Incidence ◽  
Gray Mold ◽  
Antagonistic Activity ◽  
Antagonistic Effect ◽  
Bacterial Isolates ◽  
Thompson Seedless ◽  
Grape Berries ◽  
Table Grapes

The objective of this study was to identify grapevine epiphytic yeasts and bacteria for biocontrol of Botrytis cinerea on grapes. Antagonistic yeasts and bacteria were isolated from the epiphytic flora associated with grape berries and leaves cv. ‘Thompson seedless’ from vineyards in Iran and identified by sequencing the conserved genomic regions. A total of 130 yeast and bacterial isolates from the surface of grapevine were screened in vitro for determining their antagonistic effect against B. cinerea and used to control postharvest gray mold. Among the 130 isolates, five yeasts and four bacterial isolates showed the greatest antagonistic activity in vitro against B. cinerea. Two yeasts species including Meyerozyma guilliermondii and Candida membranifaciens had high antagonistic capability against the pathogen. Also, 4 bacterial isolates belonging to Bacillus sp. and Ralstonia sp. showed significant biocontrol effect against B. cinerea. The isolates were capable of producing volatile and non-volatile substances, which suppressed the pathogen growth. The antagonistic activity of selected yeasts and bacteria against the pathogen was investigated on wounded berries of ‘Thompson seedless’. On small clusters with intact berries, all of the antagonistic isolates considerably reduced the decay on grape berries and inhibition of gray mold incidence on fruits treated by these isolates was less than 50%, except for the isolate N1, which had higher capability in inhibiting the disease incidence. These results suggest that antagonist yeasts and bacteria with potential to control B. cinerea on grape can be found in the microflora of grape berries and leaves.

scholarly journals First Report of Iprodione Resistance in Botrytis cinerea on Blackberry from South Carolina

Plant Disease ◽  
2011 ◽  
Vol 95 (11) ◽  
pp. 1481-1481
Author(s):  
F. P. Chen ◽  
X. L. Liu ◽  
X. P. Li ◽  
G. Schnabel
Keyword(s):  
South Carolina ◽  
Botrytis Cinerea ◽  
Disease Incidence ◽  
Gray Mold ◽  
Resistant Isolate ◽  
Cross Resistance ◽  
Broad Host Range ◽  
Paper Strip ◽  
Single Spore ◽  
First Report

Botrytis cinerea Pers.:Fr., is a necrotrophic fungus with a broad host range that causes gray mold on hundreds of plant species (2). Control of gray mold mainly depends on fungicides, including the dicarboxamide iprodione. Thirty-nine diseased blackberry fruit were collected from four orchards in South Carolina and the sensitivity of single-spore isolates to iprodione was examined by Spiral Plater assays (1) on potato dextrose agar (PDA). Briefly, a 5.3 cm long paper strip containing mycelia was placed along the concentration gradient of the PDA and 50% inhibition (EC50 value) was calculated after 2 days of incubation with the Spiral Gradient Endpoint (SGE) software (Spiral Biotech, Norwood, MA). Each isolate was tested in duplicates. Sensitivity ranged from 0.043 to 2.596 μg/ml, with a maximum resistance factor of 60.4. Isolates with EC50 values greater than 2 μg/ml were found in two orchards. Those isolates represented 40 and 7.1% of the total isolates from each orchard. Two isolates with high (EC50 value of 2.596 μg/ml) and low (EC50 value of 0.062 μg/ml) values were chosen to determine the efficacy of iprodione formulated product Rovral 4 Fl (Bayer CropSciences, Research Triangle Park, NC) on detached apple fruit. Fifteen apples were used for each isolate and experiment. Each fruit was wounded on the surface in three locations with a sterile syringe and inoculated with 15 μl of a spore suspension (106 conidia/ml) at the wounded sites. Rovral was applied at the recommended label rate either 24 h before (protective treatment) or 48 h after inoculation (curative treatment). The experiment was conducted three times. Blackberry fruit were not found suitable for this assay because of persistent contamination problems likely from latent infections of a symptomatic fruit. Disease incidence and lesion diameter were recorded 7 days after incubation. Disease incidence following inoculation of the sensitive and resistant isolates on non-fungicide-treated fruit was 100 and 86.7%, respectively. Disease incidence on fungicide-treated apples was 4.4% for the sensitive isolate and 75.6% for the resistant isolate with corresponding mean lesion areas of 0.36 mm and 9.37 mm, respectively. Both isolates were controlled effectively in protective treatments, however, indicating low levels of resistance. To our knowledge, this is the first report of iprodione resistance in B. cinerea from blackberry or any other field-grown crop in South Carolina. This finding adds to a study from 1999 (3) documenting resistance to the dicarboxamide fungicide vinclozolin in B. cinerea collected from ornamentals in South Carolinian greenhouses and suggests that resistance to iprodione needs to be considered in the design of gray mold control strategies in commercial blackberry orchards. No cross resistance between the phenylpyrrole fludioxonil and iprodione was found. References: (1) H. Forster et al. Phytopathology 94:163, 2004. (2) B. Williamson et al. Mol. Plant Pathol. 8:561. 2007. (3) L. F. Yourman and S. N. Jeffers. Plant Dis. 83:569, 1999.

Sign in / Sign up

Export Citation Format

Share Document