scholarly journals Epidémiologie de la fièvre Hémorragique de Crimée-Congo (FHCC) chez les bovins dans le département de Boboye au Niger

2020 ◽  
Vol 14 (3) ◽  
pp. 698-705
Author(s):  
Alima Maïna ◽  
Abdoulkarim Issa Ibrahim ◽  
Abdou Alassane ◽  
Hassane Adakal
Keyword(s):  
Immunosorbent Assay ◽  
Disease Transmission ◽  
Local Governments ◽  
Indirect Elisa ◽  
Hemorrhagic Fever ◽  
Elisa Test ◽  
Enzyme Linked Immunosorbent Assay ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus ◽  
Made In

La distribution et la dynamique des populations des tiques est un élément clé dans la connaissance des maladies transmises par ces vecteurs. C’est ainsi que cette étude a été conduite afin de mieux connaître l’épidémiologie de la Fièvre Hémorragique de Crimée-Congo (FHCC) dans les 8 communes du département de Boboye au Niger, où 355 sérums de bovins ont été collectés. En plus des sérums, des tiques ont été collectées sur 144 bovins, soit 18 par commune. Les sérums ont été soumis à un test ELISA (Enzyme Linked Immunosorbent Assay) indirect pour la détection d’anticorps anti-FHCC. Soixante-douze (72) éleveurs ont été interviewés sur leur connaissance de l’écologie des tiques, vecteurs du virus de la FHCC. Les résultats de l’enquête ont révélé que les éleveurs n’ont pas recours aux acaricides et que, dans leur majorité (55/72 soit 76,4 %), ils pratiquent la transhumance. L’étude a permis l’identification de 1342 tiques réparties en trois genres : Hyalomma (91,7%), Amblyomma (5,7%) et Rhipicephalus (Boophilus) (2,6%). La séroprévalence globale a été de 9,1±0,03%. Les communes de Harikanassou et Kiota ont été celles où les fortes prévalences ont été observées de 26,7 ± 12,9% et 22,5 ±12,9%. Le virus de la FHCC est en circulation chez la population animale, alors des investigations doivent être faites chez la population humaine.Mots clés : Anticorps anti-FHCC, Enzyme Linked Immunosorbent Assay Indirecte, Prévalence, Sérums, Tiques.   English Title: Crimean-Congo Hemorrhagic Fever (CCHF) ’s Epidemiology in cattle in Boboye’s department of Niger Republic To understand disease transmission by ticks, knowledge of population dynamics and distribution of these vectors are essentials. To sought that, the epidemiology of Crimean-Congo Hemorrhagic Fever (CCHF) in Niger Republic was studied by sampling 355 bovines (sera and ticks) in eight (8) local governments in Boboye’s department. Eighteen (18) bovines were sampled for ticks collection per local government making them a total of 144 bovine. Indirect ELISA test (enzyme-linked immunosorbent assay) was used to detect anti- CCHF antibodies. Seventy-two (72) farmers were surveyed on their knowledge on ticks’ ecology, main vectors of CCHF virus. The results revealed that farmers are not using acaricides, and their majority (55/72 thus 76.4%) practice Transhumance. The study allowed the identification of 1342 ticks distributed in 3 genus: Hyalomma (91.7%), Amblyomma (5.7%) and Rhipicephalus (Boophilus) (2.6%). The global seroprevalence against CCHF was (9.1 ± 0.03) %. Harikanassou and Kiota were the most affected local governments with respectively (26.7±12.9) % and (22.5±12,9) % prevalence. CCHV virus is circulating in animal population, so investigations must be made in human population. Keywords: Anti-CCHF antibodies, Indirect Enzyme Linked Immunosorbent Assay, Prevalence, Sera, Ticks.

scholarly journals An investigation of sheep toxoplasmosis in Basrah Province / Iraq

2010 ◽  
Vol 9 (3) ◽  
pp. 128
Author(s):  
K. M. Al-Saad ◽  
Saad Hashim Al-Husseiny
Keyword(s):  
Toxoplasma Gondii ◽  
Immunosorbent Assay ◽  
Indirect Elisa ◽  
Elisa Test ◽  
Latex Agglutination ◽  
Agglutination Test ◽  
Enzyme Linked Immunosorbent Assay ◽  
Study Results ◽  
Significant Difference ◽  
The Difference

The objective of this study was to investigate Toxoplasma gondii antibodies among sheep in different regions of Basrah province (including Al-Mdayna, Shatt Al-Arab, Al-Basrah, Al-Zubayr, and Abu Al-Khasib). The study was started in Oct. 2008 and was finished in May 2009, using latex agglutination test (LAT) and indirect enzyme linked immunosorbent assay (ELISA) IgG, 309 adult sheep were randomly selected from 15 herds among different ages and both sexes and used in this study, including 62 pregnant ewes, 185 non-pregnant ewes, 14 aborted ewes, and 48 rams. Results showed, that 60.84% were seropositive by LAT, whereas 51.11% were seropositive by ELISA IgG test, among animals used in this study, results detected that 79.03% pregnant ewes (highest value), 56.75% nonpregnant ewes,71.40% aborted ewes and 50% Rams (lowest value) were seropositive by LAT, whereas 56.52% pregnant ewes, 51.11% non-pregnant ewes, 83.33% aborted ewes (highest value), and 31.25% Rams (lowest value) were seropositive by indirect ELISA IgG. Moreover, among regions of Basrah province, the details of percentage of T.gondii antibodies were 54.54% in AL-Basrah , 71.43% in Abu Al-Khasib (highest value), 57.35% in Al- Mdayna, 47.83% in Shatt Al-Arab (lowest value), and 67.16% in Al-Zubayr by LAT, whereas 63.64% in AL-Basrah (highest value), 22.73% in Abu Al-Khasib (lowest value), 57.89% in Al-Mdayna, 50% in Shatt Al-Arab and 61.90% in Al-Zubayr by indirect ELISA test. Although the difference observed in the percentage of Toxoplasma gondii antibodies among different regions of Basrah, there was no significant difference P>0.05 detected LAT, whereas in the indirect ELISA IgG test there was significant difference P<0.05. Ewes showed high percentages 62.83%, 55.40% of toxoplasmosis than rams 50 %, 31.25% by LAT and ELISA test respectively. The highest titer was 1/4 28.57% were detected in pregnant ewes and lowest titers were 1/2, 1/8, and 1/256 0.0% were detected in aborted ewes and in ramsrespectively.

scholarly journals Epidemiology of Crimean-Congo Hemorrhagic Fever (CCHF) in Africa—Underestimated for Decades

2021 ◽  
Author(s):  
Ahmet Irfan Temur ◽  
Jens H. Kuhn ◽  
David B. Pecor ◽  
Dmitry A. Apanaskevich ◽  
Maryam Keshtkar-Jahromi
Keyword(s):  
Local Governments ◽  
Case Reports ◽  
Hemorrhagic Fever ◽  
Level Of Evidence ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus ◽  
Collection Data ◽  
Level 3 ◽  
The Impact ◽  
Level 2

Crimean-Congo hemorrhagic fever (CCHF) is endemic in Africa, but the epidemiology remains to be defined. Using a broad database search, we reviewed the literature to better define CCHF evidence in Africa. We used a One Health approach to define the impact of CCHF by reviewing case reports, human and animal serology, and records of CCHF virus (CCHFV) isolations (1956–mid-2020). In addition, published and unpublished collection data were used to estimate the geographic distribution of Hyalomma ticks and infection vectors. We implemented a previously proposed classification scheme for organizing countries into five categories by the level of evidence. From January 1, 1956 to July 25, 2020, 494 CCHF cases (115 lethal) were reported in Africa. Since 2000, nine countries (Kenya, Mali, Mozambique, Nigeria, Senegal, Sierra Leone, South Sudan, Sudan, and Tunisia) have reported their first CCHF cases. Nineteen countries reported CCHF cases and were assigned level 1 or level 2 based on maturity of their surveillance system. Thirty countries with evidence of CCHFV circulation in the absence of CCHF cases were assigned level 3 or level 4. Twelve countries for which no data were available were assigned level 5. The goal of this review is to inform international organizations, local governments, and healthcare professionals about shortcomings in CCHF surveillance in Africa to assist in a movement toward strengthening policy to improve CCHF surveillance.

scholarly journals Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tahmineh Jalali ◽  
Mostafa Salehi-Vaziri ◽  
Mohammad Hassan Pouriayevali ◽  
Seyed Latif Mousavi Gargari
Keyword(s):  
Point Of Care ◽  
Hemorrhagic Fever ◽  
Diagnostic Methods ◽  
Clinical Samples ◽  
Crimean Congo Hemorrhagic Fever ◽  
Point Of Care Test ◽  
Specificity And Sensitivity ◽  
Rural And Remote Areas ◽  
Cchf Virus ◽  
Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

scholarly journals Mice Orally Immunized with a Transgenic Plant Expressing the Glycoprotein of Crimean-Congo Hemorrhagic Fever Virus

2011 ◽  
Vol 18 (12) ◽  
pp. 2031-2037 ◽  
Author(s):  
S. M. Ghiasi ◽  
A. H. Salmanian ◽  
S. Chinikar ◽  
S. Zakeri
Keyword(s):  
Transgenic Plants ◽  
Transgenic Plant ◽  
Disease Transmission ◽  
Clinical Symptoms ◽  
Hemorrhagic Fever ◽  
Oral Immunization ◽  
Negative Control ◽  
Significant Rise ◽  
Knockout Mouse Model ◽  
Crimean Congo Hemorrhagic Fever

ABSTRACTWhile Crimean-Congo hemorrhagic fever (CCHF) has a high mortality rate in humans, the associated virus (CCHFV) does not induce clinical symptoms in animals, but animals play an important role in disease transmission to humans. Our aim in this study was to examine the immunogenicity of the CCHFV glycoprotein when expressed in the root and leaf of transgenic plants via hairy roots and stable transformation of tobacco plants, respectively. After confirmatory analyses of transgenic plant lines and quantification of the expressed glycoprotein, mice were either fed with the transgenic leaves or roots, fed the transgenic plant material and injected subcutaneously with the plant-made CCHFV glycoprotein (fed/boosted), vaccinated with an attenuated CCHF vaccine (positive control), or received no treatment (negative control). All immunized groups had a consistent rise in anti-glycoprotein IgG and IgA antibodies in their serum and feces, respectively. The mice in the fed/boosted group showed a significant rise in specific IgG antibodies after a single boost. Our results imply that oral immunization of animals with edible materials from transgenic plants is feasible, and further assessments are under way. In addition, while the study of CCHF is challenging, our protocol should be further used to study CCHFV infection in the knockout mouse model and virus neutralization assays in biosafety level 4 laboratories.

Virus-derived DNA forms mediate the persistent infection of tick cells by Hazara virus and Crimean-Congo hemorrhagic fever virus

2021 ◽  
Author(s):  
Maria Vittoria Salvati ◽  
Claudio Salaris ◽  
Vanessa Monteil ◽  
Claudia Del Vecchio ◽  
Giorgio Palù ◽  
...  
Keyword(s):  
Viral Replication ◽  
Cell Lines ◽  
Persistent Infection ◽  
Hemorrhagic Fever ◽  
Viral Reservoir ◽  
Tick Cell ◽  
Infected Tick ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus ◽  
Model Virus

Crimean-Congo hemorrhagic fever (CCHF) is a severe disease of humans caused by CCHF virus (CCHFV), a biosafety level (BSL)-4 pathogen. Ticks of the genus Hyalomma are the viral reservoir and they represent the main vector transmitting the virus to its hosts during blood feeding. We have previously shown that CCHFV can persistently infect Hyalomma -derived tick cell lines. However, the mechanism allowing the establishment of persistent viral infections in ticks is still unknown. Hazara virus (HAZV) can be used as a BSL-2 model virus instead of CCHFV to study virus/vector interactions. To investigate the mechanism behind the establishment of a persistent infection, we developed an in vitro model with Hyalomma -derived tick cell lines and HAZV. As expected, HAZV, like CCHFV, persistently infects tick cells without any sign of cytopathic effect, and the infected cells can be cultured for more than three years. Most interestingly, we demonstrated the presence of short viral-derived DNA forms (vDNAs) after HAZV infection. Furthermore, we demonstrated that the antiretroviral drug AZT could inhibit the production of vDNAs, suggesting that vDNAs are produced by an endogenous retrotranscriptase activity in tick cells. Moreover, we collected evidence that vDNAs are continuously synthesized, thereby downregulating viral replication to promote cell survival. Finally, vDNAs were also detected in CCHFV-infected tick cells. In conclusion, vDNA synthesis might represent a strategy to control the replication of RNA viruses in ticks allowing their persistent infection. IMPORTANCE Crimean-Congo hemorrhagic fever (CCHF) is an emerging tick-borne viral disease caused by CCHF virus (CCHFV). Ticks of the genus Hyalomma can be persistently infected with CCHFV representing the viral reservoir, and the main vector for viral transmission. Here we showed that tick cells infected with Hazara virus, a nonpathogenic model virus closely related to CCHFV, contained short viral-derived DNA forms (vDNAs) produced by endogenous retrotranscriptase activity. vDNAs are transitory molecules requiring viral RNA replication for their continuous synthesis. Interestingly, vDNA synthesis seemed to be correlated with downregulation of viral replication and promotion of tick cell viability. We also detected vDNAs in CCHFV-infected tick cells suggesting that they could represent a key element in the cell response to nairovirus infection and might represent a more general mechanism of innate immunity against RNA viral infection.

Sign in / Sign up

Export Citation Format

Share Document