scholarly journals Epidemiology of Crimean-Congo Hemorrhagic Fever (CCHF) in Africa—Underestimated for Decades

2021 ◽  
Author(s):  
Ahmet Irfan Temur ◽  
Jens H. Kuhn ◽  
David B. Pecor ◽  
Dmitry A. Apanaskevich ◽  
Maryam Keshtkar-Jahromi
Keyword(s):  
Local Governments ◽  
Case Reports ◽  
Hemorrhagic Fever ◽  
Level Of Evidence ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus ◽  
Collection Data ◽  
Level 3 ◽  
The Impact ◽  
Level 2

Crimean-Congo hemorrhagic fever (CCHF) is endemic in Africa, but the epidemiology remains to be defined. Using a broad database search, we reviewed the literature to better define CCHF evidence in Africa. We used a One Health approach to define the impact of CCHF by reviewing case reports, human and animal serology, and records of CCHF virus (CCHFV) isolations (1956–mid-2020). In addition, published and unpublished collection data were used to estimate the geographic distribution of Hyalomma ticks and infection vectors. We implemented a previously proposed classification scheme for organizing countries into five categories by the level of evidence. From January 1, 1956 to July 25, 2020, 494 CCHF cases (115 lethal) were reported in Africa. Since 2000, nine countries (Kenya, Mali, Mozambique, Nigeria, Senegal, Sierra Leone, South Sudan, Sudan, and Tunisia) have reported their first CCHF cases. Nineteen countries reported CCHF cases and were assigned level 1 or level 2 based on maturity of their surveillance system. Thirty countries with evidence of CCHFV circulation in the absence of CCHF cases were assigned level 3 or level 4. Twelve countries for which no data were available were assigned level 5. The goal of this review is to inform international organizations, local governments, and healthcare professionals about shortcomings in CCHF surveillance in Africa to assist in a movement toward strengthening policy to improve CCHF surveillance.

scholarly journals Epidémiologie de la fièvre Hémorragique de Crimée-Congo (FHCC) chez les bovins dans le département de Boboye au Niger

2020 ◽  
Vol 14 (3) ◽  
pp. 698-705
Author(s):  
Alima Maïna ◽  
Abdoulkarim Issa Ibrahim ◽  
Abdou Alassane ◽  
Hassane Adakal
Keyword(s):  
Immunosorbent Assay ◽  
Disease Transmission ◽  
Local Governments ◽  
Indirect Elisa ◽  
Hemorrhagic Fever ◽  
Elisa Test ◽  
Enzyme Linked Immunosorbent Assay ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus ◽  
Made In

La distribution et la dynamique des populations des tiques est un élément clé dans la connaissance des maladies transmises par ces vecteurs. C’est ainsi que cette étude a été conduite afin de mieux connaître l’épidémiologie de la Fièvre Hémorragique de Crimée-Congo (FHCC) dans les 8 communes du département de Boboye au Niger, où 355 sérums de bovins ont été collectés. En plus des sérums, des tiques ont été collectées sur 144 bovins, soit 18 par commune. Les sérums ont été soumis à un test ELISA (Enzyme Linked Immunosorbent Assay) indirect pour la détection d’anticorps anti-FHCC. Soixante-douze (72) éleveurs ont été interviewés sur leur connaissance de l’écologie des tiques, vecteurs du virus de la FHCC. Les résultats de l’enquête ont révélé que les éleveurs n’ont pas recours aux acaricides et que, dans leur majorité (55/72 soit 76,4 %), ils pratiquent la transhumance. L’étude a permis l’identification de 1342 tiques réparties en trois genres : Hyalomma (91,7%), Amblyomma (5,7%) et Rhipicephalus (Boophilus) (2,6%). La séroprévalence globale a été de 9,1±0,03%. Les communes de Harikanassou et Kiota ont été celles où les fortes prévalences ont été observées de 26,7 ± 12,9% et 22,5 ±12,9%. Le virus de la FHCC est en circulation chez la population animale, alors des investigations doivent être faites chez la population humaine.Mots clés : Anticorps anti-FHCC, Enzyme Linked Immunosorbent Assay Indirecte, Prévalence, Sérums, Tiques.   English Title: Crimean-Congo Hemorrhagic Fever (CCHF) ’s Epidemiology in cattle in Boboye’s department of Niger Republic To understand disease transmission by ticks, knowledge of population dynamics and distribution of these vectors are essentials. To sought that, the epidemiology of Crimean-Congo Hemorrhagic Fever (CCHF) in Niger Republic was studied by sampling 355 bovines (sera and ticks) in eight (8) local governments in Boboye’s department. Eighteen (18) bovines were sampled for ticks collection per local government making them a total of 144 bovine. Indirect ELISA test (enzyme-linked immunosorbent assay) was used to detect anti- CCHF antibodies. Seventy-two (72) farmers were surveyed on their knowledge on ticks’ ecology, main vectors of CCHF virus. The results revealed that farmers are not using acaricides, and their majority (55/72 thus 76.4%) practice Transhumance. The study allowed the identification of 1342 ticks distributed in 3 genus: Hyalomma (91.7%), Amblyomma (5.7%) and Rhipicephalus (Boophilus) (2.6%). The global seroprevalence against CCHF was (9.1 ± 0.03) %. Harikanassou and Kiota were the most affected local governments with respectively (26.7±12.9) % and (22.5±12,9) % prevalence. CCHV virus is circulating in animal population, so investigations must be made in human population. Keywords: Anti-CCHF antibodies, Indirect Enzyme Linked Immunosorbent Assay, Prevalence, Sera, Ticks.

scholarly journals Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tahmineh Jalali ◽  
Mostafa Salehi-Vaziri ◽  
Mohammad Hassan Pouriayevali ◽  
Seyed Latif Mousavi Gargari
Keyword(s):  
Point Of Care ◽  
Hemorrhagic Fever ◽  
Diagnostic Methods ◽  
Clinical Samples ◽  
Crimean Congo Hemorrhagic Fever ◽  
Point Of Care Test ◽  
Specificity And Sensitivity ◽  
Rural And Remote Areas ◽  
Cchf Virus ◽  
Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Virus-derived DNA forms mediate the persistent infection of tick cells by Hazara virus and Crimean-Congo hemorrhagic fever virus

2021 ◽  
Author(s):  
Maria Vittoria Salvati ◽  
Claudio Salaris ◽  
Vanessa Monteil ◽  
Claudia Del Vecchio ◽  
Giorgio Palù ◽  
...  
Keyword(s):  
Viral Replication ◽  
Cell Lines ◽  
Persistent Infection ◽  
Hemorrhagic Fever ◽  
Viral Reservoir ◽  
Tick Cell ◽  
Infected Tick ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus ◽  
Model Virus

Crimean-Congo hemorrhagic fever (CCHF) is a severe disease of humans caused by CCHF virus (CCHFV), a biosafety level (BSL)-4 pathogen. Ticks of the genus Hyalomma are the viral reservoir and they represent the main vector transmitting the virus to its hosts during blood feeding. We have previously shown that CCHFV can persistently infect Hyalomma -derived tick cell lines. However, the mechanism allowing the establishment of persistent viral infections in ticks is still unknown. Hazara virus (HAZV) can be used as a BSL-2 model virus instead of CCHFV to study virus/vector interactions. To investigate the mechanism behind the establishment of a persistent infection, we developed an in vitro model with Hyalomma -derived tick cell lines and HAZV. As expected, HAZV, like CCHFV, persistently infects tick cells without any sign of cytopathic effect, and the infected cells can be cultured for more than three years. Most interestingly, we demonstrated the presence of short viral-derived DNA forms (vDNAs) after HAZV infection. Furthermore, we demonstrated that the antiretroviral drug AZT could inhibit the production of vDNAs, suggesting that vDNAs are produced by an endogenous retrotranscriptase activity in tick cells. Moreover, we collected evidence that vDNAs are continuously synthesized, thereby downregulating viral replication to promote cell survival. Finally, vDNAs were also detected in CCHFV-infected tick cells. In conclusion, vDNA synthesis might represent a strategy to control the replication of RNA viruses in ticks allowing their persistent infection. IMPORTANCE Crimean-Congo hemorrhagic fever (CCHF) is an emerging tick-borne viral disease caused by CCHF virus (CCHFV). Ticks of the genus Hyalomma can be persistently infected with CCHFV representing the viral reservoir, and the main vector for viral transmission. Here we showed that tick cells infected with Hazara virus, a nonpathogenic model virus closely related to CCHFV, contained short viral-derived DNA forms (vDNAs) produced by endogenous retrotranscriptase activity. vDNAs are transitory molecules requiring viral RNA replication for their continuous synthesis. Interestingly, vDNA synthesis seemed to be correlated with downregulation of viral replication and promotion of tick cell viability. We also detected vDNAs in CCHFV-infected tick cells suggesting that they could represent a key element in the cell response to nairovirus infection and might represent a more general mechanism of innate immunity against RNA viral infection.

Evaluating and Assessing the Quality and Impact of Coaching Services

2019 ◽  
pp. 133-142
Keyword(s):  
Student Learning ◽  
Assessment Model ◽  
Transfer Of Knowledge ◽  
Knowledge And Skills ◽  
Annual Basis ◽  
Level 3 ◽  
Four Levels ◽  
Student Reactions ◽  
The Impact ◽  
Level 2

This chapter offers best practices, methods, and strategies for evaluating and assessing coaching services once they have been implemented. In order to determine the extent to which the coaching services that have been implemented are impacting retention, a comprehensive assessment combined with thoughtful analysis of the assessment data must be undertaken on a regular and continuous cycle. The Kirkpatrick and Kirkpatrick (2006) four-level assessment model to evaluate the impact and effectiveness of the selected coaching program on an annual basis, for either an outsourced coaching service or an internal coaching unit or department, is the recommended approach detailed in this chapter. The four levels of the assessment are as follows: Level 1 of the assessment will measure student reactions to the coaching services; Level 2 will assess student learning through the use of pre- and post-coaching assessments; Level 3 will assess transfer of knowledge and skills; and Level 4 will assess the impact and results as a result of the coaching program. The chapter provides advice and discussion about when to conduct each level of the four-part assessment model and a comprehensive sample assessment that can be modified to fit the needs of a wide variety of programs and institutions.

The impact of Crimean-Congo hemorrhagic fever virus on public health

2013 ◽  
Vol 98 (2) ◽  
pp. 248-260 ◽  
Author(s):  
Marc Mertens ◽  
Katja Schmidt ◽  
Aykut Ozkul ◽  
Martin H. Groschup
Keyword(s):  
Public Health ◽  
Hemorrhagic Fever ◽  
Fever Virus ◽  
Crimean Congo Hemorrhagic Fever ◽  
Hemorrhagic Fever Virus ◽  
The Impact

scholarly journals Detection of the RNA for new multicomponent virus in patients with Crimean-Congo hemorrhagic fever in southern Russia

2020 ◽  
Author(s):  
Vladimir Ternovoi ◽  
Anastasia Gladysheva ◽  
Alexandra Sementsova ◽  
Anna Zaykovskaya ◽  
Anna Volynkina ◽  
...  
Keyword(s):  
Phylogenetic Analyses ◽  
Hemorrhagic Fever ◽  
European Part ◽  
Viral Rna ◽  
Crimean Congo Hemorrhagic Fever ◽  
Viral Genomes ◽  
Cchf Virus ◽  
European Part Of Russia ◽  
Human Sera ◽  
Southern Russia

Background: Recently, a new multicomponent RNA-containing virus was described and called as Jingmen tick virus (JMTV) supposedly belonging to flaviviruses. A virus consists of four viral particles and JMTV was firstly isolated from ticks in China and South America. Aims: Detection viral RNA specific for JMTV complex, sequencing genome fragments and taxonomy identification novel virus from JMTV complex in patients with Crimean-Congo hemorrhagic fever (CCHF) from southern European part of Russia. Materials and methods: Panel of 20 randomly selected sera from patients with confirmed Crimean-Congo hemorrhagic fever was collected in 2016 and was used for detection JMTV and CCHF viral RNA by PCR with experimental primers. Subsequent sequencing of isolated fragments of viral genomes was used for identification JMTV and CCHF virus genetic materials and phylogenetic analyses. Results: The viral RNAs of the CCHF virus and JMTV were detected in blood of four patients. Sequencing of the isolated PCR fragment of S segment CCHF virus allowed identifying these RNA isolates as Europe 1 lineage, subgroups Va and Vb of the CCHF virus that is a typical for the southern European part of the Russia. The nucleotide sequences of segment 2 (GP glycoprotein) of the JMTV were also detected by RP PCR and sequencing in these human sera. The new JMTV isolates were clustered together by phylogenetic analysis. The level of nucleotide identity for newly discovered JMTV isolates was only about 81-82% with comparison to the previously described European variants (Kosovo) of the JMTV. Conclusions: The results suggest that viral genomic RNA for new multicomponent flavivirus named as Manych virus and related to the JMTV complex was discovered in sera of CCHF patients in Russia.

scholarly journals Molecular Assay on Detection of Crimean Congo Hemorrhagic Fever (CCHF) Virus in Ixodid Ticks Collected from Livestock in Slaughterhouse from South of Iran

2020 ◽  
Author(s):  
Mostafa Salehi-Vaziri ◽  
Hassan Vatandoos ◽  
Alireza Sanei-Dehkordi ◽  
Mehdi Fazlalipour ◽  
Mohammad Hassan Pouriayevali ◽  
...  
Keyword(s):  
Tick Infestation ◽  
Hemorrhagic Fever ◽  
The Body ◽  
Ixodid Ticks ◽  
Public Health Issue ◽  
Hard Tick ◽  
Crimean Congo Hemorrhagic Fever ◽  
Hard Ticks ◽  
Slaughter House ◽  
Cchf Virus

Background: Ticks are vectors of a wide variety of pathogens that can be transmitted to humans, and tick-borne diseas­es are a significant public health issue worldwide. The present study was carried out on the hard tick infestation of live­stock transported to Rafsanjan slaughter house in the southeast of Iran. Methods: A cross-sectional survey was carried out biweekly from April to September 2016 to determine tick infesta­tion of the meat-producing animals. All the livestock included in our study were thoroughly inspected for the presence of hard ticks on different parts of their bodies. Results: A total of 258 hard ticks were collected from the body of livestock hosts. The ticks that were sampled were classified into two genera and five species: Hyalomma marginatum, Hy. anatolicum, Hy. asiaticum, Hy. dromedarii, and Rhipicephalus sanguineus. Hyalomma dromedarii was the most abundant species in the study area. More than 50 per­cent of the sampled ticks were collected from the body of camels brought to the slaughter house however molecular analysis showed no Crimean Congo Hemorrhagic Fever (CCHF) virus infection in tick specimens. The Sex ratio of the sampled hard ticks shows that female tick infestation was more common among the study livestock. Conclusion: Due to the crucial role of hard ticks in the transmission of different pathogens to humans, additional inves­tigations are necessary to determine the risk of consumption of infested meat-producing animals in the study area.

scholarly journals Crimean-Congo hemorrhagic fever virus antibody prevalence in Mauritanian livestock (cattle, goats, sheep and camels) is stratified by the animal’s age

2021 ◽  
Vol 15 (4) ◽  
pp. e0009228
Author(s):  
Ansgar Schulz ◽  
Yahya Barry ◽  
Franziska Stoek ◽  
Aliou Ba ◽  
Jana Schulz ◽  
...  
Keyword(s):  
Clinical Symptoms ◽  
Small Ruminants ◽  
Hemorrhagic Fever ◽  
Immunofluorescence Assay ◽  
Fever Virus ◽  
Crimean Congo Hemorrhagic Fever ◽  
Prevalence Studies ◽  
Hemorrhagic Fever Virus ◽  
Generalized Linear Mixed Effects ◽  
The Impact

Crimean-Congo hemorrhagic fever virus (CCHFV) is one of the most widespread zoonotic arthropod-borne viruses in many parts of Africa, Europe and Asia. It belongs to the family of Nairoviridae in the genus of Orthonairovirus. The main reservoir and vector are ticks of the genus Hyalomma. Livestock animals (such as cattle, small ruminants and camels) develop a viremias lasting up to two weeks with absence of clinical symptoms, followed by seroconversion. This study was carried out to assess risk factors that affect seroprevalence rates in different species. In total, 928 livestock animal samples (cattle = 201; sheep = 247; goats = 233; camels = 247) from 11 out of 13 regions in Mauritania were assayed for CCHFV-specific immunoglobulin G (IgG) antibodies using enzyme-linked immunosorbent assays (ELISA) (including a novel indirect camel-IgG-specific CCHFV ELISA). Inconclusive results were resolved by an immunofluorescence assay (IFA). A generalized linear mixed-effects model (GLMM) was used to draw conclusions about the impact of certain factors (age, species, sex and region) which might have influenced the CCHFV antibody status of surveyed animals. In goats and sheep, about 15% of the animals were seropositive, whereas in cattle (69%) and camels (81%), the prevalence rate was significantly higher. On average, cattle and camels were up to twice to four times older than small ruminants. Interestingly, the seroprevalence in all species was directly linked to the age of the animals, i.e. older animals had significantly higher seroprevalence rates than younger animals. The highest CCHFV seroprevalence in Mauritania was found in camels and cattle, followed by small ruminants. The large proportion of positive animals in cattle and camels might be explained by the high ages of the animals. Future CCHFV prevalence studies should at least consider the age of surveyed animals in order to avoid misinterpretations.

scholarly journals K-MEANS CLUSTERING UNTUK PEMETAAN DAERAH RAWAN DEMAM BERDARAH

2019 ◽  
Vol 7 (1) ◽  
Author(s):  
Suprihatin Suprihatin ◽  
Yustina Retno Wahyu Utami ◽  
Didik Nugroho
Keyword(s):  
Hemorrhagic Fever ◽  
Flow Diagram ◽  
Literature Study ◽  
System Use ◽  
Level 3 ◽  
Data Flow Diagram ◽  
Level 1 ◽  
The Right ◽  
Level 2 ◽  
Collection Methods

District Nogosari is one of the dengue-prone areas in Boyolali District. During the period of 2012 to 2014, there was a significant increase in dengue cases at Boyolali district. For the reasons above, the study is focused on how to cluster Areas DHF-Prone using K-Means method. Clustering is based on the parameter of the number of dengue cases in the sporadic and endemic zones. There are several types of data collection methods that include: observation, interview, and literature study. Design of this proposed system use modeling language the context diagram and data flow diagram. The system is implemented using PHP Programming Language and MYSQL database. This system cluster 3 level zones of Endemic and 3 level zones of Sporadic based on geographic information systems. The result of system testing using the silhouette coefficient on the sporadic zone is the average coefficient for level 1 is 0.837, level 2 is 0.858, and level 3 is 0.773 that means the object has been in the right group. The proposed system is expected to be a consideration in preventing, controlling and eradicating dengue hemorrhagic fever.Keywords: Endemic, Sporadic, K-Means clustering, Dengue hemorrhagic fever.

scholarly journals ANTHROPOMETRIC VALUES OF SPANISH BEACH VOLLEYBALL PLAYERS IN RELATION TO SPORTS PERFORMANCE LEVEL

2020 ◽  
Vol 26 (3) ◽  
pp. 206-210
Author(s):  
Miriam Esther Quiroga Escudero ◽  
Antonio Palomino Martín ◽  
Samuel Sarmiento Montesdeoca ◽  
David Rodríguez Ruiz ◽  
Juan Manuel García Manso
Keyword(s):  
Selection Process ◽  
Performance Level ◽  
Sports Performance ◽  
Level Of Evidence ◽  
Results Of Treatment ◽  
Talent Selection ◽  
Volleyball Players ◽  
Level 3 ◽  
Level 1 ◽  
Level 2

ABSTRACT Introduction Since its debut at the 1996 Atlanta Olympics, beach volleyball has grown on the international sports scene. An extensive collection of data from several countries and levels of competition will provide a database that can be used to characterize beach volleyball players and define references for training stages. Objective The purpose of this study was to describe and compare the anthropometric profiles of Spanish male and female beach volleyball players at different levels of competition in relation to sports performance. Methods The sample comprised 150 players participating in the 2011 Spanish Beach Volleyball Championships (Under 19, Under 21, and Senior categories). Using the ranking provided by the Royal Spanish Volleyball Federation, the subjects were distributed by performance level (level 1: players ranked first to fourth; level 2: players ranked fifth to ninth; and level 3: players ranked tenth to seventeenth). The study comprised a group of male players, with 18 level 1 ( M1 ), 39 level 2 ( M2 ), and 22 level 3 players ( M3 ), and a group of female players, with 18 level 1 ( F1 ), 41 level 2 ( F2 ), and 12 level 3 players ( F3 ). Results The top level male sample ( M1 ) had a significantly lower average age (19.33 years) than the men’s international elite players (30 years). The top Spanish players of both genders had much lower values for height and body weight than the international elite players. Conclusions Height and fat component are responsible for the differences between top and lower level beach volleyball players, for both men and women. Moreover, as the level of performance increases, players are taller and have a lower fat component. In view of the data observed in this study, the talent selection process in Spanish beach volleyball should aim to select taller individuals than at present. Level of evidence III; Therapeutic studies-Investigating the results of treatment.

Sign in / Sign up

Export Citation Format

Share Document