scholarly journals Metody stosowane do wykrywania i identyfikacji toksyn botulinowych w próbkach klinicznych i żywności*

2020 ◽  
Vol 74 ◽  
pp. 116-130
Author(s):  
Karolina Rudnicka ◽  
Karolina Durka ◽  
Paweł Chwaluk ◽  
Magdalena Chmiela
Keyword(s):  
Clostridium Botulinum ◽  
Diagnostic Method ◽  
Clinical Symptoms ◽  
Diagnostic Methods ◽  
Alternative Methods ◽  
Clinical Samples ◽  
Laboratory Methods ◽  
Gram Positive Bacteria ◽  
Botulinum Neurotoxins ◽  
Foodborne Botulism

Botulism is a severe neuroparalytic illness, which affects the nervous system. It is caused by botulinum neurotoxins (BoNTs), produced by anaerobic gram-positive bacteria Clostridium botulinum. There are 7 serotypes of BoNT A-G, but BoNT A/B/D/E plays a major role in botulism affecting humans. Foodborne botulism (classic botulism) is the most frequent clinical manifestation occurring after consumption of food containing botulinum neurotoxins. The diagnosis of botulism is based on clinical symptoms; however, recommended and alternative laboratory methods are used to confirm the etiology of symptoms and the identification of BoNT toxin type. The aim of this work was to present the epidemiology of foodborne botulism in Poland and to gather and analyze the available diagnostic methods that allow us to detect BoNT in clinical samples. Using the epidemiological reports of National Institute of Hygiene in Poland and findings presented in the Przegląd Epidemiologiczny, the incidence of classical botulism in Poland has been presented over a period of recent 18 years. Searching for the optimal diagnostic method for BoNT identification in various samples, we have confronted the sensitivity and specificity of recently available alternative methods with classical biological assay.

A point-of-care diagnostic for differentiating Ebola from endemic febrile diseases

2018 ◽  
Vol 10 (471) ◽  
pp. eaat0944 ◽  
Author(s):  
David Sebba ◽  
Alexander G. Lastovich ◽  
Melody Kuroda ◽  
Eric Fallows ◽  
Joshua Johnson ◽  
...  
Keyword(s):  
Ebola Virus ◽  
Clinical Symptoms ◽  
Point Of Care ◽  
Hemorrhagic Fever ◽  
Diagnostic Methods ◽  
Outbreak Detection ◽  
Molecular Diagnostic ◽  
Clinical Samples ◽  
Live Virus ◽  
And Control

Hemorrhagic fever outbreaks such as Ebola are difficult to detect and control because of the lack of low-cost, easily deployable diagnostics and because initial clinical symptoms mimic other endemic diseases such as malaria. Current molecular diagnostic methods such as polymerase chain reaction require trained personnel and laboratory infrastructure, hindering diagnostics at the point of need. Although rapid tests such as lateral flow can be broadly deployed, they are typically not well-suited for differentiating among multiple diseases presenting with similar symptoms. Early detection and control of Ebola outbreaks require simple, easy-to-use assays that can detect and differentiate infection with Ebola virus from other more common febrile diseases. Here, we developed and tested an immunoassay technology that uses surface-enhanced Raman scattering (SERS) tags to simultaneously detect antigens from Ebola, Lassa, and malaria within a single blood sample. Results are provided in <30 min for individual or batched samples. Using 190 clinical samples collected from the 2014 West African Ebola outbreak, along with 163 malaria positives and 233 negative controls, we demonstrated Ebola detection with 90.0% sensitivity and 97.9% specificity and malaria detection with 100.0% sensitivity and 99.6% specificity. These results, along with corresponding live virus and nonhuman primate testing of an Ebola, Lassa, and malaria 3-plex assay, indicate the potential of the SERS technology as an important tool for outbreak detection and clinical triage in low-resource settings.

scholarly journals Bayesian Analysis of Three Methods for Diagnosis of Cystic Echinococcosis in Sheep

Pathogens ◽  
2020 ◽  
Vol 9 (10) ◽  
pp. 796
Author(s):  
Piero Bonelli ◽  
Federica Loi ◽  
Maria Giovanna Cancedda ◽  
Angela Peruzzu ◽  
Elisabetta Antuofermo ◽  
...  
Keyword(s):  
Cystic Echinococcosis ◽  
Predictive Value ◽  
Latent Class ◽  
Clinical Symptoms ◽  
Diagnostic Methods ◽  
Analysis Model ◽  
Laboratory Methods ◽  
Gross Pathology ◽  
Immunological Tests ◽  
Diagnostic Capabilities

Diagnosis of cystic echinococcosis (CE) in sheep is essentially based on necropsy findings. Clinical symptoms can be easily overlooked, while the use of immunological tests is still not recommended for an intra vitam diagnosis. This study assessed the performances of three post-mortem laboratory methods in the diagnosis of ovine CE. In the absence of a single and accurate test as a gold standard, the results of multiple analytical tests can be combined to estimate diagnostic performance based on a Bayesian statistical approach. For this purpose, livers (n = 77), and lungs (n = 79) were sampled from adult sheep and examined using gross pathology, histopathology and molecular analyses. Data from the three diagnostic methods were analyzed using a Bayesian latent class analysis model to evaluate their diagnostic accuracy in terms of sensitivity (Se), specificity (Sp), positive predictive value (PPV) and negative predictive value (NPV). The gross pathology examination revealed excellent diagnostic capabilities in diagnosing ovine CE with an Se of 99.7 (96.7–99.8), Sp of 97.5 (90.3–99.8), PPV of 97.6 (90.5–100), and NPV of 99.7 (96.5–100). The experimental design used in this work could be implemented as a validation protocol in a quality assurance system.

scholarly journals Alpha-Synuclein in the Gastrointestinal Tract as a Potential Biomarker for Early Detection of Parkinson’s Disease

2020 ◽  
Vol 21 (22) ◽  
pp. 8666
Author(s):  
Dominika Fricova ◽  
Jana Harsanyiova ◽  
Alzbeta Kralova Trancikova
Keyword(s):  
Parkinson’S Disease ◽  
Parkinson's Disease ◽  
Neurodegenerative Diseases ◽  
Clinical Symptoms ◽  
Neuronal Degeneration ◽  
Alpha Synuclein ◽  
Diagnostic Methods ◽  
Alternative Methods ◽  
Peripheral Tissues ◽  
Potential Biomarker

The primary pathogenesis associated with Parkinson’s disease (PD) occurs in peripheral tissues several years before the onset of typical motor symptoms. Early and reliable diagnosis of PD could provide new treatment options for PD patients and improve their quality of life. At present, however, diagnosis relies mainly on clinical symptoms, and definitive diagnosis is still based on postmortem pathological confirmation of dopaminergic neuronal degeneration. In addition, the similarity of the clinical, cognitive, and neuropathological features of PD with other neurodegenerative diseases calls for new biomarkers, suitable for differential diagnosis. Alpha-synuclein (α-Syn) is a potential PD biomarker, due to its close connection with the pathogenesis of the disease. Here we summarize the currently available information on the possible use of α-Syn as a biomarker of early stages of PD in gastrointestinal (GI) tissues, highlight its potential to distinguish PD and other neurodegenerative diseases, and suggest alternative methods (primarily developed for other tissue analysis) that could improve α-Syn detection procedures or diagnostic methods in general.

scholarly journals Coccidiosis Disease in Cattle in Indonesia and Development of Diagnostic Techniques

2019 ◽  
Vol 29 (3) ◽  
pp. 133
Author(s):  
Fitrine Ekawasti ◽  
April H Wardhana
Keyword(s):  
Diagnostic Method ◽  
Clinical Symptoms ◽  
Eimeria Species ◽  
Morphological Characteristics ◽  
Diagnostic Techniques ◽  
Diagnostic Methods ◽  
Economic Losses ◽  
Eimeria Spp ◽  
The Government ◽  
Cattle Farms

Coccidiosis is a parasitic disease caused by the protozoan of the order Coccidia, the family Eimeriidae of the genus Eimeria which breeds rapidly in the digestive tract and is the most difficult disease to be controlled on cattle farms. Eimeria spp. in cattle can cause high economic losses and increase susceptibility against infectious diseases. Therefore, coccidiosis in cattle needs attention from the government. This paper reviews a number of diagnostic methods that can be used in the detection of Eimeria spp. in cattle based on the goals and objectives of the examination. The coccidiosis cases often do not show any clinical symptoms but can cause sudden death in livestock. The diagnostic method that still used at present is based on its morphology that should not be used in identifying Eimeria species because the morphological characteristics Eimeria spp. have similar shape and size structures between species (resembling morphology). An appropriate diagnostic method for Eimeria is needed in the context of controlling coccidiosis strategically.

scholarly journals Effectiveness of CRISPR based tools as alternative methods for diagnosing COVID-19

2021 ◽  
Vol 8 (3) ◽  
pp. 150-152
Author(s):  
Shefali Mehta ◽  
Aditi Mehta
Keyword(s):  
Diagnostic Method ◽  
Diagnostic Methods ◽  
Alternative Methods ◽  
Molecular Diagnostic ◽  
Epigenome Editing ◽  
Adaptive Immune ◽  
Efficiency And Effectiveness ◽  
Associated Proteins ◽  
Rapid Pace ◽  
Molecular Diagnostic Method

The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas (CRISPR – Associated Proteins) systems are prokaryotic adaptive immune mechanisms that are used for cleaving the invading nucleic acids in nature. Due to this reason, the CRISPR-based tools are used in numerous applications like genome and transcriptome engineering, gene therapy, epigenome editing and many others. In addition, the issue of errors in these tests is also increasing at a very rapid pace, due to which their reliability and efficiency and effectiveness are getting severely hampered. Therefore, it may not be wrong to say that there is a still a lot more room for improvement and development to enable, widespread, rapid, and scalable testing of the COVID-19 virus. In this regard, the RT-qPCR tests can be used as a routine molecular diagnostic method for detecting any COVID-19 symptoms. However, there are various limitations that mar the use and implementation of the RT-qPCR tests. But a few of these shortcomings can be overcome by using alternative molecular diagnostic methods like the CRISPR based tests.

scholarly journals Investigation of Botulinum Neurotoxin Types from Clostridium botulinum Causing A Recent Outbreak in Vietnam

2021 ◽  
Vol 37 (4) ◽  
Author(s):  
La Thi Huong Huyen ◽  
Nguyen Thuy Linh ◽  
Nguyen Trung Thanh ◽  
Pham Yen
Keyword(s):  
Clostridium Botulinum ◽  
Stop Codon ◽  
Food Poisoning ◽  
Developed Countries ◽  
Mouse Bioassay ◽  
Gene Encoding ◽  
Pcr Products ◽  
Botulinum Neurotoxins ◽  
Specific Amplification ◽  
Foodborne Botulism

Clostridium botulinum is one of the causes of undiagnosed sudden deaths in humans due to the lethal botulinum neurotoxins (BoNTs). Foodborne botulism rarely occurs in developed countries because of being closely monitored, in opposite to developing countries including Vietnam. In the August 2020 food poisoning outbreak in Vietnam, presence of Clostridium botulinum and BoNTs was identified by culture and mouse bioassay, however, information regarding the possible toxin types was unclear. To examine the types of toxin, we designed primers for specific amplification of gene regions encoding the light chain (LC) domains for both BoNT/A and BoNT/B. After optimization, the expected PCR products were sent for sequencing. The results showed that the sequence of gene encoding BoNT/A LC was 99.2% identical to the CB-27 strain. The sequence of gene encoding BoNT/B LC was approximately 98.8% identical to reference strains. Additionally, we analyzed the sequences of the inferred proteins and identified a substitution that resulted in an early stop codon as previously found in a defective form of BoNT/B. Collectively, we provided the first evidence for C. botulinum strain possessing A(b) type in this studied outbreak. Further enzyme activity and neutralization assays are necessary to validate this preliminary toxin typing.

scholarly journals Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tahmineh Jalali ◽  
Mostafa Salehi-Vaziri ◽  
Mohammad Hassan Pouriayevali ◽  
Seyed Latif Mousavi Gargari
Keyword(s):  
Point Of Care ◽  
Hemorrhagic Fever ◽  
Diagnostic Methods ◽  
Clinical Samples ◽  
Crimean Congo Hemorrhagic Fever ◽  
Point Of Care Test ◽  
Specificity And Sensitivity ◽  
Rural And Remote Areas ◽  
Cchf Virus ◽  
Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Sign in / Sign up

Export Citation Format

Share Document