Successful Medical Management of Recalcitrant Fusarium solani Keratitis: Molecular Identification and Susceptibility Patterns

2012 ◽  
Vol 174 (3) ◽  
pp. 233-237 ◽  
Author(s):  
Hande Taylan Sekeroglu ◽  
Elif Erdem ◽  
Meltem Yagmur ◽  
Ramazan Gumral ◽  
Reha Ersoz ◽  
...  
Keyword(s):  
Molecular Identification ◽  
Fusarium Solani ◽  
Medical Management ◽  
Susceptibility Patterns

scholarly journals Identifikasi Molekuler Kapang Asosiasi Spons menggunakan Metode DNA Barcoding

2021 ◽  
Vol 10 (1) ◽  
pp. 48-54
Author(s):  
Stefanie Jessica Henny Larasati ◽  
Agus Sabdono ◽  
Mada Triandala Sibero
Keyword(s):  
Dna Barcoding ◽  
Trichoderma Reesei ◽  
Molecular Identification ◽  
Fusarium Solani ◽  
Dna Amplification ◽  
The Body ◽  
Universal Primers ◽  
Fruiting Body Formation ◽  
Marine Biotechnology ◽  
Filter Feeders

Spons merupakan organisme yang memiliki pori-pori dan termasuk kedalam filum Porifera. Hewan ini merupakan filter feeders dimana spons menyaring makanannya masuk kedalam rongga tubuhnya, sehingga spons dapan memakan partikel organik algae, dan mikroba, termasuk kapang. Kapang merupakan mikroorganisme eukariotik dari kingdom fungi, multiseluler, menghasilkan miselium tanpa pembentukan badan buah. Kapang dapat berfungsi sebagai penjaga keseimbangan ekosistem di perairan. Tujuan dari penelitian ini adalah mengidentifikasi dua isolat kapang yang telah diisolasi dari inang spons di ekosistem mangrove dengan menggunakan DNA barcoding. Metode dalam penelitian ini yaitu peremajaan isolat, karakterisasi morfologi yaitu warna koloni, tekstur, reverse, exudates, sclerotia, bentuk konidia, konidiofor, spora, dan septa. Identifikasi molekuler dari ekstraksi DNA, amplifikasi, elektroforesis, visualisasi DNA, sekuens dan BLAST. Optimasi suhu annealing dilakukan pada amplifikasi DNA. Berdasarkan identifikasi molekuler dengan menggunakan primer universal ITS1 5' TCCGTAGGTGAACCTGCGG 3' dan ITS4 5' TCCTCCGCTTATTGATATGC 3' dan persamaan homologi, isolat MKMS 2.1 merupakan Trichoderma reesei (100%) dan PKMS 2.2 merupakan spesies Fusarium solani (99,81%). A sponge is an organism that has pores and belongs to the Porifera phylum. These animals are filter feeders where the sponge filters its food into the body cavity, so the sponge can eat organic algae particles, and microbes, including fungi. Mold is a eukaryotic microorganism from Fungi kingdom, multicellular, that forms mycelium without fruiting body formation. Mold has an important role in balancing the environmental quality in an ecosystem. The purpose of this study was to identify two molds that had been isolated from sponge in the mangrove ecosystem using DNA barcoding. The study was conducted in April-October 2019 in Laboratory of Tropical Marine Biotechnology using the experimental laboratory method. The methods in this research were isolation refreshment, morphological characterization which were consisted of colony color, texture, reverse, exudates, sclerotia, conidia, conidiophores, spores, and septa. Molecular identification consisted of DNA extraction, amplification, electrophoresis, DNA visualization, sequences and BLAST. Annealing temperature optimization is carried out on DNA amplification. Based on molecular identification using universal primers ITS1 5 'TCCGTAGGTGAACCTGCGG 3' and ITS4 5 'TCCTCCGCTTATTGATATGC 3' and homological equations, MKMS 2.1 isolates were identified as Trichoderma reesei (100%) and PKMS 2.2 were identified as Fusarium solani (99.81%).

scholarly journals Molecular Identification and Antifungal Susceptibility Patterns of Candida Species Isolated from Candidemia Patients in Yasuj, Southwestern Iran

2021 ◽  
Vol 14 (7) ◽  
Author(s):  
Shaghayegh Rostami Yasuj ◽  
Maral Gharaghani ◽  
Seyed Sajjad Khoramrooz ◽  
Marjan Salahi ◽  
Ali Keshtkari ◽  
...  
Keyword(s):  
Mortality Rate ◽  
Amphotericin B ◽  
Molecular Identification ◽  
Candida Species ◽  
Antifungal Susceptibility ◽  
Hospitalized Patients ◽  
Susceptibility Tests ◽  
In Vitro Antifungal Susceptibility ◽  
Susceptibility Patterns

Background: Candidemia is the most common systemic infection in hospitalized patients causing high mortality. Hence, the diagnosis of this infection in the early stage with appropriate antifungal therapy is paramount. Objectives: The study aimed at molecular identification of Candida species isolated from candidemia patients and evaluation of the in vitro antifungal susceptibility patterns of these strains to fluconazole, amphotericin B, and caspofungin. Methods: In the present study, 800 hospitalized patients who were suspected to have candidemia were sampled. Candida species were isolated and identified based on morphological characteristics and PCR-sequencing of the ITS1-5.8S-ITS2 region. Antifungal susceptibility tests for fluconazole, amphotericin B, and caspofungin were performed according to the Clinical and Laboratory Standards Institute protocol M27-A3. Also, clinical data were recorded from the patients' records. Results: Twenty-seven patients among the sample of hospitalized patients were found to have candidemia. A total of 33.3% of candidemia patients were treated with amphotericin B, in which case the mortality rate was 14.8%. The majority of patients (59%) were from the neonatal intensive care unit, and premature birth was the most common underlying condition. Candida albicans (n = 18; 66.6%) was the most common species isolated from blood cultures, followed by C. parapsilosis (n = 7; 25.9%), C. pelliculosa (n = 1; 3.7%), and C. tropicalis (n = 1; 3.7%). Only one C. albicans isolate resistant to fluconazole (minimum inhibitory concentration = 32 µg/mL). Conclusions: Generally, C. albicans has been the most frequent causative agent of candidemia. Resistance to antifungal drugs among candidemia agents was rare. Also, the identification of Candida isolates at the species level with in vitro antifungal susceptibility tests helps manage candidemia patients better and decrease the mortality rate among them.

scholarly journals Molecular Identification and Antifungal Susceptibility Patterns of Clinical Dermatophytes Following CLSI and EUCAST Guidelines

2017 ◽  
Vol 3 (2) ◽  
pp. 17 ◽  
Author(s):  
Yubhisha Dabas ◽  
Immaculata Xess ◽  
Gagandeep Singh ◽  
Mragnayani Pandey ◽  
Suneeta Meena
Keyword(s):  
Molecular Identification ◽  
Antifungal Susceptibility ◽  
Susceptibility Patterns

scholarly journals Kanker Batang: Penyakit Baru pada Kopi di Lampung

2019 ◽  
Vol 15 (1) ◽  
pp. 9
Author(s):  
Suryo Wiyono ◽  
Andika Septiana Suryaningsih ◽  
Ali Wafa ◽  
Efi Toding Tondok ◽  
Bonjok Istiaji ◽  
...  
Keyword(s):  
Molecular Identification ◽  
Fusarium Solani ◽  
Stem Canker ◽  
New Disease ◽  
Coffee Plantations ◽  
Canker Disease ◽  
Coffee Plants ◽  
Colony Shape ◽  
Canker Pathogens ◽  
Shape And Size

Stem Canker: A New Disease of coffee in LampungStem cancer is a new disease that has attacked smallholder coffee plantations in Lampung since 2010. The cause of the disease was unknown. This study aims to describe the symptoms of the disease, the incidence of the disease in the affected plantation, and identify morphologically and molecularly the canker pathogens of the coffee stem canker diseases. All stages of Koch’s postulate were carried out in laboratories and greenhouses. The isolated pathogens were morphologically characterized by colony shape and color as well as the conidia shape and size. Molecular identification was carried out by using a general primer (ITS1 and ITS4) and followed by sequencing. The main symptoms of the disease are stem cancer and dieback, as well as more infecting older plants. Pathogen of the coffee stem canker disease that attacks coffee plants in Lampung has been identified as Fusarium solani which has 99% homology with F. solani KY245947.1.

Molecular Identification, And Antifungal Susceptibility Patterns of Candida Species Isolated From Candidemia Patients in Yasuj, Southwestern Iran

2021 ◽  
Author(s):  
Shaghayegh Rostami Yasuj ◽  
Seyed Sajad Khoramrooz ◽  
Marjan Salahi ◽  
Ali Keshtkari ◽  
Jabar Taghavi ◽  
...  
Keyword(s):  
Mortality Rate ◽  
Amphotericin B ◽  
Molecular Identification ◽  
Antifungal Susceptibility ◽  
Hospitalized Patients ◽  
Antifungal Drugs ◽  
Its2 Region ◽  
Susceptibility Tests ◽  
Susceptibility Patterns

Abstract Candidemia is the most common systemic infection in hospitalized patients and causing high mortality. Hence, the diagnosis of this infection in the early-stage with appropriate antifungal therapy has been attributed to the lowest mortality. The aims of this study are molecular identification of Candida species isolated from candidemia patients and evaluated the in vitro antifungal susceptibility patterns of these strains to fluconazole, amphotericin B, and caspofungin. In the present study, 800 hospitalized patients who suspected candidemia were sampled. Candida species were isolated and identified based on morphological and PCR-sequencing of the ITS1-5.8S-ITS2 region. Antifungal susceptibility tests for fluconazole, amphotericin B, and caspofungin was performed according to the Clinical and Laboratory Standards Institute M27-A3. Also, clinical data were recorded from patient's records. Overall, 27 candidemia patients were detected among hospitalized patients. 33.3% of candidemia patients were treated with amphotericin B, however, the mortality rate was 14.8%. The majority of patients (59%) were from the neonatal intensive care unit and premature born was the most underlying condition. C. albicans (n = 18; 66.6%) was the most common species isolated from blood cultures, followed by C.parapsilosis (n = 7; 25.9%), C.pelliculosa ( n = 1;3.7% ) and C.tropicalis (n = 1;3.7%). Only one C. albicans isolate were resistance to fluconazole (MIC = 32 µg/mL). Generally, C. albicans has been the most frequent causative agent of candidemia. Resistance to antifungal drugs among candidemia agents was rare. Also, the identification of Candida isolates at the species level with in-vitro antifungal susceptibility tests can manage and decrease the mortality rate among candidemia patients.

Sign in / Sign up

Export Citation Format

Share Document