IBUN2755 Bacillus strain controls seedling root and bacterial panicle blight caused by Burkholderia glumae

Rice is an important source of food for more than half the world’s population. Bacterial panicle blight (BPB) is a disease of rice characterized by grain discoloration or sheath rot caused mainly by Burkholderia glumae . B. glumae synthesizes toxoflavin, an essential virulence factor, that is required for symptoms of the disease. The products of the tox operons, ToxABCDE and ToxFGHI, are responsible for the synthesis and the proton motive force (PMF)-dependent secretion of toxoflavin, respectively. The DedA family is a highly conserved membrane protein family found in most bacterial genomes that likely function as membrane transporters. Our previous work has demonstrated that absence of certain DedA family members results in pleiotropic effects, impacting multiple pathways that are energized by PMF. We have demonstrated that a member of the DedA family from Burkholderia thailandensis , named DbcA, is required for the extreme polymyxin resistance observed in this organism. B. glumae encodes a homolog of DbcA with 73% amino acid identity to Burkholderia thailandensis DbcA. Here, we created and characterized a B. glumae Δ dbcA strain. In addition to polymyxin sensitivity, B. glumae Δ dbcA is compromised for virulence in several BPB infection models and secretes only low amounts of toxoflavin (∼15% of wild type levels). Changes in membrane potential in B. glumae Δ dbcA were reproduced in the wild type strain by the addition of sub-inhibitory concentrations of sodium bicarbonate, previously demonstrated to cause disruption of PMF. Sodium bicarbonate inhibited B. glumae virulence in rice suggesting a possible non-toxic chemical intervention for bacterial panicle blight. IMPORTANCE Bacterial panicle blight (BPB) is a disease of rice characterized by grain discoloration or sheath rot caused mainly by Burkholderia glumae . The DedA family is a highly conserved membrane protein family found in most bacterial genomes that likely function as membrane transporters. Here, we constructed a B. glumae mutant with a deletion in a DedA family member named dbcA and report a loss of virulence in models of BPB. Physiological analysis of the mutant shows that the proton motive force is disrupted, leading to reduction of secretion of the essential virulence factor toxoflavin. The mutant phenotypes are reproduced in the virulent wild type strain without an effect on growth using sodium bicarbonate, a nontoxic buffer that has been reported to disrupt the PMF. The results presented here suggest that bicarbonate may be an effective antivirulence agent capable of controlling BPB without imposing an undue burden on the environment.

Download Full-text

Association of Burkholderia glumae and B. gladioli with Panicle Blight Symptoms on Rice in Panama

Plant Disease ◽

10.1094/pdis-91-6-0767c ◽

2007 ◽

Vol 91 (6) ◽

pp. 767-767 ◽

Cited By ~ 26

Author(s):

R. Nandakumar ◽

M. C. Rush ◽

F. Correa

Keyword(s):

United States ◽

Fatty Acid ◽

16S Rdna ◽

Latin American ◽

The United States ◽

Unknown Etiology ◽

Rice Grain ◽

Burkholderia Glumae ◽

Specific Primers ◽

Panicle Blight

Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5′ACACGG AACACCTGGGTA3′ and BGR 5′TCGCTCTCCCGAAGAGAT3′) gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5′CGAGCT AATACCGCGAAA3′ and BLR 5′AGACTCGA GTCAACTGA3′) identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5′AGAGTTTGATCCTGGCTCAG3′ and 16SR5′GGCTACCTTGTTACGACTT3′) and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.

Download Full-text

Prevalence of Burkholderia glumae in rice crops in Ecuador

The Journal of Agriculture of the University of Puerto Rico ◽

10.46429/jaupr.v102i1-2.17532 ◽

2018 ◽

Vol 102 (1-2) ◽

pp. 65-78

Author(s):

Lenin Celiano Paz-Carrasco ◽

Luz Diana Intriago-Mendoza ◽

Marcos Fernando Basso ◽

Roberto E. Celi-Herán

Keyword(s):

Economic Importance ◽

23S Rrna ◽

Bacterial Isolates ◽

Severe Damage ◽

Burkholderia Glumae ◽

Genetic Studies ◽

Molecular Assays ◽

Blight Disease ◽

Panicle Blight

Burkholderia glumae is the agent responsible for bacterial panicle blight disease (BPBD) of rice that causes severe damage to this crop worldwide. During 2012 and 2013, symptoms of BPBD were observed in Palestina city, located in Guayas province, Ecuador. In 2014, the presence of B. glumae was confirmed at this location. In view of the socio-economic importance of rice in Ecuador, this research aimed to investigate the prevalence of B. glumae in other rice-producing regions. Eighteen bacterial isolates obtained from blighted kernels were characterized. Physiological, biochemical, serological, and molecular assays and the amplification of the 16S-23S rRNA ITS of the bacterial isolates collected confirmed the identity of the BPBD-associated bacterium. Pathogenicity assays verified the ability of these isolates to produce discoloration, spotting, and empty grains, symptoms associated with BPBD. Antibiotic assays showed that EC-EELS-01 isolate was sensitive to ciprofloxacin and tetracycline, and resistant to polymyxin. The dissemination and prevalence of B. glumae were confirmed in the rice-producing areas of El Oro, Cañar, Guayas, and Los Rios provinces. This research will serve to develop genetic studies to characterize the population in the B. glumae isolates in Ecuador.

Download Full-text

Warming increases Bacterial Panicle Blight (Burkholderia glumae) occurrences and impacts on USA rice production

PLoS ONE ◽

10.1371/journal.pone.0219199 ◽

2019 ◽

Vol 14 (7) ◽

pp. e0219199 ◽

Cited By ~ 3

Author(s):

Aaron M. Shew ◽

Alvaro Durand-Morat ◽

Lawton L. Nalley ◽

Xin-Gen Zhou ◽

Clemencia Rojas ◽

...

Keyword(s):

Rice Production ◽

Burkholderia Glumae ◽

Panicle Blight

Download Full-text

Bacterial Panicle Blight and Burkholderia glumae: from pathogen biology to disease control

Phytopathology ◽

10.1094/phyto-09-20-0401-rvw ◽

2020 ◽

Author(s):

Laura Ortega ◽

Clemencia Rojas

Keyword(s):

Biological Control ◽

Disease Resistance ◽

Disease Control ◽

Virulence Factors ◽

Plant Disease Resistance ◽

Plant Disease ◽

Rice Production ◽

Burkholderia Glumae ◽

Insight Into ◽

Panicle Blight

Bacterial Panicle Blight (BPB), caused by the bacterium Burkholderia glumae, has affected rice production worldwide. In spite of its importance, neither the disease nor its causal agent are well understood. Moreover, methods to manage BPB are still lacking. Nevertheless, the emerging importance of this pathogen has stimulated research to identify the mechanisms of pathogenicity, to gain insight into plant disease resistance, and to develop strategies to manage the disease. In this review, we consolidate current information regarding the virulence factors that have been identified in B. glumae and present a model of the disease and the pathogen. We also provide an update on the current research status to develop methods to control the disease especially through biological control approaches and through the development of resistant cultivars.

Download Full-text

Genome Sequence and Adaptation Analysis of the Human and Rice Pathogenic Strain Burkholderia glumae AU6208

Pathogens ◽

10.3390/pathogens10020087 ◽

2021 ◽

Vol 10 (2) ◽

pp. 87

Author(s):

Zhouqi Cui ◽

Sai Wang ◽

Kaleem Ullah Kakar ◽

Guanglin Xie ◽

Bin Li ◽

...

Keyword(s):

Genome Sequence ◽

Type Strain ◽

Antibiotic Biosynthesis ◽

Chronic Infections ◽

Burkholderia Glumae ◽

Niche Adaptation ◽

History Of ◽

Clinical Conditions ◽

Important Disease ◽

Panicle Blight

Burkholderia glumae causes rice (Oryza sativa) bacterial panicle blight, which is an increasingly economically important disease worldwide. As the first B. glumae strain isolated from patients with chronic infections, AU6208 has been reported as an opportunistic clinic pathogen. However, our understanding of the molecular mechanism underlying human pathogenesis by B. glumae remains rudimentary. In this study, we report the complete genome sequence of the human-isolated B. glumae strain AU6208 and compare this to the genome of the rice-pathogenic B. glumae type strain LMG 2196T. Analysis of the average nucleotide identity demonstrated 99.4% similarity between the human- and plant-pathogenic strains. However, the phenotypic results from this study suggest a history of niche adaptation and divergence. In particular, we found 44 genes were predicted to be horizontally transferred into AU6208, and most of these genes were upregulated in conditions that mimic clinical conditions. In these, the gene pair sbnAB encodes key enzymes in antibiotic biosynthesis. These results suggest that horizontal gene transfer in AU6208 may be responsible for selective advantages in its pathogenicity in humans. Our analysis of the AU6208 genome and comparison with that of LMG 2196T reveal the evolutionary signatures of B. glumae in the process of switching niches from plants to humans.

Download Full-text

Bioinspired Green Synthesis of Zinc Oxide Nanoparticles from a Native Bacillus cereus Strain RNT6: Characterization and Antibacterial Activity against Rice Panicle Blight Pathogens Burkholderia glumae and B. gladioli

Nanomaterials ◽

10.3390/nano11040884 ◽

2021 ◽

Vol 11 (4) ◽

pp. 884

Author(s):

Temoor Ahmed ◽

Zhifeng Wu ◽

Hubiao Jiang ◽

Jinyan Luo ◽

Muhammad Noman ◽

...

Keyword(s):

Zinc Oxide ◽

Antibacterial Activity ◽

Bacillus Cereus ◽

Zinc Oxide Nanoparticles ◽

Broth Culture ◽

Oxide Nanoparticles ◽

Rrna Gene ◽

Burkholderia Glumae ◽

Vis Spectroscopy ◽

Panicle Blight

Burkholderia glumae and B. gladioli are seed-borne rice pathogens that cause bacterial panicle blight (BPB) disease, resulting in huge rice yield losses worldwide. However, the excessive use of chemical pesticides in agriculture has led to an increase in environmental toxicity. Microbe-mediated nanoparticles (NPs) have recently gained significant attention owing to their promising application in plant disease control. In the current study, we biologically synthesize zinc oxide nanoparticles (ZnONPs) from a native Bacillus cereus RNT6 strain, which was taxonomically identified using 16S rRNA gene analysis. The biosynthesis of ZnONPs in the reaction mixture was confirmed by using UV–Vis spectroscopy. Moreover, XRD, FTIR, SEM-EDS, and TEM analysis revealed the functional groups, crystalline nature, and spherical shape of ZnONPs with sizes ranging from 21 to 35 nm, respectively. Biogenic ZnONPs showed significant antibacterial activity at 50 µg mL−1 against B. glumae and B. gladioli with a 2.83 cm and 2.18 cm zone of inhibition, respectively, while cell numbers (measured by OD600) of the two pathogens in broth culture were reduced by 71.2% and 68.1%, respectively. The ultrastructure studies revealed the morphological damage in ZnONPs-treated B. glumae and B. gladioli cells as compared to the corresponding control. The results of this study revealed that ZnONPs could be considered as promising nanopesticides to control BPB disease in rice.

Download Full-text

Deteksi Molekuler Burkholderia glumae, Penyebab Penyakit Hawar Malai Padi

Jurnal Perlindungan Tanaman Indonesia ◽

10.22146/jpti.30259 ◽

2018 ◽

Vol 22 (1) ◽

pp. 98

Author(s):

Methy Handiyanti ◽

Siti Subandiyah ◽

Tri Joko

Keyword(s):

Morphological Characteristics ◽

Its Region ◽

Selective Medium ◽

Rice Seed ◽

Disease Area ◽

Burkholderia Glumae ◽

Rice Varieties ◽

Blight Disease ◽

Spreading Potential ◽

Panicle Blight

The presence of bacterial panicle blight disease caused by Burkholderia glumae have been reported to infect rice plants in Indonesia. There have been no reports of yield losses due to B. glumae infection, but this pathogen is seed-borne so that it can increase the spreading potential to other areas. This study aims to determine the spread of the disease area of bacterial panicle blight in Java and to detect B. glumae based on ITS region of 16-23S rDNA. Methods for this research include surveys and random sampling of rice seeds directly from farmers and the Food Crop and Horticulture Center, Agriculture Office of Yogyakarta. The bacteria were isolated using S-PG selective medium, then DNA extraction was performed and amplified using a pair of primers BGF 5’-ACACGGAACACCTGGGTA-3’ and BGR 5’-TCGCTCTCC CGAAGAGAT-3’. 101 isolates were obtained from 21 seed samples consisting of 11 rice varieties from nine regions in Java that has different morphological characteristics. The eight isolates were detected as B. glumae by using ITS primers, i.e., isolates ChgCM.4, IRP.3, IRP.6b, InSB.1a, InSB.2a, InSB.3a, InSB.5a, and InSB.6a. The eight isolates were isolated from seed samples of Cirebon, Purworejo and Banyuwangi. This study shows that bacterial panicle blight disease has found in several rice varieties and locations in Java, and the ITS primer can be used for early detection of B. glumae in rice seed samples. IntisariPenyakit hawar malai yang disebabkan oleh bakteri patogen Burkholderia glumae mulai banyak dilaporkan menginfeksi tanaman padi di Indonesia. Belum ada laporan mengenai kerugian akibat infeksi B. glumae di Indonesia, namun sifatnya yang tular benih dapat meningkatkan potensi menyebar ke wilayah lain. Penelitian ini bertujuan untuk mengetahui wilayah sebar penyakit hawar malai di Jawa dan mendeteksi secara molekuler berdasarkan urutan basa gen 16-23S rDNA internal transcribed spacer (ITS). Metode yang dilakukan meliputi survei dan pengambilan sampel biji padi secara acak langsung dari petani dan UPT Balai Pengembangan Perbenihan Tanaman Pangan dan Hortikultura, Dinas Pertanian Yogyakarta. Sampel biji padi diisolasi menggunakan media selektif S-PG, kemudian dilakukan ekstraksi DNA, dan diamplifikasi menggunakan primer BGF 5’-ACACGGAACACCTGGGTA-3’ dan BGR 5’-TCGCTCTCC CGAAGAGAT-3’. Hasil survei di lapangan diperoleh 21 sampel biji yang terdiri dari 11 varietas padi dari sembilan wilayah di Jawa. Hasil isolasi diperoleh 101 isolat dan masing-masing isolat tersebut memiliki karakteristik morfologi yang berbeda. Delapan isolat dari total isolat yang diuji terdeteksi B. glumae menggunakan primer ITS, yaitu isolat ChgCM.4, IRP.3, IRP.6b, InSB.1a, InSB.2a, InSB.3a, InSB.5a, dan InSB.6a. Kedelapan isolat tersebut merupakan hasil isolasi sampel biji dari wilayah Cirebon, Purworejo, dan Banyuwangi. Hasil penelitian menunjukkan bahwa penyakit hawar malai bakteri sudah terdeteksi pada varietas padi di beberapa lokasi wilayah Jawa, dan penggunaan primer ITS dapat digunakan untuk deteksi dini B. glumae pada sampel biji padi secara molekuler.

Download Full-text

Emergence of Bacterial Panicle Blight Caused by Burkholderia glumae in North India

Plant Disease ◽

10.1094/pdis-01-15-0094-pdn ◽

2015 ◽

Vol 99 (9) ◽

pp. 1268-1268 ◽

Cited By ~ 7

Author(s):

K. K. Mondal ◽

C. Mani ◽

G. Verma

Keyword(s):

North India ◽

Burkholderia Glumae ◽

Panicle Blight

Download Full-text

Identification of a seed-borne rice bacterium, Burkholderia glumae using cultural, morphological and biochemical methods

Journal of Applied and Natural Science ◽

10.31018/jans.v7i2.645 ◽

2015 ◽

Vol 7 (2) ◽

pp. 562-566

Author(s):

Deepali Singh ◽

Karuna Vishunavat

Keyword(s):

Nitrate Reduction ◽

Agar Medium ◽

Carbon Sources ◽

Burkholderia Glumae ◽

Arginine Dihydrolase ◽

The World ◽

Control And Management ◽

Oxidase Reaction ◽

Bacterial Plant Pathogen ◽

Panicle Blight

Burkholderia glumae is a seed-borne rice bacterium that causes bacterial panicle blight (BPB), which is a promising disease in many rice-growing areas around the world. The bacterium has been successfully grown on King’s B agar medium (KBM) at 280C for 48 hrs. It is Gram negative, non-spore-forming, rod-shaped with cell size 0.5 to 0.7 - 1.5 to 2.0 μm with rounded ends. The colony appears as grayish white or yellow due to the pigment. The bacterium gave positive test in gelatin liquefaction, KOH solubility and nitrate reduction and while negative test in starch hydrolysis, oxidase reaction, levan production and arginine dihydrolase test. The bacterium utilized different carbon sources viz., sugars, amino acids, sugar alcohols and organic acids when examined through BiologTMGN2 Microplate System. This study would help in control and management of seed-borne bacterial plant pathogen B. glumae.

Download Full-text