scholarly journals Prevalence of Burkholderia glumae in rice crops in Ecuador

2018 ◽  
Vol 102 (1-2) ◽  
pp. 65-78
Author(s):  
Lenin Celiano Paz-Carrasco ◽  
Luz Diana Intriago-Mendoza ◽  
Marcos Fernando Basso ◽  
Roberto E. Celi-Herán
Keyword(s):  
Economic Importance ◽  
23S Rrna ◽  
Bacterial Isolates ◽  
Severe Damage ◽  
Burkholderia Glumae ◽  
Genetic Studies ◽  
Molecular Assays ◽  
Blight Disease ◽  
Panicle Blight

Burkholderia glumae is the agent responsible for bacterial panicle blight disease (BPBD) of rice that causes severe damage to this crop worldwide. During 2012 and 2013, symptoms of BPBD were observed in Palestina city, located in Guayas province, Ecuador. In 2014, the presence of B. glumae was confirmed at this location. In view of the socio-economic importance of rice in Ecuador, this research aimed to investigate the prevalence of B. glumae in other rice-producing regions. Eighteen bacterial isolates obtained from blighted kernels were characterized. Physiological, biochemical, serological, and molecular assays and the amplification of the 16S-23S rRNA ITS of the bacterial isolates collected confirmed the identity of the BPBD-associated bacterium. Pathogenicity assays verified the ability of these isolates to produce discoloration, spotting, and empty grains, symptoms associated with BPBD. Antibiotic assays showed that EC-EELS-01 isolate was sensitive to ciprofloxacin and tetracycline, and resistant to polymyxin. The dissemination and prevalence of B. glumae were confirmed in the rice-producing areas of El Oro, Cañar, Guayas, and Los Rios provinces. This research will serve to develop genetic studies to characterize the population in the B. glumae isolates in Ecuador.

scholarly journals Deteksi Molekuler Burkholderia glumae, Penyebab Penyakit Hawar Malai Padi

2018 ◽  
Vol 22 (1) ◽  
pp. 98
Author(s):  
Methy Handiyanti ◽  
Siti Subandiyah ◽  
Tri Joko
Keyword(s):  
Morphological Characteristics ◽  
Its Region ◽  
Selective Medium ◽  
Rice Seed ◽  
Disease Area ◽  
Burkholderia Glumae ◽  
Rice Varieties ◽  
Blight Disease ◽  
Spreading Potential ◽  
Panicle Blight

The presence of bacterial panicle blight disease caused by Burkholderia glumae have been reported to infect rice plants in Indonesia. There have been no reports of yield losses due to B. glumae infection, but this pathogen is seed-borne so that it can increase the spreading potential to other areas. This study aims to determine the spread of the disease area of bacterial panicle blight in Java and to detect B. glumae based on ITS region of 16-23S rDNA. Methods for this research include surveys and random sampling of rice seeds directly from farmers and the Food Crop and Horticulture Center, Agriculture Office of Yogyakarta. The bacteria were isolated using S-PG selective medium, then DNA extraction was performed and amplified using a pair of primers BGF 5’-ACACGGAACACCTGGGTA-3’ and BGR 5’-TCGCTCTCC CGAAGAGAT-3’. 101 isolates were obtained from 21 seed samples consisting of 11 rice varieties from nine regions in Java that has different morphological characteristics. The eight isolates were detected as B. glumae by using ITS primers, i.e., isolates ChgCM.4, IRP.3, IRP.6b, InSB.1a, InSB.2a, InSB.3a, InSB.5a, and InSB.6a. The eight isolates were isolated from seed samples of Cirebon, Purworejo and Banyuwangi. This study shows that bacterial panicle blight disease has found in several rice varieties and locations in Java, and the ITS primer can be used for early detection of B. glumae in rice seed samples. IntisariPenyakit hawar malai yang disebabkan oleh bakteri patogen Burkholderia glumae mulai banyak dilaporkan menginfeksi tanaman padi di Indonesia. Belum ada laporan mengenai kerugian akibat infeksi B. glumae di Indonesia, namun sifatnya yang tular benih dapat meningkatkan potensi menyebar ke wilayah lain. Penelitian ini bertujuan untuk mengetahui wilayah sebar penyakit hawar malai di Jawa dan mendeteksi secara molekuler berdasarkan urutan basa gen 16-23S rDNA internal transcribed spacer (ITS). Metode yang dilakukan meliputi survei dan pengambilan sampel biji padi secara acak langsung dari petani dan UPT Balai Pengembangan Perbenihan Tanaman Pangan dan Hortikultura, Dinas Pertanian Yogyakarta. Sampel biji padi diisolasi menggunakan media selektif S-PG, kemudian dilakukan ekstraksi DNA, dan diamplifikasi menggunakan primer BGF 5’-ACACGGAACACCTGGGTA-3’ dan BGR 5’-TCGCTCTCC CGAAGAGAT-3’. Hasil survei di lapangan diperoleh 21 sampel biji yang terdiri dari 11 varietas padi dari sembilan wilayah di Jawa. Hasil isolasi diperoleh 101 isolat dan masing-masing isolat tersebut memiliki karakteristik morfologi yang berbeda. Delapan isolat dari total isolat yang diuji terdeteksi B. glumae menggunakan primer ITS, yaitu isolat ChgCM.4, IRP.3, IRP.6b, InSB.1a, InSB.2a, InSB.3a, InSB.5a, dan InSB.6a. Kedelapan isolat tersebut merupakan hasil isolasi sampel biji dari wilayah Cirebon, Purworejo, dan Banyuwangi. Hasil penelitian menunjukkan bahwa penyakit hawar malai bakteri sudah terdeteksi pada varietas padi di beberapa lokasi wilayah Jawa, dan penggunaan primer ITS dapat digunakan untuk deteksi dini B. glumae pada sampel biji padi secara molekuler.

scholarly journals RESISTANCE OF SEVERAL RICE VARIETIES AGAINST THE BACTERIAL PANICLE BLIGHT DISEASE (Burkholderia glumae)

2019 ◽  
Vol 19 (1) ◽  
pp. 15
Author(s):  
Nurni Wahidah ◽  
Irda Safni ◽  
Hasanuddin Hasanuddin ◽  
Lisnawita Lisnawita
Keyword(s):  
Leaf Sheath ◽  
Positive Control ◽  
Negative Control ◽  
Control Factor ◽  
Burkholderia Glumae ◽  
Rice Varieties ◽  
Blight Disease ◽  
Number Of Seeds ◽  
Empty Seeds ◽  
Panicle Blight

Resistance of Several Rice Varieties against the Bacterial Panicle Blight Disease (Burkholderia glumae) .Burkholderia glumae is included as A2 Quarantine Plant Pest Organism, which is found in some restricted area in Indonesia.  B. glumae is a seedborne pathogen that causes panicle blight, seedling rot, grain rotand leaf sheath browning on rice plants. This research was objected  to determine the resistance of five  rice varieties against bacterial panicle blight pathogen. The experiment was carried out at the screen house of Faculty of Agriculture, Universitas Sumatera Utara, Medan from May to September 2018. This experiment was designed using Factorial Completely Randomized Design (CRD) with 2 factors; Factor 1: B1 (sterile water as negative control), B2 (B. glumae isolate CH BJ), B3 (B. glumae isolate IR 64), B4 (B. glumae isolate IC PRC), B5 (B. glumae isolate DSMZ 9512ᵀ as positive control). Factor 2: V1 (Cisokan variety), V2 (Inpari 4 variety), V3 (Situbagendit variety), V4 (Inpari 32 variety) and V5 (Cidenu variety). The results showed that all five rice varieties were highly susceptible to bacterial panicle blight pathogen. Inpari 32 variety had the highest number of seeds and weight of 100 seeds and had the lowest percentage of empty seeds.  IR 64 variety had the lowest number of seeds and the weight of 100 seeds and had the highest percentage of empty seeds.

scholarly journals Leptospira Survey in Wild Boar (Sus scrofa) Hunted in Tuscany, Central Italy

Pathogens ◽  
2020 ◽  
Vol 9 (5) ◽  
pp. 377 ◽  
Author(s):  
Giovanni Cilia ◽  
Fabrizio Bertelloni ◽  
Marta Angelini ◽  
Domenico Cerri ◽  
Filippo Fratini
Keyword(s):  
16S Rrna ◽  
Wild Boar ◽  
Sus Scrofa ◽  
Central Italy ◽  
23S Rrna ◽  
Rrna Gene ◽  
Pathogenic Leptospira ◽  
Molecular Assays ◽  
Realtime Pcr ◽  
23S Rrna Gene

Leptospirosis is a re-emerging, worldwide zoonosis, and wild boar (Sus scrofa) are involved in its epidemiology as the reservoir. The aim of this study was to investigate the prevalence of Leptospira with serological, bacteriological, and molecular assays in wild boar hunted in Tuscany (Italy) during two hunting seasons. In total, 287 specimens of sera, kidneys, and liver were collected to perform microscopic agglutination tests (MATs), isolation, and RealTime PCR to detect pathogenic (lipL32 gene), intermediate (16S rRNA gene), and saprophytic (23S rRNA gene) Leptospira. Within sera, 39 (13.59%) were positive to the MAT, and Australis was the most represented serogroup (4.88%), followed by Pomona (4.18%), and Tarassovi (3.14%). Moreover, four Leptospira cultures were positive, and once isolates were identified, one was identified as L. borgpetersenii serovar Tarassovi, and three as L. interrogans serovar Bratislava. Pathogenic Leptospira DNA were detected in 32 wild boar kidneys (11.15%). The characterization through the amplification of the rrs2 gene highlighted their belonging to L. interrogans (23 kidneys), L. borgpetersenii (four), and L. kirschneri (one), while nine kidneys (3.14%) were positive for intermediate Leptospira, all belonging to L. fainei. The results of this study confirmed the importance of wild boar in the epidemiology of leptospirosis among wildlife in Central Italy.

scholarly journals Chemical or genetic alteration of proton motive force results in loss of virulence of Burkholderia glumae , the cause of rice bacterial panicle blight.

2021 ◽  
Author(s):  
Asif Iqbal ◽  
Pradip R. Panta ◽  
John Ontoy ◽  
Jobelle Bruno ◽  
Jong Hyun Ham ◽  
...  
Keyword(s):  
Sodium Bicarbonate ◽  
Wild Type Strain ◽  
Proton Motive Force ◽  
Membrane Transporters ◽  
Motive Force ◽  
Wild Type ◽  
Bacterial Genomes ◽  
Burkholderia Glumae ◽  
Sheath Rot ◽  
Panicle Blight

Rice is an important source of food for more than half the world’s population. Bacterial panicle blight (BPB) is a disease of rice characterized by grain discoloration or sheath rot caused mainly by Burkholderia glumae . B. glumae synthesizes toxoflavin, an essential virulence factor, that is required for symptoms of the disease. The products of the tox operons, ToxABCDE and ToxFGHI, are responsible for the synthesis and the proton motive force (PMF)-dependent secretion of toxoflavin, respectively. The DedA family is a highly conserved membrane protein family found in most bacterial genomes that likely function as membrane transporters. Our previous work has demonstrated that absence of certain DedA family members results in pleiotropic effects, impacting multiple pathways that are energized by PMF. We have demonstrated that a member of the DedA family from Burkholderia thailandensis , named DbcA, is required for the extreme polymyxin resistance observed in this organism. B. glumae encodes a homolog of DbcA with 73% amino acid identity to Burkholderia thailandensis DbcA. Here, we created and characterized a B. glumae Δ dbcA strain. In addition to polymyxin sensitivity, B. glumae Δ dbcA is compromised for virulence in several BPB infection models and secretes only low amounts of toxoflavin (∼15% of wild type levels). Changes in membrane potential in B. glumae Δ dbcA were reproduced in the wild type strain by the addition of sub-inhibitory concentrations of sodium bicarbonate, previously demonstrated to cause disruption of PMF. Sodium bicarbonate inhibited B. glumae virulence in rice suggesting a possible non-toxic chemical intervention for bacterial panicle blight. IMPORTANCE Bacterial panicle blight (BPB) is a disease of rice characterized by grain discoloration or sheath rot caused mainly by Burkholderia glumae . The DedA family is a highly conserved membrane protein family found in most bacterial genomes that likely function as membrane transporters. Here, we constructed a B. glumae mutant with a deletion in a DedA family member named dbcA and report a loss of virulence in models of BPB. Physiological analysis of the mutant shows that the proton motive force is disrupted, leading to reduction of secretion of the essential virulence factor toxoflavin. The mutant phenotypes are reproduced in the virulent wild type strain without an effect on growth using sodium bicarbonate, a nontoxic buffer that has been reported to disrupt the PMF. The results presented here suggest that bicarbonate may be an effective antivirulence agent capable of controlling BPB without imposing an undue burden on the environment.

scholarly journals First report of Erwina amylovora in Tuscany, Italy

2021 ◽  
Vol 60 (2) ◽  
pp. 253-257
Author(s):  
Duccio MIGLIORINI ◽  
Francesco PECORI ◽  
Aida RAIO ◽  
Nicola LUCHI ◽  
Domenico RIZZO ◽  
...  
Keyword(s):  
Fire Blight ◽  
Erwinia Amylovora ◽  
Chromosomal Region ◽  
Reca Gene ◽  
Plant Tissues ◽  
Molecular Assays ◽  
Pcr Assays ◽  
Blight Disease ◽  
Fruit Orchards ◽  
Symptomatic Plant

2-years-old plants of Pyrus communis showing symptoms of fire blight disease were sampled in an orchard in Tuscany (Italy) during Autumn 2020. Plants were obtained the previous spring from a commercial nursery located in a region where the disease is present since 1994. The collected material was processed in the lab in order to verify the presence of the bacterium Erwinia amylovora, the causal agent of fire blight. Pure isolates showing white mucoid colonies and levan producers on Levan medium were putatively assimilated to E. amylovora. DNA was extracted from the cultures and analysed with three molecular assays, including duplex PCR of the 29-Kb plasmid pEA29 and the ams chromosomal region, sequencing of the 16S rDNA and recA gene regions, two real-time PCR assays on symptomatic plant tissues. All tests confirmed the presence of E. amylovora. Symptomatic and surrounding plants were removed and immediately destroyed according to the regional phytosanitary protocol. This outcome poses a serious threat for fruit orchards in the area.

scholarly journals Association of Burkholderia glumae and B. gladioli with Panicle Blight Symptoms on Rice in Panama

Plant Disease ◽  
2007 ◽  
Vol 91 (6) ◽  
pp. 767-767 ◽  
Author(s):  
R. Nandakumar ◽  
M. C. Rush ◽  
F. Correa
Keyword(s):  
United States ◽  
Fatty Acid ◽  
16S Rdna ◽  
Latin American ◽  
The United States ◽  
Unknown Etiology ◽  
Rice Grain ◽  
Burkholderia Glumae ◽  
Specific Primers ◽  
Panicle Blight

Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5′ACACGG AACACCTGGGTA3′ and BGR 5′TCGCTCTCCCGAAGAGAT3′) gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5′CGAGCT AATACCGCGAAA3′ and BLR 5′AGACTCGA GTCAACTGA3′) identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5′AGAGTTTGATCCTGGCTCAG3′ and 16SR5′GGCTACCTTGTTACGACTT3′) and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.

scholarly journals Identification and Assessment of Genetic Similarity of Soil Bacterial Isolates of Pseudomonas spp. Using Molecular Techniques

2014 ◽  
Vol 63 (3) ◽  
pp. 291-298
Author(s):  
ANNA LISEK ◽  
LIDIA SAS PASZ ◽  
PAWEŁ TRZCIŃSKI
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Genetic Similarity ◽  
Sour Cherry ◽  
23S Rrna ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Bacterial Strains ◽  
The 16S Rrna Gene ◽  
Selection Of

Bacteria of the genus Pseudomonas are often components of bioproducts designed to enhance the condition of the soil and plants. The use of Pseudomonas bacteria in bioproducts must be preceded by the acquisition, characterization and selection of beneficial strains living in the soil. A prerequisite for the selection of bacterial strains for use in bioproducts is to be able to identify the isolates rapidly and accurately. To identify and differentiate 15 bacterial isolates obtained from the soil surrounding the roots of sour cherry trees and to assess their genetic similarity, the rep-PCR technique and restriction analysis of the 16S rRNA gene and the 16S-ITS-23S rRNA operon were used. In addition, a sequence analysis of the 16S rRNA gene was performed. The analyses made it possible to divide the isolates into four clusters and to confirm their affiliation with the Pseudomonas species. RFLP analysis of the 16S-ITS-23S rRNA operon enabled greater differentiation of the isolates than RFLP of the 16S rRNA gene. The greatest differentiation of isolates within the clusters was obtained after using the rep-PCR technique. However, none of the techniques was able to discriminate all the isolates, which indicates very high genetic similarity of the Pseudomonas isolates found in the same sample of soil from around the roots of sour cherry trees. The tests performed will find application for distinguishing and identifying Pseudomonas strains collected from the soil in order to select the most valuable bacterial strains that produce beneficial effects on plants.

scholarly journals Warming increases Bacterial Panicle Blight (Burkholderia glumae) occurrences and impacts on USA rice production

PLoS ONE ◽  
2019 ◽  
Vol 14 (7) ◽  
pp. e0219199 ◽  
Author(s):  
Aaron M. Shew ◽  
Alvaro Durand-Morat ◽  
Lawton L. Nalley ◽  
Xin-Gen Zhou ◽  
Clemencia Rojas ◽  
...  
Keyword(s):  
Rice Production ◽  
Burkholderia Glumae ◽  
Panicle Blight

Bacterial Panicle Blight and Burkholderia glumae: from pathogen biology to disease control

2020 ◽  
Author(s):  
Laura Ortega ◽  
Clemencia Rojas
Keyword(s):  
Biological Control ◽  
Disease Resistance ◽  
Disease Control ◽  
Virulence Factors ◽  
Plant Disease Resistance ◽  
Plant Disease ◽  
Rice Production ◽  
Burkholderia Glumae ◽  
Insight Into ◽  
Panicle Blight

Bacterial Panicle Blight (BPB), caused by the bacterium Burkholderia glumae, has affected rice production worldwide. In spite of its importance, neither the disease nor its causal agent are well understood. Moreover, methods to manage BPB are still lacking. Nevertheless, the emerging importance of this pathogen has stimulated research to identify the mechanisms of pathogenicity, to gain insight into plant disease resistance, and to develop strategies to manage the disease. In this review, we consolidate current information regarding the virulence factors that have been identified in B. glumae and present a model of the disease and the pathogen. We also provide an update on the current research status to develop methods to control the disease especially through biological control approaches and through the development of resistant cultivars.

Sign in / Sign up

Export Citation Format

Share Document