The first report of Meloidogyne enterolobii on Thai basil in Florida, United States

Thai basil (Ocimum basilicum var. thyrsiflora) is an important ethnic aromatic herb native to Southeast Asia. According to the Vegetable Production Handbook of Florida 2020-2021, Asian vegetables are currently grown on more than 4,000 ha in Florida, and Thai basil is one of the most commonly grown among these. Meloidogyne spp. cause severe damage to different basil cultivars (Brito et al. 2007). During May-July 2020, plant stunting and galled root symptoms were observed on Thai basil plants sampled from a commercial Asian vegetable farm in Wimauma, Florida (27°44.951' N; 82°16.271’ E); 1,972 root-knot nematode second-stage juveniles (J2s) were extracted from 200 cm3 soil. A pathogenicity test was performed in September 2020 at the University of Florida Gulf Coast Research and Education Center, Wimauma, Florida. Ten of 20, three-week-old nematode-free Thai basil plants were inoculated with 5,000 eggs of field nematode cultures. Two months after inoculation (temperature = 22.8 ± 3.8 °C, relative humidity = 85.6 ± 14.0 %), average gall index (Bridge and Page 1980) = 5.4 ± 1.1 were only observed in inoculated plants, and 69,276 ± 18,904 eggs were extracted from roots using the NaClO method (Hussey and Barker 1973); 5 ± 7 J2s / 200 cc soil were recovered by the modified Baermann funnel technique (Forge and Kimpinski 2007). Nematode reproduction factor (RF) = 13.86 ± 3.78 (Nicol et al. 2010). Morphological measurements (mean, standard deviation and range) of J2s (n=20) included body length = 394.0 ± 22.3 (362.8 - 437.9) µm, body width = 15.7 ± 1.2 (13.6 - 18.3) µm, and stylet length = 12.8 ± 1.1 (10.4-14.5) µm. The perineal pattern of matured female (n=5) was oval-shaped with coarse and smooth striate; the dorsal arch was high and round; no lateral line presented. Morphological characteristics of females and J2s were consistent with those described for M. enterolobii (Yang and Eisenback 1983). DNA was extracted from a single female picked from infected Thai basil root using NaOH digestion method (Hübschen et al. 2004). The D2-D3 expansion segment of 28S rDNA and the COXII region on mitochondrial DNA were amplified by PCR using the primers 28S391a/28S501 and C2F3/1108 (Ye et al. 2020); the species was also confirmed with species-specific primers Me-F/Me-R (Ye et al. 2020). PCR products were sequenced by the Genomic Sciences Laboratory (North Carolina State University, Raleigh, NC, USA) and the results were recorded in the NCBI with GeneBank Accession Nos. MW488150 and MW507374. The sequences showed 100% identity with M. enterolobii in D2/D3 (KP901079, KP411230) and COXII (MN809527, KX214350). M. enterolobii (M. mayaguensis) has been reported on sweet basil in Florida (Brito et al. 2008). To our knowledge, this is the first detection of M. enterolobii on Thai basil in Hillsborough County, Florida. It is not clear to what extent M. enterolobii reduces the yield of Thai basil, but the RF value obtained in the pathogenicity test indicates the crop is certainly a very good host. Limited information is available on the distribution of M. enterolobii in Florida and the US. M. enterolobii is known to break down the root-knot resistance of crops including soybean, sweet potatoes, and tomatoes (Philbrick et al. 2020). This nematode is considered one of the major emerging threats to agriculture in the southeastern US. A multistate research and outreach program (FINDMe program) was initiated in 2019 to study the distribution and management of this nematode in the southeastern US.

Download Full-text

First Report of Meloidogyne javanica on Globe Artichoke in Florida, USA

Plant Disease ◽

10.1094/pdis-10-21-2360-pdn ◽

2021 ◽

Author(s):

Mengyi Gu ◽

Hung Xuan Bui ◽

Shinsuke Agehara ◽

Johan Desaeger

Keyword(s):

Morphological Characteristics ◽

Meloidogyne Javanica ◽

The United States ◽

Pathogenicity Test ◽

Globe Artichoke ◽

Nematode Reproduction ◽

First Report ◽

Specialty Crop ◽

Florida Gulf Coast ◽

Meloidogyne Spp

Globe artichoke (Cynara cardunculus var. scolymus L.) is native to the Mediterranean region and cultivated worldwide for its edible flower buds and the medicinal value of its leaves (Pignone and Sonnante 2004). In 2019, artichokes were planted on 29 km2 predominantly in California, with a yield of over 100 million kg (USDA 2020). It has been grown as a specialty crop in Florida since 2017 (Agehara 2017a). Meloidogyne spp. (root-knot nematodes/RKNs) can lead to yield losses to artichoke (Greco et al. 2005). In June 2020, artichokes (cv. Imperial Star) with stunting, wilting, and galled-root symptoms were observed in a research field with sandy soil located at the University of Florida Gulf Coast Research and Education Center (UF/GCREC), Wimauma, Florida. The goal of this report was to identify the RKN species collected from two symptomatic artichoke roots. Morphological measurements (mean, standard deviation and range) of 15 second-stage juveniles (J2s) included body length = 409.1 ± 31.6 (360.3 - 471.3) µm, body width = 15.4 ± 1.6 (12.4 - 18.8) µm, and stylet length = 14.7 ± 0.7 (13.9 -16.1) µm. Perineal patterns of five matured females had a high dorsal arch and double lateral lines. Morphological characteristics of the RKN cultures were consistent with the description of M. javanica (Eisenback and Triantaphyllou 1991). DNA was extracted respectively from two RKN females isolated from the diseased artichoke roots. The nematode species was confirmed with primers Fjav/Rjav and resulted in ≈ 670 bp fragment (Zijlstra et al. 2000). The COXII region of mtDNA was amplified by C2F3/1108 (Powers and Harris 1993), and the sequencing results were submitted to the NCBI with GeneBank Accession No. MZ397905. The molecular sequences had 100% identity with M. javanica in COXII (MK033440 and MK033439). The pathogenicity test was conducted in the greenhouse at UF/GCREC from May to August 2021 (temperature = 26.7 ± 4.1°C, relative humidity = 83.9 ± 14.6 %). Each of the ten 6.5-in-diameter plastic pots containing 3.8-L pasteurized soil was seeded with one artichoke seed. Five pots were inoculated with 5000 eggs of the field RKN cultures 4-week after planting, and five pots served as the untreated control. Two months after inoculation, galled symptoms were only observed in inoculated plants with an average gall index (Bridge and Page 1980) of 6.2 ± 2.2; 99,240 ± 72,250 eggs were extracted from each root system, and the nematode reproduction factor was 19.9 ± 14.4. Meloidogyne spp. has been reported on artichoke in Europe, Asia, and South America (Greco et al. 2005). This is the first report of RKN on artichoke in the United States. Meloidogyne javanica caused severe root gall symptoms and visible aboveground damage in the form of chlorosis, stunting, and wilting of artichoke planted at the UF/GCREC research farm. Meloidogyne javanica is the predominant RKN species at the UF/GCREC research farm and one of the most common RKNs in Florida (Gu and Desaeger 2021). Artichoke is a new crop in Florida, and RKNs is likely to be one of the main soilborne problems for its production in the state. Its long growing season (October - May) (Agehara 2017b) allows for high nematode reproduction rates. Several new growers have already reported RKN as a problem in their fields. For artichoke to become a commodity in Florida, managing RKNs will be critical. This report provides new information on the risk that RKNs pose to artichoke, a newly established specialty crop in Florida.

Download Full-text

Morpho-molecular identification and pathogenicity test on fungal parasites of guava root-knot nematode eggs in Lampung, Indonesia

Biodiversitas Journal of Biological Diversity ◽

10.13057/biodiv/d210334 ◽

2020 ◽

Vol 21 (3) ◽

Author(s):

I Gede Swibawa I Gede ◽

YUYUN FITRIANA ◽

SOLIKHIN ◽

RADIX SUHARJO ◽

F.X. SUSILO ◽

...

Keyword(s):

Molecular Identification ◽

Morphological Characteristics ◽

Pathogenicity Test ◽

Root Knot Nematode ◽

Commercial Products ◽

Tomato Plants ◽

Greenhouse Test ◽

Nematode Eggs ◽

Fungal Parasites

Abstract. Swibawa IG, Fitriana Y, Solikhin, Suharjo R, Susilo FX, Rani E, Haryani MS, Wardana RA. 2020. Morpho-molecular identification and pathogenicity test on fungal parasites of guava root-knot nematode eggs in Lampung, Indonesia. Biodiversitas 21: 1108-1115. This study aimed to obtain and discover the identity of the species of fungal egg parasites of root-knot nematodes (RKN), which have a high pathogenic ability causing major losses in vegetable crops. The exploration of the fungi was carried out in 2016 and 2018 from Crystal guava plantations in East Lampung, Central Lampung, Tanggamus, and NirAma, a commercial product that has been used for controlling Meloidogyne sp. in Indonesia. Identification was carried out based on morphological characteristics and molecular-based gene sequential analysis of Intergenic Transcribed Spacer (ITS) 1 and ITS 4. A pathogenicity test was carried out in vitro and in a greenhouse using tomato plants as indicator plants. In the in vitro test, observations were made on the percentage of infected RKN eggs. The observations in the greenhouse test were carried out on RKN populations in the soil and roots of tomato plants, root damage (root knots), and damage intensity due to RKN infection. The exploration resulted in five isolates of fungal egg parasites of RKN from the guava plantations in East Lampung (2), Central Lampung (1), Tanggamus (1), and from the isolation results of commercial products (1). The isolates were given codes as B4120X (PT GGP PG1), B3010 (PT GGP PG4), B412G (PT GGP PG 4), B01TG (Tanggamus), and BioP (Commercial products). Based on their morphological characteristics, the isolates were classified into the genus of Paecilomyces. The results of molecular identification showed that the discovered fungi were Purpureocillium lilacinum (Thom.) Luangsa Ard. (Syn. Paecilomyces lilacinus (Thom.) Samson.). Based on the in vitro tests, the five fungal isolates were able to parasitize RKN eggs at 86.4-100%. In the greenhouse test, all isolates significantly suppressed nematode populations in the soil and tomato roots, inhibited the formation of root knots, and produced lower damage intensity compared to controls. Among all the isolates tested, B01TG had the best ability to infect nematode eggs (99.5%), suppressing the formation of root knots, nematode population in the soil and the roots of tomato plants, and the damage intensity compared to other isolates.

Download Full-text

Brugmansia suaveolens as a New Host for Root-Knot Nematode, Meloidogyne incognita, in Goiás State, Brazil

Plant Disease ◽

10.1094/pdis-06-21-1193-pdn ◽

2021 ◽

Author(s):

Daniel Dalvan Nascimento ◽

Edicleide Macedo da Silva ◽

Ana Paula Mendes Lopes ◽

Rivanildo Junior Ferreira ◽

Vanessa Rafaela Carvalho ◽

...

Keyword(s):

Large Scale ◽

Morphological Characteristics ◽

Molecular Techniques ◽

Cultivated Plants ◽

Pathogenicity Test ◽

Root Knot Nematode ◽

Trapezoidal Shape ◽

Angel’S Trumpet ◽

Brugmansia Suaveolens ◽

The World

Brugmansia suaveolens (Humb. and Bonpl. ex Willd.) Bercht. and J. Presl, also called White Angel’s Trumpet is an ornamental plant known, for its medicinal properties and as an invasive weed (Kwak et al., 2021; Petricevich et al., 2020). It belongs to the Solanaceae family, with a center of origin in South America, and it is currently found all over the world (Petricevich et al., 2020). In February 2020, B. suaveolens plants cultivated in a single garden in Vianópolis region (16°56'60.0"S 48°29'16.0"W), Goiás state, Brazil were observed presenting yellowing symptoms, with descending branches death. When the roots were inspected, a large number of galls were found, typical of root-knot nematodes. Samples of soil and root were sent to a Nematology Laboratory (LabNema) at São Paulo State University, Jaboticabal Campus. Forty-one thousand six hundred eggs and second-stage juveniles (J2s) were extracted from 100 cm³ of soil and 7,600 eggs and J2s of Meloidogyne sp. per gram of root. Morphological, enzymatic, and molecular techniques were used to identify the species. The perineal pattern of the females (n = 15) had a high dorsal arch, with thick streaks and a trapezoidal shape. The male labial region (n = 15) had a trapezoidal shape with apparent annulations (Eisenback and Hirschmann, 1981; Nascimento et al., 2021; Taylor and Netscher, 1974). The morphological characteristics of adults were similar to those originally described for M. incognita (Kofoid and White, 1919) Chitwood 1949. The profile of the isoenzyme esterase was studied (n = 16) and the phenotype I1, characteristic of M. incognita, was found (Esbenshade and Triantaphyllou, 1985). Genomic DNA (N = 20) was obtained through DNA of females, extracted by Worm Lysis Buffer (WLB) (Carvalho et al., 2019). Two sets of primers were used, Finc-1: GGGATGTGTAAATGCTCCTG, Rinc-1: CCCGCTACACCCTCAACTTC (Randig et al., 2002) and Finc-4: GTGAGGATTCAGCTCCCCAG, Rinc-4: ACGAGGAACATACTTCTCCGTCC (Meng et al., 2004), specific for M. incognita, which amplified fragments of 399 and 955 bp, respectively, confirming the species. A pathogenicity test was conducted under greenhouse conditions. Six newly formed seedlings were transplanted individually into 10-liter pots containing autoclaved soil and, subsequently, each plant was inoculated with 3,000 eggs and J2s from the original population of M. incognita. After 120 days, White Angel’s Trumpet plants showed reduced development, yellow leaves, and many root galls with abundant egg masses on the roots, unlike the non-inoculated plants. Nematodes were extracted from roots. The average recovered reached 78,458 eggs and J2s per plant, corresponding to a reproductive factor (RF) of 26.15. A high RF provides an alert for B. suaveolens cultivation in areas with a history of root-knot nematode infestation. Moreover, this disease outbreak might serve as a source of inoculum for large-scale cultivated plants near the farm, which are generally good hosts for M. incognita. This is the first report presenting Angel’s Trumpet as host of root-knot nematode, M. incognita, in Brazil and the world.

Download Full-text

SEM and TEM observations of sperm development in the testis of the freshwater fish Oreochromis mossambicus

Proceedings, annual meeting, Electron Microscopy Society of America ◽

10.1017/s0424820100157838 ◽

1990 ◽

Vol 48 (3) ◽

pp. 58-59

Author(s):

Daryl A. Cornish ◽

George L. Smit

Keyword(s):

Morphological Characteristics ◽

Oreochromis Mossambicus ◽

Breeding Cycle ◽

Limited Information ◽

North West ◽

The North ◽

Sem And Tem ◽

Sperm Development ◽

Ultrastructural Characteristics ◽

The University

Oreochromis mossambicus is currently receiving much attention as a candidater species for aquaculture programs within Southern Africa. This has stimulated interest in its breeding cycle as well as the morphological characteristics of the gonads. Limited information is available on SEM and TEM observations of the male gonads. It is known that the testis of O. mossambicus is a paired, intra-abdominal structure of the lobular type, although further details of its characteristics are not known. Current investigations have shown that spermatids reach full maturity some two months after the female becomes gravid. Throughout the year, the testes contain spermatids at various stages of development although spermiogenesis appears to be maximal during November when spawning occurs. This paper describes the morphological and ultrastructural characteristics of the testes and spermatids.Specimens of this fish were collected at Syferkuil Dam, 8 km north- west of the University of the North over a twelve month period, sacrificed and the testes excised.

Download Full-text

Genetic diversity of Meloidogyne spp. parasitising potato in Brazil and aggressiveness of M. javanica populations on susceptible cultivars

Nematology ◽

10.1163/15685411-00003032 ◽

2017 ◽

Vol 19 (1) ◽

pp. 69-80 ◽

Cited By ~ 9

Author(s):

Israel L. Medina ◽

Cesar B. Gomes ◽

Valdir R. Correa ◽

Vanessa S. Mattos ◽

Philippe Castagnone-Sereno ◽

...

Keyword(s):

Genetic Diversity ◽

Rapd Markers ◽

Potato Production ◽

Potato Cultivars ◽

Root Knot Nematode ◽

Root Knot Nematodes ◽

Nematode Reproduction ◽

Meloidogyne Spp ◽

Prevalent Species ◽

Reproduction Factor

Root-knot nematodes (Meloidogyne spp.) significantly impact potato production worldwide and in Brazil they are considered one of the most important group of nematodes affecting potatoes. The objectives of this study were to survey Meloidogyne spp. associated with potatoes in Brazil, determine their genetic diversity and assess the aggressiveness of M. javanica on two susceptible potato cultivars. Fifty-seven root-knot nematode populations were identified using esterase phenotyping, including Meloidogyne javanica, M. incognita, M. arenaria and M. ethiopica. Overall, root-knot nematodes were present in ca 43% of sampled sites, in which M. javanica was the most prevalent species, and the phenotypes Est J3, J2a and J2 occurred in 91.2, 6.7 and 2.1% of the positive samples, respectively. Other species, such as M. incognita, M. arenaria and M. ethiopica, were found less frequently and occurred at rates of 6.4, 4.3 and 2.1% of the samples, respectively. Sometimes, M. javanica was found in mixtures with other root-knot nematodes in ca 10.6% of sites containing Meloidogyne. After confirming the identification of 17 isolates of M. javanica and one isolate each of M. incognita, M. arenaria and M. ethiopica by SCAR markers, the populations were used to infer their genetic diversity using RAPD markers. Results revealed low intraspecifc genetic diversity among isolates (13.9%) for M. javanica. Similarly, M. javanica sub-populations (J2a) clustered together (81% of bootstrap), indicating subtle variation from typical J3 populations. The aggressiveness of four populations of M. javanica from different Brazilian states on two susceptible potato cultivars was tested under glasshouse conditions. Results indicated differences in aggressiveness among these populations and showed that potato disease was proportional to nematode reproduction factor.

Download Full-text

Morphological and phylogenetical analyses of pathogenic Hypomyces perniciosus isolates from Agaricus bisporus causing wet bubble disease in China

Phytotaxa ◽

10.11646/phytotaxa.491.2.2 ◽

2021 ◽

Vol 491 (2) ◽

pp. 115-130

Author(s):

CHUN-LAN ZHANG ◽

ZHENG-WEN JIN ◽

CAN SUN ◽

ODESHNEE MOODLEY ◽

JI-ZE XU ◽

...

Keyword(s):

Phylogenetic Relationships ◽

Agaricus Bisporus ◽

Morphological Characteristics ◽

Pathogenicity Test ◽

Test Results ◽

Phylogenetic Studies ◽

Group Ii

Hypomyces perniciosus is a destructive pathogen of Agaricus bisporus. The disease has been known to occur wherever A. bisporus is cultivated. Morphological characteristics have shown differences between reported isolates of H. perniciosus. However, clarification is needed to determine whether those isolates are the same species and an investigation of the phylogenetic relationships among them is warranted. Here, taxonomic and phylogenetic studies were carried out on 29 wet bubble disease pathogen isolates from China. Our analyses of the morphological characteristics and phylogenetic results support that they are the same H. perniciosus. Moreover, they are separated into two groups, groups ⅰ and groups ii. Pathogenicity test results inferred that group ii had weaker pathogenicity than group ⅰ. Consequently, we can deduce that wet bubble disease is still caused by H. perniciosus and isolates from two distinct groups.

Download Full-text

First Report of Stem and Foliage Blight of Chrysanthemum Caused by Phytophthora drechsleri in the United States

Plant Disease ◽

10.1094/pdis-03-21-0631-pdn ◽

2021 ◽

Author(s):

Charles Krasnow ◽

Nancy Rechcigl ◽

Jennifer Olson ◽

Linus Schmitz ◽

Steven N. Jeffers

Keyword(s):

United States ◽

South Carolina ◽

Sequence Similarity ◽

Morphological Characteristics ◽

The United States ◽

Universal Primers ◽

Broad Host Range ◽

Pathogenicity Test ◽

First Report ◽

Foliage Blight

Chrysanthemum (Chrysanthemum × morifolium) plants exhibiting stem and foliage blight were observed in a commercial nursery in eastern Oklahoma in June 2019. Disease symptoms were observed on ~10% of plants during a period of frequent rain and high temperatures (26-36°C). Dark brown lesions girdled the stems of symptomatic plants and leaves were wilted and necrotic. The crown and roots were asymptomatic and not discolored. A species of Phytophthora was consistently isolated from the stems of diseased plants on selective V8 agar (Lamour and Hausbeck 2000). The Phytophthora sp. produced ellipsoid to obpyriform sporangia that were non-papillate and persistent on V8 agar plugs submerged in distilled water for 8 h. Sporangia formed on long sporangiophores and measured 50.5 (45-60) × 29.8 (25-35) µm. Oospores and chlamydospores were not formed by individual isolates. Mycelium growth was present at 35°C. Isolates were tentatively identified as P. drechsleri using morphological characteristics and growth at 35°C (Erwin and Ribeiro 1996). DNA was extracted from mycelium of four isolates, and the internal transcribed spacer (ITS) region was amplified using universal primers ITS 4 and ITS 6. The PCR product was sequenced and a BLASTn search showed 100% sequence similarity to P. drechsleri (GenBank Accession Nos. KJ755118 and GU111625), a common species of Phytophthora that has been observed on ornamental and vegetable crops in the U.S. (Erwin and Ribeiro 1996). The gene sequences for each isolate were deposited in GenBank (accession Nos. MW315961, MW315962, MW315963, and MW315964). These four isolates were paired with known A1 and A2 isolates on super clarified V8 agar (Jeffers 2015), and all four were mating type A1. They also were sensitive to the fungicide mefenoxam at 100 ppm (Olson et al. 2013). To confirm pathogenicity, 4-week-old ‘Brandi Burgundy’ chrysanthemum plants were grown in 10-cm pots containing a peat potting medium. Plants (n = 7) were atomized with 1 ml of zoospore suspension containing 5 × 103 zoospores of each isolate. Control plants received sterile water. Plants were maintained at 100% RH for 24 h and then placed in a protected shade-structure where temperatures ranged from 19-32°C. All plants displayed symptoms of stem and foliage blight in 2-3 days. Symptoms that developed on infected plants were similar to those observed in the nursery. Several inoculated plants died, but stem blight, dieback, and foliar wilt were primarily observed. Disease severity averaged 50-60% on inoculated plants 15 days after inoculation. Control plants did not develop symptoms. The pathogen was consistently isolated from stems of symptomatic plants and verified as P. drechsleri based on morphology. The pathogenicity test was repeated with similar results. P. drechsleri has a broad host range (Erwin and Ribeiro 1996; Farr et al. 2021), including green beans (Phaseolus vulgaris), which are susceptible to seedling blight and pod rot in eastern Oklahoma. Previously, P. drechsleri has been reported on chrysanthemums in Argentina (Frezzi 1950), Pennsylvania (Molnar et al. 2020), and South Carolina (Camacho 2009). Chrysanthemums are widely grown in nurseries in the Midwest and other regions of the USA for local and national markets. This is the first report of P. drechsleri causing stem and foliage blight on chrysanthemum species in the United States. Identifying sources of primary inoculum may be necessary to limit economic loss from P. drechsleri.

Download Full-text

First Report of Rhizoctonia solani AG 4 on Lamb's Lettuce in Italy

Plant Disease ◽

10.1094/pd-90-1109c ◽

2006 ◽

Vol 90 (8) ◽

pp. 1109-1109 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

G. Gilardi ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Northern Italy ◽

Crown Rot ◽

Pathogenicity Test ◽

First Report ◽

Pathogenicity Tests ◽

Hyphal Diameter ◽

Wheat Kernels ◽

Extensive Necrosis

Lamb's lettuce or corn salad (Valerianella olitoria) is increasingly grown in Italy and used primarily in the preparation of mixed processed salad. In the fall of 2005, plants of lamb's lettuce, cv Trophy, exhibiting a basal rot were observed in some commercial greenhouses near Bergamo in northern Italy. The crown of diseased plants showed extensive necrosis, progressing to the basal leaves, with plants eventually dying. The first symptoms, consisting of water-soaked zonate lesions on basal leaves, were observed on 30-day-old plants during the month of October when temperatures ranged between 15 and 22°C. Disease was uniformly distributed in the greenhouses, progressed rapidly in circles, and 50% of the plants were affected. Diseased tissue was disinfested for 1 min in 1% NaOCl and plated on potato dextrose agar amended with 100 μg/liter of streptomycin sulfate. A fungus with the morphological characteristics of Rhizoctonia solani was consistently and readily isolated and maintained in pure culture after single-hyphal tipping (3). The five isolates of R. solani, obtained from affected plants successfully anastomosed with tester isolate AG 4, no. RT 31, received from R. Nicoletti of the Istituto Sperimentale per il Tabacco, Scafati, Italy (2). The hyphal diameter at the point of anastomosis was reduced, and cell death of adjacent cells occurred (1). Pairings were also made with AG 1, 2, 3, 5, 7, and 11 with no anastomoses observed between the five isolates and testers. For pathogenicity tests, the inoculum of R. solani (no. Rh. Vale 1) was grown on autoclaved wheat kernels at 25°C for 10 days. Plants of cv. Trophy were grown in 10-liter containers (20 × 50 cm, 15 plants per container) on a steam disinfested substrate (equal volume of peat and sand). Inoculations were made on 20-day-old plants by placing 2 g of infected wheat kernels at each corner of the container with 3 cm as the distance to the nearest plant. Plants inoculated with clean wheat kernels served as controls. Three replicates (containers) were used. Plants were maintained at 25°C in a growth chamber programmed for 12 h of irradiation at a relative humidity of 80%. The first symptoms, consisting of water-soaked lesions on the basal leaves, developed 5 days after inoculation with crown rot and plant kill in 2 weeks. Control plants remained healthy. R. solani was consistently reisolated from infected plants. The pathogenicity test was carried out twice with similar results. This is, to our knowledge, the first report of R. solani on lamb's lettuce in Italy as well as worldwide. The isolates were deposited at the AGROINNOVA fungal collection. The disease continues to spread in other greenhouses in northern Italy. References: (1) D. Carling. Rhizoctonia Species: Pages 37–47 in: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. B. Sneh et al., eds. Kluwer Academic Publishers, the Netherlands, 1996. (2) J. Parmeter et al. Phytopathology, 59:1270, 1969. (3) B. Sneh et al. Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN, 1996.

Download Full-text

Report of Leaf Blight on Washington Lupine (Lupinus polyphyllus) Caused by Rhizoctonia solani AG 4 in Italy

Plant Disease ◽

10.1094/pdis-93-4-0429a ◽

2009 ◽

Vol 93 (4) ◽

pp. 429-429

Author(s):

A. Garibaldi ◽

G. Gilardi ◽

D. Bertetti ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Aqueous Suspension ◽

Morphological Characteristics ◽

Its Region ◽

Leaf Blight ◽

Herbaceous Plant ◽

Pathogenicity Test ◽

Lupinus Polyphyllus ◽

Leaf Petiole ◽

Sphagnum Peat

Lupinus polyphyllus (Leguminosae), Washington lupine, is a perennial herbaceous plant. In March 2008, in a campus greenhouse at the University of Torino, Grugliasco (northern Italy), a leaf blight was observed on 20% of potted 30-day-old plants. Semicircular, water-soaked lesions developed on leaves just above the soil line at the leaf-petiole junction and later along the leaf margins. Lesions expanded for several days along the midvein until the entire leaf was destroyed. Blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. Severely infected plants died. Plants were grown in a sphagnum peat/perlite/clay (70:20:10) substrate at temperatures between 18 and 25°C and relative humidity of 60 to 80%. Diseased tissue was disinfested for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA) amended with 25 mg/liter of streptomycin sulfate. A fungus with the morphological characteristics of Rhizoctonia solani (4) was consistently and readily recovered, then transferred and maintained in pure culture. Ten-day-old mycelium grown on PDA at 20 ± 1°C appeared light brown, rather compact, and exhibited radial growth. The isolates of R. solani successfully anastomosed with tester isolate AG 4 (AG 4 RT 31, obtained from tobacco plants). The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and cell death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (3). Pairings were also made with tester isolates AG 1, 2.1, 2.2, 3, 6, 7, 11, and BI with no anastomoses observed between the recovered and tester isolates. The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and sequenced. BLASTn analysis (1) of the 660-bp fragment showed 100% homology with the sequence of R. solani. The nucleotide sequence has been assigned GenBank Accession No. FJ486272. For pathogenicity tests, the inoculum of R. solani was prepared by growing the pathogen on PDA for 10 days. Plants of 30-day-old L. polyphyllus were grown in 10-liter containers (10 plants per container) on a steam disinfested sphagnum peat/perlite/clay (70:20:10) medium. Inoculum, consisting of an aqueous suspension of mycelium disks prepared from PDA cultures (5 g of mycelium per plant), was placed at the collar of plants. Plants inoculated with water and PDA fragments alone served as control treatments. Three replicates were used. Plants were maintained in a greenhouse at temperatures between 18 and 23°C. First symptoms, similar to those observed in the nursery, developed 10 days after the artificial inoculation. R. solani was consistently reisolated from infected leaves and stems. Control plants remained healthy. The pathogenicity test was repeated twice. The susceptibility of L. polyphyllus to R. solani was reported in Poland (2). This is, to our knowledge, the first report of leaf blight of L. polyphyllus caused by R. solani in Italy. The importance of the disease is at the moment limited. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) W. Blaszczak. Rocz. Nauk. Roln. Ser A 85:705, 1962. (3) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Kluwer Academic Publishers, The Netherlands, 1996. (4) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St Paul, MN, 1991.

Download Full-text

First Report of Leaf Spot and Root Rot Caused by Phoma betae on Beta vulgaris subsp. vulgaris (Garden Beet Group) in Italy

Plant Disease ◽

10.1094/pdis-91-11-1515c ◽

2007 ◽

Vol 91 (11) ◽

pp. 1515-1515 ◽

Cited By ~ 7

Author(s):

A. Garibaldi ◽

G. Gilardi ◽

D. Bertetti ◽

M. L. Gullino

Keyword(s):

Beta Vulgaris ◽

Morphological Characteristics ◽

Its Region ◽

Pathogenicity Test ◽

Vegetable Crops ◽

Plastic Bags ◽

Blastn Analysis ◽

Commercial Farms ◽

Pathogenicity Tests ◽

Phoma Betae

In the winter of 2007 in Piedmont (northern Italy), symptoms of a previously unknown disease were observed on beet (Beta vulgaris L. subsp. vulgaris) (garden beet group) grown under a tunnel on several commercial farms near Cuneo. First symptoms appeared on 1-month-old plants, occurring as brown, round-to-oval spots as much as 2 cm in diameter with dark concentric rings near the perimeter. Small, dark pycnidia were present throughout the spots in concentric rings. Generally, older, lower leaves were affected more than the younger ones. Ten to fifteen percent of the plants were affected. Symptoms on the roots began near the crown as small, dark, sunken spots that became soft and water soaked. Eventually, spots on the roots turned dark brown to black and black lines separated diseased and healthy tissues. Older infected tissues were black, dry, shrunken, and spongy. Pycnidia were not observed on affected roots. From infected leaves and roots, a fungus was consistently isolated on potato dextrose agar (PDA) amended with 25 mg/l of streptomycin. The fungus was grown on PDA and maintained at 22°C (12 h of light, 12 h of dark). After 10 days, black pycnidia (130 to 328 [204] μm in diameter) developed, releasing abundant hyaline, elliptical, nonseptate conidia measuring 3.9 to 6.7 (5.1) × 2.4 to 5.9 (3.6) μm. On the basis of its morphological characteristics, the fungus was identified as a Phoma sp. (1). The internal transcribed spacer (ITS) region was amplified using primers ITS4/ITS6 (2) and sequenced. BLASTn analysis of the 557 bp obtained showed an E-value of 0.0 with Phoma betae. The nucleotide sequence has been assigned GenBank Accession No. EU003450. Pathogenicity tests were performed by spraying leaves of healthy 20-day-old potted B. vulgaris plants with a spore and mycelial suspension (1 × 106 spores or mycelial fragments per ml). Noninoculated plants sprayed only with water served as controls. Fifteen plants (three per pot) were used for each treatment. Plants were covered with plastic bags for 5 days after inoculation and kept in a growth chamber at 20°C. Symptoms previously described developed on leaves of all inoculated plants 5 days after inoculation, while control plants remained healthy. Later, pycnidia and conidia, with the same dimensions and characteristics previously described, were observed on the infected leaves. The fungus was consistently reisolated from the lesions of the inoculated plants. The pathogenicity test was carried out twice. P. betae on B. vulgaris var. cycla has been reported in Canada (3) as well as in other countries. The same pathogen was reported in Italy on sugar beet (2). References: (1) G. H. Boerema and G. J. Bollen. Persoonia 8:111, 1975. (2) A. Canova. Inf. Fitopatol. 16:207, 1966. (3) D. E L. Cooke and J. M. Duncan. Mycol. Res. 101:667, 1997. (4) J. R. Howard et al. Diseases of Vegetable Crops in Canada. Canadian Phytopathological Society, 1994.

Download Full-text