First Report of Turnip ringspot virus in Field Mustard (Brassica chinensis) in Taiwan

Crucifer crops (Brassica spp.) are important winter vegetables in Taiwan. Five viruses, including Turnip mosaic virus (TuMV), Cucumber mosaic virus (CMV), Radish mosaic virus (RaMV), Beet western yellows virus (BWYV), and Cauliflower mosaic virus (CaMV), have been detected in a range of domestic-grown crucifers during past decades (1). Field mustard plants (Brassica chinensis) showing mosaic in the leaves were collected in the ChiaYi area in December 2007. Spherical virus-like particles, approximately 30 nm in diameter, were readily observed in crude sap of symptomatic plants. Tests by ELISA failed to detect any of the aforementioned viruses. A spherical agent was isolated through mechanical inoculation onto Chenopodium quinoa, and a virus culture was established and inoculated mechanically back to the original host as well as other crucifers. Systemic mosaic appeared on inoculated B. campestris, B. chinensis, and B. juncea, whereas ringspots appeared on inoculated leaves of B. oleracea. Total RNA was extracted from symptomatic leaves and used for reverse transcription (RT)-PCR amplification using degenerate primers for comoviruses (2). Other successive fragments of RNAs 1 and 2 were amplified by specific or degenerate primers designed on the basis of sequences of published Turnip ringspot virus (TuRSV). The RNA 1 (GenBank Accession No. GU968732) and RNA 2 (No. GU968731) of the isolated virus consisted of 6,076 and 3,960 nucleotides, respectively. The number of nucleotides and the arrangement of open reading frames on both RNA 1 and RNA 2 were similar to those of comoviruses. Sequence analysis revealed that the nucleotide sequences of RNA 1 and RNA 2 shared 54.2 to 82.5% and 50.2 to 79.3% similarities, respectively, to those of comoviruses and were most similar to Turnip ringspot virus. The deduced peptides of large and small coat proteins (LCP and SCP) contain 375 amino acids (41.2 kDa) and 251 amino acids (28.5 kDa), respectively. The deduced amino acid sequences of RNA-dependent RNA polymerase (RdRp), LCP, and SCP share 92.0 to 94.5%, 93.1 to 93.3% and 87.3 to 89.6% similarity, respectively, to those of published TuRSV isolates, i.e., -B (GenBank Accession No. GQ222382), -M12 (No. FJ516746), and -Toledo (No. FJ712027) indicating that the newly isolated virus from field mustard in Taiwan is an isolate of TuRSV, hence TuRSV-TW. Comparison of LCP and SCP between current TuRSV-TW and Radish mosaic virus (RaMV; GenBank Accession No. AB295644) showed 74% similarity, which is below the species demarcation level of 75% (3), indicating its discrimination from RaMV. To our knowledge, this is the first report of the occurrence of TuRSV in Taiwan and in the subtropics. References: (1) T. H. Chen et al. Plant Pathol. Bull. 9:39, 2000. (2) V. Maliogka et al. J. Phytopathol. 152:404, 2004. (3) K. Petrzik and I. Koloniuk. Virus Genes 40:290, 2010.

Download Full-text

Variants of Triticum mosaic virus Isolated From Wheat in Colorado Show Divergent Biological Behavior

Plant Disease ◽

10.1094/pdis-10-12-0925-re ◽

2013 ◽

Vol 97 (7) ◽

pp. 903-911 ◽

Cited By ~ 3

Author(s):

Dallas L. Seifers ◽

Satyanarayana Tatineni ◽

Roy French

Keyword(s):

Amino Acids ◽

Amino Acid ◽

Amino Acid Sequence ◽

Mosaic Virus ◽

Dry Weight ◽

Amino Acid Sequences ◽

Biological Behavior ◽

Enzyme Linked Immunosorbent Assay ◽

Temperature Sensitive ◽

Coat Proteins

Triticum mosaic virus (TriMV) is a recently discovered virus infecting wheat. We compared Colorado isolates C10-492 and C11-775 with the 06-123 isolate. Comparisons were made using enzyme-linked immunosorbent assay (ELISA), infectivity assay, host range, dry weight (DW), inoculation of ‘Mace’ wheat with temperature-sensitive resistance to Wheat streak mosaic virus, and the deduced amino acid sequence of the coat proteins (CP) and P1 proteins. Both C10-492 and C11-775 infected ‘Gallatin’ barley and, when compared with 06-123, had significantly reduced ELISA values and virus titers in wheat. Both Colorado isolates caused symptomless infections in Mace, whereas 06-123 caused mosaic symptoms. The amino acid sequences of the CP differed by two and one amino acids for C10-492 and C11-775, respectively, compared with 06-123. The sequence of C10-492 differed from C11-775 by one amino acid. The P1 amino acid sequence of C10-492 and C11-775 differed from 06-123 by three and one amino acids, respectively. The C10-492 and C11-775 isolates reduced DW significantly in ‘Karl 92’ but significantly less than 06-123. In ‘2317’ wheat, the Colorado isolates did not consistently cause significant reduction in DW, while 06-123 did. The data collectively indicate that C10-492 and C11-775 are isolates of TriMV showing biological behavior diverse from that of 06-123.

Download Full-text

Die primäre Proteinstruktur von Stämmen des Tabakmosaikvirus

Zeitschrift für Naturforschung B ◽

10.1515/znb-1963-1207 ◽

1963 ◽

Vol 18 (12) ◽

pp. 1032-1049 ◽

Cited By ~ 13

Author(s):

B. Wittmann-Liebold ◽

H. G. Wittmann

Keyword(s):

Amino Acids ◽

Amino Acid ◽

Amino Acid Sequence ◽

Tobacco Mosaic Virus ◽

Mosaic Virus ◽

Amino Acid Sequences ◽

Tryptic Peptides

The amino acid sequence of dahlemense, a naturally occuring strain of tobacco mosaic virus, has been determined and compared with that of the strain vulgare (Fig. 7). In this communication the experimental details are given for the elucidation of the amino acid sequences within two tryptic peptides with 65 amino acids.

Download Full-text

First Report of Yam mild mosaic virus in Yam in Guangxi Province, China

Plant Disease ◽

10.1094/pdis-04-11-0350 ◽

2011 ◽

Vol 95 (10) ◽

pp. 1320-1320 ◽

Cited By ~ 4

Author(s):

C. Zou ◽

J. Meng ◽

Z. Li ◽

M. Wei ◽

J. Song ◽

...

Keyword(s):

Mosaic Virus ◽

Viral Genome ◽

Terminal Region ◽

Mild Mosaic ◽

Rt Pcr ◽

Degenerate Primers ◽

Germplasm Exchange ◽

First Report ◽

Pcr Products ◽

Mild Mosaic Virus

Yams (Dioscorea spp.) are widely grown in China as vegetables and herbal medicine. However, studies on viral diseases on yams are still limited. As a pilot project of a government initiative for improving yam productivity, a small study was conducted in Guangxi, a southern province of China, on viral disease in yams. Incidence of virus-like disease for the three extensively grown D. alata cultivars, GH2, GH5, and GH6, were 12 to 40%, 12 to 29%, and 11 to 25%, respectively, as found in a field survey with a five-plot sampling method in 2010. A total of 112 leaf samples showing mosaic or mottling or leaves without symptoms were collected from the cvs. GH2, GH5, GH6, and seven additional cultivars (D. alata cvs. GY2, GY23, GY47, GY69, GY62, GY72, and D. batatas cv. Tiegun). To determine if the symptoms were caused by Yam mild mosaic virus (YMMV; genus Potyvirus, family Potyviridae), total RNA was extracted from leaves with a commercial RNA purification kit (TIANGEN, Beijing, China), and reverse-transcription (RT)-PCR was conducted with a YMMV-specific primer pair (4) that amplifies the 3′-terminal portion of the viral genome. A PCR product with the predicted size of 262 bp was obtained from samples of GH5 (number testing positive of total number of leaves = 5 of 12), GH6 (24 of 42), and GY72 (1 of 1), but not from asymptomatic leaves. PCR products from a GH5 sample (YMMV-Nanning) and a GH6 sample (YMMV-Luzhai) were cloned and sequenced using an ABI PRISM 3770 DNA Sequencer. The two PCR products were 97% identical at nucleotide (nt) level and with the highest homology (89% identity) to a YMMV isolate (GenBank Accession No. AJ305466). To further characterize the isolates, degenerate primers (2) were used to amplify viral genome sequence corresponding to the C-terminal region of the nuclear inclusion protein b (NIb) and the N-terminal region of the coat protein (CP). These 781-nt fragments were sequenced and a new primer, YMMV For1 (5′-TTCATGTCGCACAAAGCAGTTAAG-3′) corresponding to the NIb region, was designed and used together with primer YMMV UTR 1R to amplify a fragment that covers the complete CP region of YMMV by RT-PCR. These 1,278-nt fragments were sequenced (GenBank Accession Nos. JF357962 and JF357963). CP nucleotide sequences of the YMMV-Nanning and YMMV-Luzhai isolates were 94% similar, while amino acid sequences were 99% similar. BLAST searches revealed a nucleotide identity of 82 to 89% and a similarity of 88 to 97% for amino acids to sequences of YMMV isolates (AF548499 and AF548519 and AAQ12304 and BAA82070, respectively) in GenBank. YMMV is known to be prevalent on D. alata in Africa and the South Pacific, and has recently been identified in the Caribbean (1) and Colombia (3). To our knowledge, this is the first report of the natural occurrence of YMMV in China and it may have implications for yam production and germplasm exchange within China. References: (1) M. Bousalem and S. Dallot. Plant Dis. 84:200, 2000. (2) D. Colinet et al. Phytopathology 84:65, 1994. (3) S. Dallot et al. Plant Dis. 85:803, 2001. (4) R. A. Mumford and S. E. Seal. J. Virol. Methods 69:73, 1997.

Download Full-text

First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽

10.1094/pdis-10-12-0933-pdn ◽

2013 ◽

Vol 97 (4) ◽

pp. 561-561 ◽

Cited By ~ 2

Author(s):

S. Khankhum ◽

P. Bollich ◽

R. A. Valverde

Keyword(s):

Common Bean ◽

Mosaic Virus ◽

Seed Quality ◽

Soybean Mosaic Virus ◽

Ringspot Virus ◽

Wild Plants ◽

Rt Pcr ◽

Sequence Comparisons ◽

First Report ◽

Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

Download Full-text

First Report of Cymbidium mosaic virus and Odontoglossum ringspot virus in Orchids in Mexico

Plant Disease ◽

10.1094/pdis-08-11-0655 ◽

2012 ◽

Vol 96 (3) ◽

pp. 464-464

Author(s):

A. G. Soto-Valladares ◽

R. De La Torre-Almaraz ◽

B. Xoconostle-Cazares ◽

R. Ruíz-Medrano

Keyword(s):

Mosaic Virus ◽

Pcr Amplification ◽

Positive Sample ◽

Ringspot Virus ◽

Rdrp Gene ◽

Mixed Infections ◽

Cymbidium Mosaic Virus ◽

First Report ◽

Odontoglossum Ringspot Virus ◽

Cp Gene

In 2010, a survey for viral diseases in commercial, orchid-producing greenhouses was carried out in Morelos, Mexico. Many symptomatic plants were observed. The most common leaf symptoms were yellow mottle, yellow streaks, and chlorotic and necrotic ringspots. Leaf samples were collected from eight symptomatic plants from the following genera: Encyclia, Oncidium, Shomburghia, Brassia, Guarianthe, Cattleya, Epidendrum, Vanilla, Xilobium, Laelia, and Brassocattleya. Samples were tested using double-antibody sandwich (DAS)-ELISA (Agdia, Elkhart, IN) with antiserum for Cymbidium mosaic virus (CymMV), Odontoglossum ringspot virus (ORSV), Cymbidium ringspot mosaic virus, and Tobacco mosaic virus (TMV) and a general antiserum for potyviruses. At least one plant from each genus was positive to CymMV and ORSV as individual or mixed infections. Encyclia and Laelia plants were the most frequently found with mixed infections by both viruses. All genera were negative for TMV and potyviruses. Total RNA extracts were obtained from all ELISA-positive samples by a modified silica capture protocol (2). Reverse transcription (RT)-PCR was carried out with general polymerase (RdRp) gene primers corresponding to the Potexvirus group (3) and specific primers for the coat protein gene (CP) of CymMV and ORSV (1). The PCR amplification from a positive sample of each genus was resolved in agarose gels. Amplification products of the expected size were obtained for CymMV and ORSV. Five CymMV RdRp gene clones from five different plants of Laelia (GenBank Accession Nos. HQ393958, HQ393959, HQ393960, HQ393961, and HQ393962), two CP gene clones of CP gene of CymMV from two different plants of Oncidium (GenBank Accession Nos. HQ393956 and HQ393957), and three CP clones of CP of ORSV from three different plants of Encyclia (GenBank Accession Nos. HQ393953, HQ393954, and HQ393955) were sequenced. The nucleotide sequences of the Mexican orchid CymMV isolates were 96 to 97% identical to CymMV sequences in the GenBank, while those of ORSV were 99 to 100% identical to deposited ORSV sequences. To our knowledge, this is the first report of CymMV and ORSV in orchids in Mexico, which are two of the most important quarantine virus in orchids in Mexico. References: (1) P. Ajjikuttira et al. J. Gen. Virol. 86:1543, 2005. (2) J. R. Thompson et al. J. Virol. Methods 111:85, 2003. (3) R. A. A. van der Vlugt and M. Berendsen. Eur. J. Plant Pathol. 108:367, 2002.

Download Full-text

Monoclonal Antibodies Detect a Single Amino Acid Difference Between the Coat Proteins of Soilborne Wheat Mosaic Virus Isolates: Implications for Virus Structure

Phytopathology ◽

10.1094/phyto.1997.87.3.295 ◽

1997 ◽

Vol 87 (3) ◽

pp. 295-301 ◽

Cited By ~ 19

Author(s):

Jianping Chen ◽

Lesley Torrance ◽

Graham H. Cowan ◽

Stuart A. MacFarlane ◽

Gerald Stubbs ◽

...

Keyword(s):

Amino Acids ◽

Monoclonal Antibodies ◽

Amino Acid ◽

Mosaic Virus ◽

Single Amino Acid ◽

Computer Assisted ◽

Amino Acid Difference ◽

Coat Proteins ◽

C Terminus ◽

Readthrough Protein

Four monoclonal antibodies (MAbs) were prepared against an isolate of soilborne wheat mosaic furovirus from Oklahoma (SBWMV Okl-7). Three MAbs had different reactivities in tests on SBWMV isolates from Nebraska (Lab1), France, and Japan. One MAb (SCR 133) also reacted with oat golden stripe furovirus. None of the MAbs cross-reacted with other rod-shaped viruses including beet necrotic yellow vein furovirus, potato mop-top furovirus, and tobacco rattle tobravirus. Sequence analysis of nucleotides between 334 and 1,000 of RNA 2, the region that encodes the coat protein (CP) and the first 44 amino acids of a readthrough protein, of the four SBWMV isolates revealed up to 27 base changes from the published sequence of a Nebraska field isolate of SBWMV. Most changes were translationally silent, but some caused differences of one to three amino acids in residues located near either the N- or C-terminus of the CPs of the different isolates. Two further single amino acid changes were found at the beginning of the readthrough domain of the CP-readthrough protein. Some of these amino acid changes could be discriminated by MAbs SCR 132, SCR 133, and SCR 134. Peptide scanning (Pepscan) analysis indicated that the epitope recognized by SCR 134 is located near the N-terminus of the CP. SCR 132 was deduced to react with a discontinuous CP epitope near the C-terminus, and SCR 133 reacted with a surface-located continuous epitope also near the C-terminus. Predictions of CP structure from computer-assisted three-dimensional model building, by comparison with the X-ray fiber diffraction structure of tobacco mosaic virus, suggested that the three CP amino acids found to differ between isolates of SBWMV were located near the viral surface and were in regions predicted to be antigenic.

Download Full-text

Genetic Diversity Among Geminiviruses Associated with the Weed Species Sida spp., Macroptilium lathyroides, and Wissadula amplissima from Jamaica

Plant Disease ◽

10.1094/pdis.1997.81.11.1251 ◽

1997 ◽

Vol 81 (11) ◽

pp. 1251-1258 ◽

Cited By ~ 40

Author(s):

Marcia E. Roye ◽

Wayne A. McLaughlin ◽

Medhat K. Nakhla ◽

Douglas P. Maxwell

Keyword(s):

Genetic Diversity ◽

Amino Acid ◽

Mosaic Virus ◽

Amino Acid Sequences ◽

Yellow Mosaic Virus ◽

Weed Species ◽

Degenerate Primers ◽

Sequence Comparisons ◽

The Common ◽

Macroptilium Lathyroides

Genetic diversity among geminiviruses associated with three common weeds in Jamaica was studied using digoxigenin-labeled geminiviral DNA probes, polymerase chain reaction with degenerate primers for DNA-A and DNA-B, nucleic acid sequencing, and derived amino acid sequences. Geminiviruses with bipartite genomes were found in Sida spp., Macroptilium lathyroides, and Wissadula amplissima. The geminiviruses detected in Sida spp. and M. lathyroides were nearly identical and were both designated Sida golden mosaic geminivirus (SidGMV-JA), whereas the geminivirus in W. amplissima was sufficiently different to be designated Wissadula golden mosaic geminivirus (WGMV). Nucleotide sequence comparisons of the common regions and the N-terminal regions of the AC1 (rep) and AV1 ORFs, together with the derived amino acid sequence comparisons of the N-terminal parts of BC1 and BV1 ORFs were used to determine their similarities to other geminiviruses. SidGMV-JA was most similar to potato yellow mosaic geminivirus (PYMV). We propose that these two geminiviruses (SidGMV-JA and PYMV) define a new geminivirus cluster, the potato yellow mosaic virus (PYMV) cluster. WGMV was most similar to members of the Abutilon mosaic virus cluster but is not likely to be included in the Abutilon phylogenetic group because of the divergent sequence of the common region. These results indicate that geminiviruses infecting some weeds in Jamaica are distinct from crop-infecting geminiviruses in Jamaica and define a new geminivirus cluster.

Download Full-text

Identification of amino acid sequences determining interaction between the cucumber mosaic virus-encoded 2a polymerase and 3a movement proteins

Journal of General Virology ◽

10.1099/vir.0.83207-0 ◽

2007 ◽

Vol 88 (12) ◽

pp. 3445-3451 ◽

Cited By ~ 11

Author(s):

Min Sook Hwang ◽

Kyung Nam Kim ◽

Jeong Hyun Lee ◽

Young In Park

Keyword(s):

Amino Acids ◽

Amino Acid ◽

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Critical Role ◽

Amino Acid Sequences ◽

Multiple Sequence ◽

Movement Proteins ◽

Gdd Motif

The cucumber mosaic virus (CMV)-encoded 3a movement protein (MP) is indispensable for CMV movement in plants. We have previously shown that MP interacts directly with the CMV-encoded 2a polymerase protein in vitro. Here, we further dissected this interaction and determined the amino acid sequences that are responsible for the MP and 2a polymerase protein interaction. Both the N-terminal 21 amino acids and the central GDD motif of the 2a polymerase protein were important for interacting with the MP. Although each of the regions alone was sufficient for the interaction with MP, quantitative yeast two-hybrid analyses showed that they acted synergistically to enhance the binding affinity. The MP N-terminal 20 amino acids were sufficient for interacting with the 2a polymerase protein, and the serine residue at position 14 played a critical role in the interaction. Multiple sequence alignment showed that the 2a protein interacting regions and the serine at position 14 in the MP are highly conserved among subgroup I and II CMV isolates.

Download Full-text

Involvement of Beet western yellows virus, Cauliflower mosaic virus, and Turnip mosaic virus in Internal Disorders of Stored White Cabbage

Phytopathology ◽

10.1094/phyto.2002.92.8.816 ◽

2002 ◽

Vol 92 (8) ◽

pp. 816-826 ◽

Cited By ~ 14

Author(s):

P. J. Hunter ◽

J. E. Jones ◽

J. A. Walsh

Keyword(s):

Mosaic Virus ◽

Leaf Tissue ◽

Subsequent Development ◽

Turnip Mosaic Virus ◽

Cauliflower Mosaic Virus ◽

Beet Western Yellows Virus ◽

Growing Seasons ◽

White Cabbage ◽

Necrotic Spots ◽

Internal Necrosis

Experiments over two growing seasons clearly showed that Turnip mosaic virus (TuMV) infection was associated with internal necrosis (sunken necrotic spots 5 to 10 mm in diameter) and Beet western yellows virus (BWYV) infection was associated with collapse of leaf tissue at the margins (tipburn) in heads of stored white cabbage (Brassica oleracea var. capitata). Virtually no tipburn was seen in cv. Polinius, whereas cv. Impala was affected severely. Internal necrotic spots were seen in both cultivars. BWYV appeared to interact with TuMV. Plants infected with both viruses showed a lower incidence of external symptoms and had less internal necrosis than plants infected with TuMV alone. Cauliflower mosaic virus (CaMV) did not induce significant amounts of internal necrosis or tipburn, but did, in most cases, exacerbate symptoms caused by TuMV and BWYV. BWYV-induced tipburn worsened significantly during storage. Post-transplanting inoculation with TuMV induced more internal necrosis than pre-transplant inoculation. There was a significant association between detection of TuMV just prior to harvest and subsequent development of internal necrotic spots. Individually, all three viruses significantly reduced the yield of cv. Polinius, whereas only BWYV and CaMV treatments reduced the yield of cv. Impala.

Download Full-text

Introgression of a Tombusvirus Resistance Locus from Nicotiana edwardsonii var. Columbia to N. clevelandii

Phytopathology ◽

10.1094/phyto-96-0453 ◽

2006 ◽

Vol 96 (5) ◽

pp. 453-459 ◽

Cited By ~ 6

Author(s):

James E. Schoelz ◽

B. Elizabeth Wiggins ◽

William M. Wintermantel ◽

Kathleen Ross

Keyword(s):

Mosaic Virus ◽

Resistance Genes ◽

Virus Resistance ◽

Dominant Gene ◽

Cauliflower Mosaic Virus ◽

Ringspot Virus ◽

N Gene ◽

Interspecific Crosses ◽

Addition Line ◽

Resistance Locus

A new variety of Nicotiana, N. edwardsonii var. Columbia, was evaluated for its capacity to serve as a new source for virus resistance genes. Columbia was developed from a hybridization between N. glutinosa and N. clevelandii, the same parents used for the formation of the original N. edwardsonii. However, in contrast to the original N. edwardsonii, crosses between Columbia and either of its parents are fertile. Thus, the inheritance of virus resistance genes present in N. glutinosa could be characterized by using Columbia as a bridge plant in crosses with the susceptible parent, N. clevelandii. To determine how virus resistance genes would segregate in interspecific crosses between Columbia and N. clevelandii, we followed the fate of the N gene, a single dominant gene that specifies resistance to Tobacco mosaic virus (TMV). Our genetic evidence indicated that the entire chromosome containing the N gene was introgressed into N. clevelandii to create an addition line, designated N. clevelandii line 19. Although line 19 was homozygous for resistance to TMV, it remained susceptible to Tomato bushy stunt virus (TBSV) and Cauliflower mosaic virus (CaMV) strain W260, indicating that resistance to these viruses must reside on other N. glutinosa chromosomes. We also developed a second addition line, N. clevelandii line 36, which was homozygous for resistance to TBSV. Line 36 was susceptible to TMV and CaMV strain W260, but was resistant to other tombusviruses, including Cucumber necrosis virus, Cymbidium ringspot virus, Lettuce necrotic stunt virus, and Carnation Italian ringspot virus.

Download Full-text