First Report of Sirosporium celtidis Causing a Foliar Disease of European Hackberry in Spain

Hackberry (Celtis australis L.) is widely used for reforestation and as shade tree in parks and roadside plantings in southern Europe (4). In autumn 2011, a foliar disease was observed affecting several trees planted in a garden area located in Alzira (Valencia province, eastern Spain). Symptoms appeared on lower leaf surfaces as reddish to dark brown velvety irregular spots, later becoming grayish brown on the upper surface. Most of the infected trees were prematurely defoliated. Spots on lower leaf surfaces were covered by mycelium, conidiophores, and conidia. Fungal isolates were recovered directly from the structures present on the lesions and by surface-disinfecting small fragments of symptomatic leaf tissue in 0.5% NaOCl, double-rinsing the sections in sterile water, and plating the sections onto potato dextrose agar (PDA) amended with 0.5 g of streptomycin sulfate per liter. Single conidium cultures made onto PDA were maintained for 2 months at 25°C in darkness for morphological examination. Conidia were thick walled, dark reddish brown, often markedly curved or coiled, cylindrical to obclavate, smooth, wrinkled, or verrucose, typically multicellular, 2 to 40 transversely septate and occasionally with 1 to 3 longitudinal or oblique septa that were often constricted, 20 to 96 (44.9) × 6 to 9 (7.1) μm, with an inconspicuous scar at the base. Morphological characters corresponded to the description of Sirosporium celtidis (Biv. ex Spreng) M. B. Ellis published in 1963 (3). The internal transcribed spacer (ITS) region of the rDNA was amplified with the primers ITS1 and ITS4 from DNA extracted from the isolate AL1, and sequenced (GenBank Accession No. JX397963). The sequence was identical to that obtained from an isolate of S. celtidis from the Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands (CBS 289.50). Pathogenicity tests were conducted on five 2-year-old hackberry trees by spraying onto the upper and lower leaf surfaces a conidial suspension of S. celtidis (approximately 50 ml/plant, 106 conidia/ml of water). Five control plants were sprayed with sterile water. Plants were covered with clear plastic bags and incubated in a growth chamber for 72 h at 25°C with a 12-h photoperiod. First leaf spots were visible on inoculated plants after 7 days, but symptoms were not observed on control plants. The fungus was reisolated from leaf lesions on inoculated plants, confirming Koch's postulates. S. celtidis was first described in Sicily in 1815 (3) and has been recorded on various hackberry species in Mediterranean countries and the USA (1,2). To our knowledge, this is the first report of the disease in Spain. The economic and ecological significance of the pathogen in natural ecosystems in Spain remains to be determined but it could certainly become a serious problem for nurseries and urban plantings. References: (1) S.O. Cacciola. 2000. Plant Dis. 84, 492. (2) D. H. Linder. 1931. Ann. Mo. Bot. Garden 18, 31. (3) M. B. Ellis. 1963. Mycological Papers, No. 87. Commonw. Mycol. Inst. Kew, England. (4) S. Pauleit et al., Urban For. Urban Green. 1:83, 2002.

Download Full-text

First Report of Cochliobolus sativus Causing Leaf Spot on Paper Mulberry in China

Plant Disease ◽

10.1094/pdis-04-11-0319 ◽

2011 ◽

Vol 95 (12) ◽

pp. 1586-1586 ◽

Cited By ~ 1

Author(s):

P. S. Wu ◽

K. Chen ◽

H. Z. Du ◽

J. Yan ◽

Q. E. Zhang

Keyword(s):

Leaf Spot ◽

Leaf Tissue ◽

Pathogenic Fungi ◽

Bipolaris Sorokiniana ◽

Causal Agent ◽

Cochliobolus Sativus ◽

Conidial Suspension ◽

Sterile Water ◽

First Report ◽

Forest Park

Paper mulberry, Broussonetia papyrifera (L.) Vent., is a highly adaptable, fast-growing tree that is native to eastern Asia. Its ability to absorb pollutants makes it ideal for ornamental landscapes, especially in industrial and mining areas. During the summer of 2010, brown lesions were observed on leaves of paper mulberry in Baiwangshan Forest Park, Beijing, China. These lesions were ovoid to fusiform and 4 to 9 × 2 to 4 mm with dark brown centers and light brown irregular edges. Spots on severely infected leaves sometimes coalesced to form long stripes with gray centers. To isolate the causal agent of the lesions, 4-mm2 pieces of diseased leaf tissue from 12 leaves were collected at the lesion margins and surface disinfected in 0.5% NaOCl for 3 min, rinsed three times with sterile water, plated on water agar, and incubated at 25°C with a 12-h photoperiod. After 5 days, the cultures, which became dark brown to black, were observed. Conidiophores (120 to 220 × 4 to 7 μm) were solitary or in groups of two to five, straight or flexuous with swollen bases, and light or dark brown. Conidia were dark olive brown, spindle- or oval-shaped with truncated ends (60 to 120 × 15 to 30 μm), slightly curved, and containing 3 to 12 distoseptate (mostly 6 to 10). Pseudothecia, produced after 14 days in culture, were dark brown to black and flask shaped (420 to 530 μm in diameter with 85 to 100 × 75 to 90 μm ostiolar beaks). Asci were cylindrical (100 to 220 × 30 to 40 μm) and contained eight ascospores. Ascospores were filiform, (150 to 360 × 6 to 9 μm), hyaline, with 6 to 11 septations. Isolates were identified as Cochliobolus sativus (Ito & Kurib.) Drechsler & Dastur (anamorph Bipolaris sorokiniana (Sacc. & Sorok.) Shoem.) on the basis of culture color and dimensions and colors of pseudothecia, asci, ascospores, conidiophores, and conidia (2,3). The identity of one isolate was confirmed by ITS1-5.8S-ITS2 rDNA sequence (GenBank Accession No. HQ 654781) analysis that showed 100% homology to C. sativus listed in Berbee et al. (1). Koch's postulates were performed with six potted 3-month-old paper mulberry plants. An isolate was grown on potato dextrose agar for 14 days to obtain conidia for a conidial suspension (3 × 104 conidia/ml). Three of the potted plants were sprayed with the conidial suspension and three were sprayed with sterile water as controls. Each plant was covered with a plastic bag for 24 h to maintain high humidity and incubated at 25°C with a 12-h photoperiod. After 7 days, the inoculated plants showed leaf symptoms identical to those previously observed on paper mulberry trees in the Baiwangshan Forest Park, while control trees remained symptom free. Reisolation of the fungus from the inoculated plants confirmed that the causal agent was C. sativus. C. sativus is widely distributed worldwide causing a variety of cereal diseases. Wheat and barley are the most economically important hosts. To our knowledge, this is the first report of C. sativus as a pathogen causing leaf spot of paper mulberry in China. References: (1) M. L. Berbee et al. Mycologia 91:964, 1999. (2) M. B. Ellis. Dematiaceous Hyphomycetes. CABI, Oxon, UK, 1971. (3) A. Sivanesan et al. No.701 in: Descriptions of Pathogenic Fungi and Bacteria. CAB, Kew, Surrey, U.K., 1981.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽

10.1094/pdis-01-21-0219-pdn ◽

2021 ◽

Author(s):

Nooreen Mamode Ally ◽

Hudaa Neetoo ◽

Mala Ranghoo-Sanmukhiya ◽

Shane Hardowar ◽

Vivian Vally ◽

...

Keyword(s):

Botrytis Cinerea ◽

Single Cells ◽

Disease Incidence ◽

Gray Mold ◽

Post Inoculation ◽

Conidial Suspension ◽

Sterile Water ◽

Susceptible Host ◽

Tomato Plants ◽

First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

First Report of Anthracnose of Onion Caused by Colletotrichum coccodes in Ohio

Plant Disease ◽

10.1094/pdis-01-14-0032-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1271-1271 ◽

Cited By ~ 2

Author(s):

F. Baysal-Gurel ◽

N. Subedi ◽

D. P. Mamiro ◽

S. A. Miller

Keyword(s):

Leaf Tissue ◽

Its Region ◽

The United States ◽

Tween 20 ◽

Colletotrichum Coccodes ◽

Academic Press ◽

Conidial Suspension ◽

First Report ◽

Allium Cepa L ◽

Total Dna

Dry bulb onion (Allium cepa L. cvs. Pulsar, Bradley, and Livingston) plants with symptoms of anthracnose were observed in three commercial fields totaling 76.5 ha in Huron Co., Ohio, in July 2013. Symptoms were oval leaf lesions and yellowing, curling, twisting, chlorosis, and death of leaves. Nearly half of the plants in a 32.8-ha field of the cv. Pulsar were symptomatic. Concentric rings of acervuli with salmon-colored conidial masses were observed in the lesions. Conidia were straight with tapered ends and 16 to 23 × 3 to 6 μm (2). Colletotrichum coccodes (Wallr.) S. Hughes was regularly isolated from infected plants (2). Culturing diseased leaf tissue on potato dextrose agar (PDA) amended with 30 ppm rifampicin and 100 ppm ampicillin at room temperature yielded white aerial mycelia and salmon-colored conidial masses in acervuli. Numerous spherical, black microsclerotia were produced on the surface of colonies after 10 to 14 days. To confirm pathogen identity, total DNA was extracted directly from a 7-day-old culture of isolate SAM30-13 grown on PDA, using the Wizard SV Genomic DNA Purification System (Promega, Madison, WI) following the manufacturer's instructions. The ribosomal DNA internal transcribed spacer (ITS) region was amplified by PCR using the primer pair ITS1 and ITS4 (2), and sequenced. The sequence, deposited in GenBank (KF894404), was 99% identical to that of a C. coccodes isolate from Michigan (JQ682644) (1). Ten onion seedlings cv. Ebenezer White at the two- to three-leaf stage of growth were spray-inoculated with a conidial suspension (1 × 105 conidia/ml containing 0.01% Tween 20, with 10 ml applied/plant). Plants were maintained in a greenhouse (21 to 23°C) until symptoms appeared. Control plants were sprayed with sterilized water containing 0.01% Tween 20, and maintained in the same environment. After 30 days, sunken, oval lesions each with a salmon-colored center developed on the inoculated plants, and microscopic examination revealed the same pathogen morphology as the original isolates. C. coccodes was re-isolated consistently from leaf lesions. All non-inoculated control plants remained disease-free, and C. coccodes was not re-isolated from leaves of control plants. C. coccodes was reported infecting onions in the United States for the first time in Michigan in 2012 (1). This is the first report of anthracnose of onion caused by C. coccodes in Ohio. Unusually wet, warm conditions in Ohio in 2013 likely contributed to the outbreak of this disease. Timely fungicide applications will be necessary to manage this disease in affected areas. References: (1) A. K. Lees and A. J. Hilton. Plant Pathol. 52:3. 2003. (2) L. M. Rodriguez-Salamanca et al. Plant Dis. 96:769. 2012. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Nigrospora osmanthi Causing Leaf Spot on Tartary Buckwheat in China

Plant Disease ◽

10.1094/pdis-08-20-1773-pdn ◽

2020 ◽

Author(s):

Quan Shen ◽

Xixu Peng ◽

Feng He ◽

Shaoqing Li ◽

Zuyin Xiao ◽

...

Keyword(s):

Relative Humidity ◽

Leaf Spot ◽

Plant Pathogens ◽

Hunan Province ◽

Tartary Buckwheat ◽

Tween 20 ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Sterile Water ◽

First Report

Buckwheat (Fagopyrum tataricum) is a traditional short-season pseudocereal crop originating in southwest China and is cultivated around the world. Antioxidative substances in buckwheat have been shown to provide many potential cardiovascular health benefits. Between August and November in 2019, a leaf spot was found in several Tartary buckwheat cv. Pinku1 fields in Xiangxiang County, Hunan Province, China. The disease occurred throughout the growth cycle of buckwheat after leaves emerged, and disease incidence was approximately 50 to 60%. Initially infected leaves developed a few round lesions, light yellow to light brown spots. Several days later, lesions began to enlarge with reddish brown borders, and eventually withered and fell off. Thirty lesions (2×2 mm) collected from three locations with ten leaves in each location were sterilized in 70% ethanol for 10 sec, in 2% sodium hypochlorite for 30 sec, rinsed in sterile water for three times, dried on sterilized filter paper, and placed on a potato dextrose PDA with lactic acid (3 ml/L), and incubated at 28°C in the dark for 3 to 5 days. Fungal colonies were initially white and later turned black with the onset ofsporulation. Conidia were single-celled, black, smooth, spherical to subspherical, and measured 9.2 to 15.6 µm long, and 7.1 to 11.6 µm wide (n=30). Each conidium was terminal and borne on a hyaline vesicle at the tip of conidiophores. Morphologically, the fungus was identified as Nigrospora osmanthi (Wang et al. 2017). Identification was confirmed by amplifying and sequencing the ITS region, and translation elongation factor 1-alpha (TEF1-α) and partial beta-tublin (TUB2) genes using primers ITS1/ITS4 (Mills et al. 1992), EF1-728F/EF-2 (Carbone and Kohn 1999; O’Donnell et al. 1998) and Bt-2a/Bt-2b (Glass et al. 1995), respectively. BLAST searches in GenBank indicated the ITS (MT860338), TUB2 (MT882054) and TEF1-α (MT882055) sequences had 99.80%, 99% and 100% similarity to sequences KX986010.1, KY019461.1 and KY019421.1 of Nigrospora osmanthi ex-type strain CGMCC 3.18126, respectively. A neighbor-joining phylogenetic tree constructed using MEGA7.0 with 1,000 bootstraps based on the concatenated nucleotide sequences of the three genes indicated that our isolate was closely related to N. osmanthi. Pathogenicity test was performed using leaves of healthy F. tataricum plants. The conidial suspension (1 × 106 conidia/ml) collected from PDA cultures with 0.05% Tween 20 buffer was used for inoculation by spraying leaves of potted 20-day-old Tartary buckwheat cv. Pinku1. Five leaves of each plant were inoculated with spore suspensions (1 ml per leaf). An equal number of control leaves were sprayed with sterile water to serve as a control. The treated plants were kept in a greenhouse at 28°C and 80% relative humidity for 24 h, and then transferred to natural conditions with temperature ranging from 22 to 30°C and relative humidity ranging from 50 to 60%. Five days later, all N. osmanthi-inoculated leaves developed leaf spot symptoms similar to those observed in the field, whereas control leaves remained healthy. N. osmanthi was re-isolated from twelve infected leaves with frequency of 100%, fulfilling Koch’s postulates. The genus Nigrospora has been regarded by many scholars as plant pathogens (Fukushima et al. 1998) and N. osmanthi is a known leaf blight pathogen for Stenotaphrum secundatum (Mei et al. 2019) and Ficus pandurata (Liu et al. 2019) but has not been reported on F. tataricum. Nigrospora sphaerica was also detected in vegetative buds of healthy Fagopyrum esculentum Moench (Jain et al. 2012). To our knowledge, this is the first report of N. osmanthi causing leaf spot on F. tataricum in China and worldwide. Appropriate strategies should be developed to manage this disease.

Download Full-text

First Report of Stem Blight Caused by Calonectria colhounii (Anamorph Cylindrocladium colhounii) on Greenhouse-Grown Blueberries in the United States

Plant Disease ◽

10.1094/pdis-02-11-0117 ◽

2011 ◽

Vol 95 (9) ◽

pp. 1187-1187

Author(s):

J. J. Sadowsky ◽

T. D. Miles ◽

A. M. C. Schilder

Keyword(s):

United States ◽

North Carolina ◽

Root Rot ◽

The United States ◽

Vaccinium Corymbosum ◽

Conidial Suspension ◽

Centraalbureau Voor ◽

First Report ◽

Stem Lesions ◽

Β Tubulin

Necrotic stems and leaves were observed on 2- to 4-month-old, rooted microshoot plants (Vaccinium corymbosum L. ‘Liberty’ and ‘Bluecrop’, V. angustifolium Aiton ‘Putte’, and V. corymbosum × V. angustifolium ‘Polaris’) in a Michigan greenhouse in 2008 and 2009. As the disease progressed, leaves fell off and 80 to 100% of the plants died in some cases. Root rot symptoms were also observed. A fungus was isolated from stem lesions. On potato dextrose agar (PDA), cultures first appeared light tan to orange, then rusty brown and zonate with irregular margins. Chains of orange-brown chlamydospores were abundant in the medium. Macroconidiophores were penicillately branched and had a stipe extension of 220 to 275 × 2.5 μm with a narrowly clavate vesicle, 3 to 4 μm wide at the tip. Conidia were hyaline and cylindrical with rounded ends, (1-)3-septate, 48 to 73 × 5 to 7 (average 60 × 5.5) μm and were held together in parallel clusters. Perithecia were globose to subglobose, yellow, 290 to 320 μm high, and 255 to 295 μm in diameter. Ascospores were hyaline, 2- to 3-septate, guttulate, fusoid with rounded ends, slightly curved, and 30 to 88 × 5 to 7.5 (average 57 × 5.3) μm. On the basis of morphology, the fungus was identified as Calonectria colhounii Peerally (anamorph Cylindrocladium colhounii Peerally) (1,2). The internal transcribed spacer region (ITS1 and ITS2) of the ribosomal DNA and the β-tubulin gene were sequenced (GenBank Accession Nos. HQ909028 and JF826867, respectively) and compared with existing sequences using BLASTn. The ITS sequence shared 99% maximum identity with that of Ca. colhounii CBS 293.79 (GQ280565) from Java, Indonesia, and the β-tubulin sequence shared 97% maximum identity with that of Ca. colhounii CBS 114036 (DQ190560) isolated from leaf spots on Rhododendron sp. in North Carolina. The isolate was submitted to the Centraalbureau voor Schimmelcultures in the Netherlands (CBS 129628). To confirm pathogenicity, 5 ml of a conidial suspension (1 × 105/ml) were applied as a foliar spray or soil drench to four healthy ‘Bluecrop’ plants each in 10-cm plastic pots. Two water-sprayed and two water-drenched plants served as controls. Plants were misted intermittently for 2 days after inoculation. After 7 days at 25 ± 3°C, drench-inoculated plants developed necrotic, sporulating stem lesions at the soil line, while spray-inoculated plants showed reddish brown leaf and stem lesions. At 28 days, three drench-inoculated and one spray-inoculated plant had died, while others showed stem necrosis and wilting. No symptoms were observed on control plants. Fungal colonies reisolated from surface-disinfested symptomatic stem, leaf, and root segments appeared identical to the original isolate. Cy. colhounii was reported to cause a leaf spot on blueberry plants in nurseries in China (3), while Ca. crotalariae (Loos) D.K. Bell & Sobers (= Ca. ilicicola Boedijn & Reitsma) causes stem and root rot of blueberries in North Carolina (4). To our knowledge, this is the first report of Ca. colhounii causing a disease of blueberry in Michigan or the United States. Because of its destructive potential, this pathogen may pose a significant threat in blueberry nurseries. References: (1) P. W. Crous. Taxonomy and Pathology of Cylindrocladium (Calonectria) and Allied Genera. The American Phytopathological Society, St. Paul, MN, 2002. (2) L. Lombard et al. Stud. Mycol. 66:31, 2010. (3) Y. S. Luan et al. Plant Dis. 90:1553, 2006. (4) R. D. Milholland. Phytopathology 64:831, 1974.

Download Full-text

A Foliar Disease of European Hackberry Endemic in Sicily

Plant Disease ◽

10.1094/pdis.2000.84.4.492c ◽

2000 ◽

Vol 84 (4) ◽

pp. 492-492 ◽

Cited By ~ 1

Author(s):

S. O. Cacciola

Keyword(s):

The United States ◽

River Valley ◽

Natural Ecosystems ◽

Variable Intensity ◽

Closely Related Species ◽

Foliar Disease ◽

Leaf Surfaces ◽

Moist Environment ◽

Advanced Stages ◽

Celtis Australis

European hackberry (Celtis australis L.; Ulmaceae), a semideciduous tree or shrub that produces small edible berries was originally grown in Italy to produce charcoal and timber and was particularly suitable for making whipstocks, carriage wheel spokes, and hoe handles. European hackberry is currently used for reforestation and as shade trees in parks and roadside plantings. Recently, a foliar disease caused by the dematiaceous hyphomycetous fungus Sirosporium celtidis (Biv.-Bern. ex Sprengel) M.B. Ellis on hackberry saplings in a nursery was observed in the Piedmont Region (northern Italy) by Giannetti et al. (2), who referred to it as a rare disease. However, during a survey in the nature reserve of the Anapo River Valley, in the Sicily Region (southern Italy), where European hackberry and a closely related species (C. tournefortii Lam.) grow naturally, most hackberry plants were found to be infected by S. celtidis, with variable intensity. During autumn, symptoms appeared on lower leaf surfaces as reddish brown to dark black-brown subcircular velvety spots (up to 10 to 15 mm wide) surrounded by narrow paler margins that were evenly distributed over the leaf surface and later confluent. Nonspecific symptoms on upper leaf surfaces were visible only in advanced stages and consisted of necrotic areas, usually apical or marginal, that were at first red-brown and later turned gray. A few trees were prematurely defoliated. Usually, however, severely affected leaves were necrotic, withered, and curled but remained attached. Spots on lower leaf surfaces were covered by mycelium, conidiophores, and conidia that corresponded to the description of S. celtidis published by Ellis (1). Conidia were straight, flexuous, occasionally markedly curved or coiled, cylindrical or obclavate, smooth, wrinkled or verrucose, subhyaline to golden or reddish brown, typically multicellular with 1 to 32 transverse septa, and occasionally had longitudinal or oblique septa that were often constricted, more than 100 μm long and up to 5 to 8 μm thick, with an inconspicuous scar at the base. From 1997 to 1999, infection by S. celtidis in the Anapo River Valley occurred each year, probably favored by the moist environment. S. celtidis, first described in Sicily as early as 1815 (1), has been recorded on various hackberry species in many countries, including the United States (3). Apparently this pathogen is of little economic and ecological significance in natural ecosystems; however, the fungus could become a serious problem in nurseries (2). References: (1) M. B. Ellis. 1963. Mycological Papers, No. 87. Commonw. Mycol. Inst. Kew, England. (2) G. Giannetti et al. Inform. Fitopatol. 49:39, 1999. (3) D. H. Linder. Ann. Mo. Bot. Garden 18:31, 1931.

Download Full-text

First Report on Ovate-leaf Atractylodes Damping-off Caused by Fusarium oxysporum species Complex in South Korea

Plant Disease ◽

10.1094/pdis-05-21-1107-pdn ◽

2021 ◽

Author(s):

Oliul Hassan ◽

Taehyun Chang

Keyword(s):

South Korea ◽

Fusarium Oxysporum ◽

Species Complex ◽

Disease Incidence ◽

Fusarium Species ◽

Morphological Characteristics ◽

Conidial Suspension ◽

Sterile Water ◽

Damping Off ◽

First Report

In South Korea, ovate-leaf atractylodes (OLA) (Atractylodes ovata) is cultivated for herbal medicine. During May to June 2019, a disease with damping off symptoms on OLA seedlings were observed at three farmer fields in Mungyeong, South Korea. Disease incidence was estimated as approximately 20% based on calculating the proportion of symptomatic seedlings in three randomly selected fields. Six randomly selected seedlings (two from each field) showing damping off symptoms were collected. Small pieces (1 cm2) were cut from infected roots, surface-sterilized (1 minute in 0.5% sodium hypochlorite), rinsed twice with sterile water, air-dried and then plated on potato dextrose agar (PDA, Difco, and Becton Dickinson). Hyphal tips were excised and transferred to fresh PDA. Six morphologically similar isolates were obtained from six samples. Seven-day-old colonies, incubated at 25 °C in the dark on PDA, were whitish with light purple mycelia on the upper side and white with light purple at the center on the reverse side. Macroconidia were 3–5 septate, curved, both ends were pointed, and were 19.8–36.62 × 3.3–4.7 µm (n= 30). Microconidia were cylindrical or ellipsoid and 5.5–11.6 × 2.5–3.8 µm (n=30). Chlamydospores were globose and 9.6 –16.3 × 9.4 – 15.0 µm (n=30). The morphological characteristics of present isolates were comparable with that of Fusarium species (Maryani et al. 2019). Genomic DNA was extracted from 4 days old cultures of each isolate of SRRM 4.2, SRRH3, and SRRH5, EF-1α and rpb2 region were amplified using EF792 + EF829, and RPB2-5f2 + RPB2-7cr primer sets, respectively (Carbone and Kohn, 1999; O'Donnell et al. 2010) and sequenced (GenBank accession number: LC569791- LC569793 and LC600806- LC600808). BLAST query against Fusarium loci sampled and multilocus sequence typing database revealed that 99–100% identity to corresponding sequences of the F. oxysporum species complex (strain NRRL 28395 and 26379). Maximum likelihood phylogenetic analysis with MEGA v. 6.0 using the concatenated sequencing data for EF-1α and rpb2 showed that the isolates belonged to F. oxysporum species complex. Each three healthy seedlings with similar sized (big flower sabju) were grown for 20 days in a plastic pot containing autoclaved peat soil was used for pathogenicity tests. Conidial suspensions (106 conidia mL−1) of 20 days old colonies per isolate (two isolates) were prepared in sterile water. Three pots per strain were inoculated either by pouring 50 ml of the conidial suspension or by the same quantity of sterile distilled water as control. After inoculation, all pots were incubated at 25 °C with a 16-hour light/8-hour dark cycle in a growth chamber. This experiment repeated twice. Inoculated seedlings were watered twice a week. Approximately 60% of the inoculated seedlings per strain wilted after 15 days of inoculation and control seedlings remained asymptomatic. Fusarium oxysporum was successfully isolated from infected seedling and identified based on morphology and EF-1α sequences data to confirm Koch’s postulates. Fusarium oxysporum is responsible for damping-off of many plant species, including larch, tomato, melon, bean, banana, cotton, chickpea, and Arabidopsis thaliana (Fourie et al. 2011; Hassan et al.2019). To the best of our knowledge, this is the first report on damping-off of ovate-leaf atractylodes caused by F. oxysporum in South Korea. This finding provides a basis for studying the epidemic and management of the disease.

Download Full-text

First Report of Epicoccum layuense Causing Leaf Brown Spot on Camellia oleifera in Hefei, China

Plant Disease ◽

10.1094/pdis-08-21-1726-pdn ◽

2022 ◽

Author(s):

Xiang Xie ◽

Shiqiang Zhang ◽

Qingjie Yu ◽

Xinye Li ◽

Yongsheng Liu ◽

...

Keyword(s):

Leaf Spot ◽

Brown Spot ◽

Likelihood Method ◽

Leaf Spot Disease ◽

Original Strain ◽

Conidial Suspension ◽

Camellia Oleifera ◽

Sterile Water ◽

Beta Tubulin ◽

First Report

Camellia oleifera, a major tree species for producing edible oil, is originated in China. Its oil is also called ‘‘eastern olive oil’’ with high economic value due to richness in a variety of healthy fatty acids (Lin et al. 218). However, leaves are susceptible to leaf spot disease (Zhu et al. 2014). In May 2021, we found circular to irregular reddish-brown lesions, 4-11 mm in diameter, near the leaf veins or leaf edges on 30%-50% leaves of 1/3 oil tea trees in a garden of Hefei City, Anhui Province, China (East longitude 117.27, North latitude 31.86) (Figure S1 A). To isolate the causal agents, symptomatic leaves were cut from the junction of diseased and healthy tissues (5X5 mm) and treated with 70 % alcohol for 30 secs and 1 % NaClO for 5 min, and subsequently inoculated onto PDA medium for culture. After 3 days, hyphal tips were transferred to PDA. Eventually, five isolates were obtained. Then the isolates were cultured on PDA at 25°C for 7 days and the mycelia appeared yellow with a white edge and secreted a large amount of orange-red material to the PDA (Figure S1 B and C). Twenty days later, the mycelium appeared reddish-brown, and sub-circular (3-10 mm) raised white or yellow mycelium was commonly seen on the Petri dish, and black particles were occasionally seen. Meanwhile, the colonies on the PDA produced abundant conidia. Microscopy revealed that conidia were globular to pyriform, dark, verrucose, and multicellular with 14.2 to 25.3 μm (=19.34 μm, n = 30) diameter (Figure S1 D). The morphological characteristics of mycelial and conidia from these isolates are similar to that of Epicoccum layuense (Chen et al.2020). To further determine the species classification of the isolates, DNA was extracted from 7-day-old mycelia cultures and the PCR-amplified fragments were sequenced for internal transcribed spacer (ITS), beta-tubulin and 28S large subunit ribosomal RNA (LSU) gene regions ITS1/ITS4, Bt2a/Bt2b and LR0R/LR5, followed by sequencing and molecular phylogenetic analysis of the sequences analysis (White et al. 1990; Glass and Donaldson 1995; Vilgalys and Hester 1990). Sequence analysis revealed that ITS, beta-tubulin, and LSU divided these isolates into two groups. The isolates AAU-NCY1 and AAU-NCY2, representing the first group (AAU-NCY1 and AAU-NCY5) and the second group (AAU-NCY2, AAU-NCY3 and AAU-NCY4), respectively, were used for further studies. Based on BLASTn analysis, the ITS sequences of AAU-NCY1 (MZ477250) and AAU-NCY2 (MZ477251) showed 100 and 99.6% identity with E. layuense accessions MN396393 and KY742108, respectively. And, the beta-tubulin sequences (MZ552310; MZ552311) showed 99.03 and 99.35% identity with E. layuense accessions MN397247 and MN397248, respectively. Consistently, their LSU (MZ477254; MZ477255) showed 99.88 and 99.77% identity with E. layuense accessions MN328724 and MN396395, respectively. Phylogenetic trees were built by maximum likelihood method (1,000 replicates) using MEGA v.6.0 based on the concatenated sequences of ITS, beta-tubulin and LSU (Figure S2). Phylogenetic tree analysis confirmed that AAU-NCY1 and AAU-NCY2 are closely clustered with E. layuense stains (Figure S2). To test the pathogenicity, conidial suspension of AAU-NCY2 (106 spores/mL) was prepared and sterile water was used as the control. Twelve healthy leaves (six for each treatment) on C. oleifera tree were punched with sterile needle (0.8-1mm), the sterile water or spore suspension was added dropwise at the pinhole respectively (Figure S1 E and F). The experiment was repeated three times. By ten-day post inoculation, the leaves infected by the conidia gradually developed reddish-brown necrotic spots that were similar to those observed in the garden, while the control leaves remained asymptomatic (Figure S1 G and H). DNA sequences derived from the strain re-isolated from the infected leaves was identical to that of the original strain. E. layuense has been reported to cause leaf spot on C. sinensis (Chen et al. 2020), and similar pathogenic phenotypes were reported on Weigela florida (Tian et al. 2021) and Prunus x yedoensis Matsumura in Korea ( Han et al. 2021). To our knowledge, this is the first report of E. layuense causing leaf spot on C. oleifera in Hefei, China.

Download Full-text

First Report of a Leaf Blight Caused by Pyricularia pennisetigena on Cenchrus echinatus in Paraguay

Plant Disease ◽

10.1094/pdis-02-21-0287-pdn ◽

2021 ◽

Author(s):

Cinthia C. Cazal-Martínez ◽

Yessica Magaliz Reyes Caballero ◽

Alice Chávez ◽

Pastor Enmanuel Pérez Estigarribia ◽

Alcides Rojas ◽

...

Keyword(s):

Rna Polymerase Ii ◽

Large Subunit ◽

Fungal Species ◽

Leaf Blight ◽

Internal Transcribed Spacers ◽

Conidial Suspension ◽

Sterile Water ◽

Potential Threat ◽

First Report ◽

Microscopic Features

The genus Pyricularia contains several fungal species known to cause diseases on plants in the Poaceae family (Klaubauf et al. 2014; Wang et al. 2019). While sampling for P. oryzae during March-2015 and April-2018, common weed Cenchrus echinatus L. was observed with leaf lesions in and around experimental wheat fields in the departments of Canindeyú and Itapúa. C. echinatus samples from both locations displayed similar leaf lesions, varying from small light brown pinpoint to elliptical brown lesions with greyish center. Symptomatic leaves were surface disinfested and cultured on potato dextrose agar (PDA) amended with 1% gentamicin at 25°C. Two monosporic isolates were obtained, one from Itapúa (ITCeh117) and the other from Canindeyú (YCeh55). The isolates were subsequently grown on oatmeal agar (OA) and PDA under a 12-h photoperiod at 25°C and evaluated after ten days for colony diameter, sporulation, macroscopic and microscopic features. Colonies on OA reached up to 4.8 cm diameter and were light grey, whereas colonies on PDA reached up to 5.3 cm diameter and were brown with grey centers, with cottony mycelium and broad white rims. Mycelium consisted of smooth, hyaline, branched, septate hyphae 4-4.5 µm diameter. Conidiophores were erect, straight or curved, unbranched, medium brown and smooth. Conidia were solitary, pyriform, pale brown, smooth, granular, 2-septate, 32-33 × 9-10 μm; truncated with protruding hilum and varied in length from 1.0 to 1.5 μm and diameters from 2.0 to 2.2 μm. Both isolates were similar and identified as Pyricularia pennisetigena, according to morphological and morphometric characteristics (Klaubauf et al. 2014). Subsequently, genomic DNA was extracted from each isolate using the primers described in Klaubauf et al. (2014) to amplify and sequence the internal transcribed spacers (ITS), partial large subunit (LSU), partial RNA polymerase II large subunit gene (RPB1), partial actin gene (ACT), and partial calmodulin gene (CAL). Sequences from each isolate (YCeh55/ITCeh117) were deposited in GenBank with the following submission ID for ITS: MN947521/MN947526, RPB1: MN984710/MN984715, LSU: MN944829/MN944834, ACT: MN917177/MN917182, and CAL: MN984688/MN984693. Phylogenetic analysis was conducted using the software Beast v1.10.4. The results obtained from the concatenated matrix of the five loci placed these isolates in the P. pennisetigena clade. To confirm pathogenicity, each isolate was adjusted to 5×104 conidia/ml of sterile water and C. echinatus plants were sprayed with the conidial suspension for isolate YCeh55, ITCeh117 or sterile water using an oilless airbrush sprayer until runoff. The three treatments were kept in the greenhouse at 25-28°C and about 75% relative humidity under natural daylight. Each treatment included three to five inoculated plants and 10 leaves were evaluated per treatment. Symptoms were observed 8-15 days after inoculation and were similar to those originally observed in the field for both isolates, whereas the control plants remained asymptomatic. P. pennisetigena was re-isolated from the inoculated leaves fulfilling Koch’s postulates. To our knowledge, this is the first report of leaf blight on C. echinatus caused by P. pennisetigena in Paraguay. The occurrence of P. pennisetigena in the region and its ability to infect economically important crops such as wheat and barley (Klaubauf et al. 2014; Reges et al., 2016, 2018) pose a potential threat to agriculture in Paraguay.

Download Full-text

First Report of Fulvia fulva, Causal Agent of Tomato Leaf Mold, in Greenhouses in Southeastern Spain

Plant Disease ◽

10.1094/pdis-92-9-1371b ◽

2008 ◽

Vol 92 (9) ◽

pp. 1371-1371 ◽

Cited By ~ 1

Author(s):

M. de Cara ◽

F. Heras ◽

M. Santos ◽

J. C. Tello Marquina

Keyword(s):

Pathogenic Fungi ◽

Malt Extract ◽

Conidial Suspension ◽

First Report ◽

Leaf Mold ◽

Southeastern Spain ◽

Solanum Lycopersicum L ◽

Plastic Bags ◽

Leaf Surfaces ◽

Fulvia Fulva

Tomato (Solanum lycopersicum L.) is produced in more than 9,000 ha of greenhouses in Almería (southeastern Spain). During 2006 and 2007, a new disease was observed on almost all plants in 37 greenhouses. Yellow spots on upper and lower leaf surfaces were accompanied by gray-to-dark brown mycelia, conidiophores, and conidia on lower leaf surfaces. Affected leaves became necrotic and withered. Six isolates grown on malt extract agar (MEA) were identified as Fulvia fulva (1). The one- to three-celled conidia ranged from 21.8 × 7.8 μm to 21.5 × 6.5 μm. On MEA, potato dextrose agar, and V8 juice agar, the pathogen grew slowly; colonies were only 1 cm in diameter after 30 days. Colony color was initially intense yellow but became dark brown with age. In a growth chamber (12,000 lux for 16 h per day, 23 to 28°C, and 60 to 95% relative humidity), six pots containing five tomato plants (cv. SanPedro) at the four-true-leaf stage were inoculated with a conidial suspension (103 CFU/ml) of F. fulva. Control plants were sprayed with water. The trial was repeated once. Immediately after inoculation, plants were sealed in plastic bags for 8 days. Symptoms of the disease and signs of the pathogen were observed on all inoculated plants 18 days after inoculation. To our knowledge, this is the first report of leaf mold of tomato in Almería and it is becoming common in the greenhouse industry in this region. Reference: (1) P. Holliday and J. L. Mulder. No. 487 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1976.

Download Full-text