scholarly journals First Report of Bursaphelenchus doui on Tulip Tree (Liriodendron tulipifera) in Korea

Plant Disease ◽  
2009 ◽  
Vol 93 (11) ◽  
pp. 1221-1221 ◽  
Author(s):  
H. Han ◽  
Y.-J. Chung ◽  
S.-C. Shin
Keyword(s):  
Body Length ◽  
Pinus Densiflora ◽  
Tail Length ◽  
Liriodendron Tulipifera ◽  
Biological Information ◽  
Causative Organism ◽  
Male Body ◽  
First Report ◽  
Stylet Length ◽  
Tulip Tree

Tulip tree (Liriodendron tulipifera) is one the major tree species in Korean plantations, but it originated from North America. Bursaphelenchus doui was collected from the wood of dead tulip trees located at Wanju in Chonnam Province, Korea. Nematodes were maintained in fungal medium culture (Botrytis cinerae) on potato dextrose agar. B. doui is morphologically close to B. xylophilus, a causative organism of pine wilt disease, and identification to species is difficult. However, B. doui differs from the other species of the xyophilus group by the larger spicule (33.8 to 43.3 μm) (1). For accurate species identification, both morphology and molecular biological methods were applied. Morphological observations showed lip region 3.7 μm high and offset by a constriction, median bulb well developed, esophageal gland overlapping intestine dorsally, vulval flap present, tail terminus with distinct mucro. Males ventrally curved by fixation, spicules pared, and large with small, cucullus, oval-shaped bursa. Measurements of 20 females and 10 males (female; body length = 901.7 ± 60.5 μm, a = 34.3 ± 3.1, b = 10.4 ± 1.5, c = 23.0 ± 2.3, V = 77.1 ± 2.0, stylet length = 14.3 ± 0.4 μm, tail length = 39.5 ± 4.2 μm, length of postuterine sac = 104.6 ± 7.8: male; body length = 790.4 ± 40.6 μm, a = 34.4 ± 2.7, b = 10.8 ± 1.7, c = 22.7 ± 1.3, stylet length = 14.3 ± 0.3 μm, tail length = 34.8 ± 1.9 μm, spicules length = 39.5 ± 4.1 μm) were close to the original description of B. doui by Braasch et al. (1). For molecular diagnosis, DNA was extracted from more than 30 individual nematodes with a DNeasy Kit (Qiagen, Valencia, CA) and the internal transgenic spacers (ITS) 1, 2, and 5.8S regions in rDNA were amplified by PCR (US/PTC-0220; Bio Rad, Hercules, CA). ITS-restriction fragment length polymorphism (RFLP) can discriminate closely related species by using five different restriction enzymes (2). ITS-RFLP patterns obtained with these enzymes were the same as reported by Braasch et al. (1). B. doui previously has been detected in Korean wooden packages imported to China (1). However, most production of Korean wooden packages depends on imported coniferous trees from other countries. Although B. doui has been reported in Japanese red pine (Pinus densiflora) in Japan (3), the natural distribution of B. doui in Korea is unclear. On the basis of morphological and molecular biological information, we identify this nematode as B. doui. To our knowledge, this is the first report of B. doui on tulip tree and in a natural area in Korea. References: (1) H. Braasch et al. Russ. J. Nematol. 12:19, 2004. (2) W. Burgermeister et al. Russ. J. Nematol. 13:29, 2005. (3) N. Kanzaki et al. Nematology. 10:69, 2008.

scholarly journals First Report of Bursaphelenchus thailandae on Pinus densiflora in Korea

Plant Disease ◽  
2010 ◽  
Vol 94 (7) ◽  
pp. 922-922 ◽  
Author(s):  
H. Han ◽  
Y.-J. Chung ◽  
S.-C. Shin
Keyword(s):  
Body Length ◽  
Pinus Densiflora ◽  
Original Description ◽  
The United States ◽  
Bursaphelenchus Xylophilus ◽  
Wood Chips ◽  
Korean Isolate ◽  
Male Body ◽  
First Report ◽  
Stylet Length

A survey of nematodes on Pinus densiflora in Namyangju City, Gyeonggi Province, Korea was conducted in 2008. Namyangju is located in an area with pine wilt caused by Bursaphelenchus xylophilus and monitoring of wilt has been conducted periodically. Nematodes were extracted from wood chips by the Baermann's funnel method and were cultured on a medium of Botrytis cinerea. During the survey, B. xylophilus and B. thailandae were detected. B. thailandae was found in 20% of the trees tested and usually was found alone without B. xylophilus. Population density of B. thailandae ranged from 8,000 to 15,000 nematodes per 100 g of wood chips. The species was identified by morphology and molecular characterization. B. thailandae was differentiated from B. xylophilus by slight swellings of the stylet knobs, protruding vulval flaps and pointed tail in females, and the male spicule with distinctive shading in the dorsal region. Morphometric data was obtained by measurements of 20 females and 10 males: female, body length = 951.3 ± 56.6 μm, a = 31.8 ± 1.9, b = 10.8 ± 0.9, c = 23.4. ± 0.8, V = 76.2 ± 0.8, stylet length = 14.5 ± 0.6 μm, length of postuterine sac = 90.3 ± 13.5 μm; male, body length = 838.0 ± 71.5 μm, a = 31.1 ± 2.1, b = 5.2 ± 0.5, c = 30.4 ± 2.7, stylet length = 13.5 ± 1.1 μm, spicules length = 16.5 ± 0.7 μm. Measurements were compared with the original description of B. thailandae reported by Braasch and Braasch-Bidasak (1), which showed that the Korean isolate was larger in most body sizes. For molecular diagnosis, the internal transcribed spacer (ITS) and D2-D3 rDNA were amplified by PCR (US/PTC-0220; Bio Rad, Hercules, CA). The sequences of ITS and D2-D3 rDNA of B. thailandae from P. densiflora showed 98 and 99% homology to those of B. thailandae from GenBank Accession Nos. AM157746 and DQ497184, respectively. B. thailandae was originally described on Pinus merkusi in Pai, North Thailand (1) while Ningbo Entry-Exit Inspection and Quarantine Bureau in China reported a detection of B. thailandae in the imported packaging wood from Hong Kong, Japan, Korea, Italy, and the United States (2). However, packaging wood is a circulating product and the establishment of B. thailandae in those countries is not confirmed. The pathogenicity of B. thailandae on coniferous trees remains to be determined. To our knowledge, this is the first report of B. thailandae on P. densiflora in a natural area in Korea. References: (1) H. Braasch and R. Braasch-Bidasak. Nematology 4:853, 2002. (2) J. Gu et al. For. Pathol. 36:323, 2006.

scholarly journals First Report of Subanguina moxae Infecting Mugwort in Yunnan, China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1232-1232 ◽  
Author(s):  
R. Y. Yao ◽  
X. Q. Hu ◽  
J. P. Xue
Keyword(s):  
Body Length ◽  
Tail Length ◽  
Total Body Length ◽  
Guizhou Province ◽  
Universal Primers ◽  
Parasitic Nematodes ◽  
Its Sequence ◽  
First Report ◽  
Stylet Length ◽  
Total Body

Mugwort is a perennial in the Compositae family distributed throughout Asia and Europe. The leaves are reported to have various pharmaceutical properties, e.g., antibacterial, antiviral, antitussive, and hemostatic properties, and have been used in traditional Chinese medicine for more than 2,000 years. In August 2011, a field of mugwort in Kunming, Yunnan Province, China, exhibited more than 90% incidence of whitish and rounded galls on the leaves. There were approximately 10 galls on each leaf, impacting the quality of the leaves for medicinal use. Parasitic nematodes were found upon dissection of the galls, then eggs, second-stage juveniles (J2), and mature males and females were observed. Through the morphologic observation of juveniles and female and male adults, the parasitic nematode was identified as Subanguina moxae (Yokoo and Choi, 1968) Brzeski, 1981 (3). Key morphological features are as follows: eggs (n = 20) measured 54.0 to 71.4 × 24.1 to 30.0 μm; J2 (n = 20) had the following characteristics: body length 689.3 to 873.2 μm (x = 775.5 μm); stylet length 8.2 to 9.8 μm (x = 8.8 μm); tail length 49.5 to 74.5 μm (x = 60.1 μm); a (total body length/maximum body width) ranged from 28.6 to 38.6 μm (x = 34.1 μm); and c (total body length/the length of the tail) ranged from 11.2 to 16.0 μm (x = 13.0 μm). Females (n = 20) had the following characteristics: body length 1,252.8 to 1,665.2 μm (x = 1,475.7 μm); stylet length 7.2 to 9.2 μm (x = 8.2 μm); V of 88.0 to 92.3 μm (x = 89.6 μm); a ranged from 17.6 to 24.5 μm (x = 21.3 μm); and c ranged from 20.2 to 28.9 μm (x = 22.8 μm). Males (n = 20) had the following characteristics: body length 994.2 to 1,453.6 μm (x = 1,253.2 μm); stylet length 7.5 to 9.9 μm (x= 9.1 μm); tail length 69.2 to 88.1 μm (x = 78.0 μm); spicule length 22.2 to 33.4 μm (x = 29.4 μm); gubernaculum length 10.4 to 14.2 μm (x = 12.2 μm); a ranged from 23.1 to 37.2 μm (x = 29.9 μm); and c ranged from 13.9 to 18.7 μm (x = 16.1 μm). Amplification of the rDNA-internal transcribed spacer (ITS) region and the D2/D3 (1) fragments of the 28S RNA with universal primers rDNA1/rDNA2 and D2A/D3B yielded PCR fragments of 934 bp and 754 bp, respectively. The ITS sequence (JN865234) and D2D3 sequence (JN885540) were submitted to GenBank. The ITS sequence (JN865234) exhibited 99.4% similarity with Mesoanguina moxae (AF396314) (synonym of S. moxae) (4). S. moxae has been identified from the common mugwort in Japan (2) and in China, was reported to infect wheat in Guizhou Province, but to our knowledge, this is the first report of this nematode affecting mugwort in Yunnan, China. References: (1) S. Amiri et al. Eur. J. Plant Pathol. 108:497, 2002. (2) K. Daigo et al. Bull. School Agric. Meiji University. 56:237, 2007. (3) M. R. Siddiqi. Tylenchida: Parasites of Plants and Insects. CABI Publishing, New York, 2000. (4) S. A. Subbotin et al. Mol. Phylogenet. Evol. 30:226, 2004.

scholarly journals First Report of Meloidogyne incognita on Cardamine Violifohia in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Rui Liu ◽  
Hongqing Yin ◽  
Lin Li ◽  
Kaiwei Huang ◽  
Huixia Li ◽  
...  
Keyword(s):  
Body Length ◽  
Meloidogyne Incognita ◽  
Uv Light ◽  
Morphological Characteristics ◽  
Tail Length ◽  
Nematode Species ◽  
Economic Losses ◽  
Egg Masses ◽  
First Report ◽  
Stylet Length

Cardamine violifohia is an economically-important medicinal plant, and also a valuable plant for strong ability to accumulate selenium (Se) (Ebba et al. 2020). It is not only be used to extract selenium protein and selenium polysaccharide, but also widely used to develop selenium-supplement reagent. In September 2020, root-knot nematodes (RKN; Meloidogyne spp.) infection experiments showed that galls and egg masses were observed on the roots of numerous C. violifolia plants in Enshi (30°32′25.67″ N; 109°48′48.46″ E), Hubei Province, China. Meanwhile, the overground plants of C. violifohia were stunted and leaves were yellow. Almost 5% C. violifohia plants were affected by the disease. The roots with galls were collected, and nematodes were dissected and extracted (Fig. S1). Based on phytopathological clinic, the number of galls on each plant was 91.87 ± 19.01, and egg masses was 15.27 ± 5.36 (n = 15). Nematodes and galls were collected from soil and infected roots (Barker 1985). The morphological diagnostic of the nematode species was measured as follows. Measurements of adult females (n=20), body length = 628.15 ± 73.69 μm, width = 356.77 ± 36.72 μm, stylet length = 15.58 ±0.93 μm. Meanwhile, a high and trapezoidal dorsal arch with thick striations was observed in the perineal region of females. Second-stage juveniles (J2s) (n=20): body length = 377.09 ± 18.19 μm, body width = 15.64 ± 1.24 μm, stylet length = 13.31 ± 1.04 μm, tail length = 42.49 ± 4.64 μm, hyaline tail terminus = 12.35 ± 2.02 μm and presented well developed esophageal glands. Eggs (n=20): length = 80.81 ± 3.47 μm, and width = 37.09 ± 2.98 μm. All the morphological characteristics of the identified species were consistent with the descriptions of Meloidogyne incognita (Kofoid & White, 1919) Chitwood, 1949 (Whitehead, 1968). Molecular identification was carried out by PCR with the M. incognita-specific primers Mi-F/Mi-R (Meng et al. 2004) and 28S rDNA D2/D3 region primers MF/MR (Hu et al. 2011). The target fragments of 955 bp and 478 bp amplified by of the primer pairs Mi-F/Mi-R and MF/MR were observed under a UV light, which confirmed that these nematodes collected from C. violifohia were M. incognita (Fig. S2). Fragments were, sequenced (MZ596342 and MZ566843, respectively) and aligned with available sequences on NCBI, which were 100% identical to the MK410954, MN728679, and MK410953, MF177882 M. incognita sequences, respectively. Pathogenicity testing was conducted to perform Koch’s postulates in a greenhouse by inoculation of 500 J2s from the original population into C. violifohia seedlings (n = 30, 5-6 leaves stage). After 7 weeks, all inoculated plants exhibited the same symptoms that observed in the field initially. Different life stages of M. incognita were observed in dissected galled tissues. The average reproductive factor was 37.30 ± 6.13, which is considered as the pathogenicity of M. incognita to C. violifohia. Therefore, C. violifohia is a suitable host for M. incognita in China. The growers should be informed of the current findings to avoid serious economic losses that might be caused by this pathogenic nematode, and prepare for proper management action. To our knowledge, this is the first report of M. incognita infecting C. violifohia in China.

scholarly journals First Report of Leipotylenchus abulbosus in Iran

Plant Disease ◽  
2011 ◽  
Vol 95 (7) ◽  
pp. 882-882
Author(s):  
M. Mirzaee-Qomi ◽  
F. Khozeini ◽  
S. Barooti ◽  
S. Rezaee
Keyword(s):  
Body Length ◽  
Sandy Loam ◽  
Morphological Characteristics ◽  
Tail Length ◽  
Crop Plants ◽  
The Body ◽  
Posterior Portion ◽  
First Report ◽  
Pure Cultures ◽  
Stylet Length

Leipotylenchus abulbosus (Thorne, 1949) Sher, 1974 belongs to the family Tylenchidae, subfamily Leipotylenchinae, and order Tylenchida. During the spring and autumn months of 2008 to 2010, 80 samples were collected from rhizosphere soil of symptomatic plants including wheat (Tritichum aestivum L.), beet (Beta vulgaris L.), and maize (Zea mays L.) from Meighan and Gavar regions of Markazi Province in central Iran. Plants were dwarfed and leaves were chlorotic. Diseased plants comprised ~7% of all plants in the field. Sandy loam soil was collected from roots up to 15 cm from the base of the plants. Nematodes were extracted from the soil by sieving and centrifugation (3). For species identification, nematodes were transferred to anhydrous glycerin (2) and mounted on slides by the paraffin ring method. Identification was based on morphometric and morphological characteristics of females and males. No other forms of the nematode were isolated from collected samples. L. abulbosus was found in 10% of the collected samples. The nematodes showed typical characteristics of the genus Leipotylenchus: striated and anteriorly flattened lip region, stylet without basal knobs, didelphic gonads, four incisures in lateral fields that were areolated in the posterior portion, presence of deirids and adanal caudal alae, amphid inconspicuous in males. Males contained bursa in tail. Females contained an almost straight body, tapering anteriorly from median bulb and posteriorly beyond the anus; cuticle thick, annules fine. Labial framework was moderately sclerotized. Median bulb with prominent valvular apparatus in the center, oval, occupied two-thirds of the body. Deirids were prominent and at the level of the excretory pore. Vagina a transverse slit at right angles to body axis, extending less than half width into body. Tai1 finely annulated, short, tapering to a narrow tip but becoming broader just before the terminus. Phasmids small in anterior half of the tail. Measurements of 12 females: body length = 1,377 ± 90 (1,276 to 1,469) μm; a = 39.2 ± 1.62 (36.8 to 41.1); b = 7.2 ± 0.34 (6.6 to 8.30); c = 11.1 ± 0.16 (10.7 to 11.3); V% = 52.6 ± 1.42 (50.4 to 53.8); stylet length = 17 ± 0.22 (16.6 to 18) μm; tail length = 124 ± 6.83 (116 to 137) μm); and 7 males: (body length = 1,150 ± 56.84 (1,090 to 1,246) μm; a = 39.5 ± 1.48 (37.5 to 41.5); b = 6.4 ± 0.21 (6.1 to 6.8); c = 9.5 ± 0.06 (9.4 to 9.6); T% = 55.1 ± 0.91 (54.4 to 56.20); stylet length = 17.6 ± 0.36 (17 to 18) μm; tail length = 120 ± 3.77 (115 to 129) μm) conformed to the description of L. abulbosus. L. abulbosus, originally isolated from crop plants in surveyed regions, was cultured on beet (B. vulgaris L.) in the greenhouse. Pure cultures of the nematode were inoculated on beet seedlings at the 4- to 6-leaf stage as described previously (1). Sterilized soils were inoculated with 1,000 infective mature nematodes with three replications. Infection of beet roots by the nematode resulted in leaf chlorosis and reduction in plant height. Previously, L. amiri was collected from soils associated with the roots of onion (Allium cepa L.) plants in Pakistan (4). However there have not been any reports of L. abulbosus in crop plants before. To our knowledge, this is also the first report of L. abulbosus infecting wheat, beet, and maize plants in Iran. References: (1) K. R. Barker. Methodology 2:19, 1985. (2) A. De Grisse. Meded. Rijksfac. Landbouwwet. Gent. 34:351, 1969. (3) W. R. Jenkins. Plant Dis. Rep. 48:692, 1964. (4) M. A. Maqbool and F. Shahina. Rev. Nèmatol. 7:363, 1984.

scholarly journals First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio

Plant Disease ◽  
2012 ◽  
Vol 96 (9) ◽  
pp. 1385-1385
Author(s):  
H. D. Lopez-Nicora ◽  
T. Mekete ◽  
N. J. Taylor ◽  
T. L. Niblack
Keyword(s):  
Body Length ◽  
Tail Length ◽  
The Body ◽  
28S Rrna ◽  
Lateral Field ◽  
First Report ◽  
Pratylenchus Vulnus ◽  
Buxus Sempervirens ◽  
Stylet Length ◽  
De Man

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 μm (mean 583.0 μm), stylet length from 15.0 to 17.8 μm (mean 16.8 μm), tail length from 23.2 to 37.5 μm (mean 29.2 μm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 μm (mean 3.1 μm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c′ = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 μm (mean 537.9 μm), stylet length from 15.0 to 17.2 μm (mean 16.2 μm), tail length from 22.7 to 28.1 μm (mean 25.5 μm), spicule from 15.0 to 17.5 μm (mean 16.4 μm), gubernaculum from 3.5 to 4.7 μm (mean 4.0 μm), and DGO from 2.6 to 3.7 μm (mean 3.1 μm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c′ = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.

scholarly journals First Report of Meloidogyne incognita on Mulberry in Saudi Arabia

Plant Disease ◽  
2021 ◽  
Author(s):  
Hamzeh Lafi ◽  
Fahad Al-Yahya ◽  
Ahmad Al Hazmi
Keyword(s):  
Saudi Arabia ◽  
Body Length ◽  
Meloidogyne Incognita ◽  
Tail Length ◽  
Total Body Length ◽  
Morus Alba ◽  
Body Width ◽  
First Report ◽  
Stylet Length ◽  
Total Body

The genus Morus comprises many species (Suttie 2012). The species Morus alba is one of the most popular mulberry species worldwide. In October 2020, numerous mulberry trees presented chlorotic leaves and stunted growth with severe root galling in a private compound in Riyadh region, Saudi Arabia. The infected roots showed galls, which are typical symptoms of infection by root-knot nematodes (RKNs). Infected roots were dissected, and males and females were extracted from roots while second stage juveniles (J2s) were from both soil and eggmasses. Morphological and morphometrical features were documented. Perineal patterns of females, males, and J2s were studied using a compound microscope. The endoparasitic females had pearly shaped bodies with projecting neck. Stylet knobs were rounded and set off and the shape of the cone distinctly curved. The posterior perineal had a dorsally high square arch. Striae patterns were zig-zag or forked along the lateral lines. Males were vermiform and the head cap flat to concave. Mostly conus of stylet was longer than shaft. Stylet knobs were prominent, set off, flat and usually greater width than the length. Males had a bluntly rounded tail, spicules were slightly curved and gubernaculum was crescentic. The J2s were vermiform, and stylet knobs were prominent and rounded shape. The J2s tail had a transparent area with an obtuse tip. The morphological measurements (means and range) of the perineal patterns of females (n = 4) were: length of vulval slit (LVS) = 22.5 (21.5 to 23.4) μm, anus to vulval slit (AVS) = 22 (21.8 to 22.1) μm, and anus length (AL) = 7.7 (7.5 to 7.8) μm. The males (n = 16) measurements were: length (L) = 1136 (1116 to 1159) μm; a (total body length / greatest body width) = 34.8 (33 to 37.1); body width = 32.7 (31.2 to 33.8) μm; stylet length = 25.6 (24.7 to 27.3) μm; dorsal oesophageal gland orifice (DGO) = 2.9 (2.6 to 3) μm, tail length = 7.1 (6.5 to 7.8) μm, c (total body length / tail length) = 161 (143.1 to 175), spicules length = 30.8 (26 to 33.8) μm; gubernaculum = 9.7 (9.1 to 10.4) μm. The J2s (n = 11) measurements were: L = 395 (378 to 405) μm; a = 26.2 (24.3 to 28.4); c = 8.6 (8.2 to 9.2); head end to metacorpus valve = 53 (49.4 to 54.6) μm; excretory pore to head end = 78 (72.8 to 80) μm, stylet length = 10.7 (10.4 to 11.7) μm; body width = 15.1 (14.3 to 15.6) μm; tail length = 45.8 (44.2 to 49.4) μm; hyaline tail terminus length = 12.5 (10.4 to 13) μm. Both the morphological and morphometrical features of the perineal pattern of the females, males, and J2s match the original description of Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Eisenback and Hirschmann 1981; Taylor and Netscher 1974). To perform Koch’s postulates, mulberry plants maintained in pots were inoculated with 2,500 J2s and eggs of the original population of M. incognita using five replicates. After two months, all inoculated plants had galled roots typical of RKNs. Reproduction factor value was 6.4. The noninoculated plants did not present galls in the roots. These results confirmed the nematode’s pathogenicity on mulberry. To the best of our knowledge, this is the first report that M. incognita was identified as a parasite of mulberry (Morus alba) in Saudi Arabia and the world, while Meloidogyne hispanica was reported on mulberry trees in Iran (Shokoohi et al. 2016). The importance of this report shed some lights on this new problem to direct the attention of farmers and home gardeners to take actions for the management of this newly identified problem. The authors declare no conflict of interest. Acknowledgments Authors wish to thanks College of Food and Agricultural Sciences, Research Center and Deanship of Scientific Research, King Saud University, Saudi Arabia for supporting this work. References: Eisenback, J. D. and Hirschmann, H. 1981. J. Nematol. 13:513. Shokoohi, E. et al. 2016. Australasian Plant Dis. Notes 11:16. Suttie, J. M. 2012. Food and Agricultural Organization of the United Nations. Taylor D. P., Netscher, C. 1974. Nematologica 20:268.

scholarly journals First report of Meloidogyne hapla infecting Yunmuxiang (Aucklandia lappa) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Wentao Wu ◽  
Zewen Gao ◽  
Shaofang Zhou ◽  
Hong Li ◽  
Ying Dong ◽  
...  
Keyword(s):  
Body Length ◽  
Morphological Characteristics ◽  
Herbaceous Plant ◽  
Pathogenicity Test ◽  
Meloidogyne Hapla ◽  
Medicinal Uses ◽  
First Report ◽  
Second Stage ◽  
Stylet Length ◽  
Species Specific

Yunmuxiang (Aucklandia lappa) is a tall, perennial herbaceous plant in the compositae family, occurring mainly in Asia and Europe. Yunmuxiang originated in India and was introduced into China in approximately 1940. Since then it has been widely cultivated in the southwest region of China for medicinal uses; it is included in the Chinese Pharmacopoeia. Yunmuxiang is used primarily as a sedative, including for anesthesia (Ting et al. 2012). Severely stunted and withered Yunmuxiang plants with rotted and galled roots were observed in a field in near the city of Lijiang (N 99°46′; E 27°18′) in October 2019. These symptoms were typical of infection by root-knot nematodes.The second-stage juveniles (J2) were collected from the soil in the root zone, and adult females were dissected from roots. Population densities of J2 ranged from 325 to 645 per 100 cm3. Morphological analysis and species-specific PCR were performed on the second stage (J2) and females. Morphological characteristics are as follows: for J2 (n=20) , body length = 360.5 ± 23.4 µm, tail length = 47.2 ± 6.1 µm, and stylet length = 10.4 ± 1.9 µm, distance from dorsal esophageal gland opening to the stylet knot (DGO) = 3.96 ± 0.42 μm; females (n = 20) were pear-shaped, body length = 565.23 ± 86.68 μm, maximum body width = 407.24 ± 60.21 μm, stylet length = 9.93 ± 0.88 μm, DGO = 4.76 ± 0.32 μm, stylet median bulb width (MBW) = 29.67 ± 3.61 μm, perineum morphology is low and low dorsal arch round, with a typical inferior protrusion near the anus. These morphological characteristics are consistent with Meloidogyne hapla as described by Hunt and Handoo (2009). To confirm species identification, DNA was extracted from females (Blok, et al. 1997) and ITS region was amplified using the primers 18S/26S (Vrain et al. 1992). Furthermore, species-specific SCAR primers JMV1/JMV hapla were used as described by Adam et al. (2007). PCR produced 768 bp and 419 bp sequences. Fragments were sequenced (MW512922and MW228371, respectively) and compared with available sequences on NCBI. Sequences were 99.48% identical to the MT249016, KJ572385, and 100% identical to the GQ395574, GQ395569 M. hapla sequences, respectively. Morphological and molecular characterization supports the identification of the isolate found on Aucklandia lappa as M. hapla. Yunmuxiang seed were planted in 20 cm diameter, 10 cm deep plastic pots containing 1000 cm3 sterilized soil. Seedlings were thinned to one per pot. At the 2-3 leaf stage 10 pots were infested with 1500 M. hapla J2 per seedling, using a sterilized micropipette. Plants were maintained at 20-25°C in a greenhouse. Control plants received sterile water, and the pathogenicity test was repeated three times. After 30 days, plants were removed from pots and soil gently removed from the roots. A large number of galls (95.6 ± 2.5) and egg masses (33.5 ± 0.5) were found on each root system. Yunmuxiang was considered a good host for M. hapla in Lijiang. M. hapla is a major plant parasitic nematode with a wide geographic distribution and range of host plants and causes severe yield losses (Azevedo de Oliveira et al. 2018). Through investigation, this is the first report worldwide of M. hapla infecting Aucklandia lappa.

First Report of the Apple Root-Knot Nematode, Meloidogyne mali, on Maple Trees in Republic of Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Heonil Kang ◽  
Jongmin Seo ◽  
Hyoung-Rai Ko ◽  
Sohee Park ◽  
Nam-Sook Park ◽  
...  
Keyword(s):  
Body Length ◽  
National Park ◽  
Its Region ◽  
28S Rdna ◽  
Republic Of Korea ◽  
Egg Mass ◽  
Lateral Field ◽  
First Report ◽  
Future Production ◽  
Stylet Length

Meloidogyne mali was originally described in Japan on roots of an apple rootstock (Malus prunifolia) (Itoh et al. 1969) and found on elm trees in Italy, Netherlands, Belgium, France and United Kingdom, and euonymus in the USA (EPPO 2018; Prior et al. 2019). In Italy, the nematode was initially described as a new species, Meloidogyne ulmi, but was later synonymized with M. mali (Ahmad et al., 2013). During the study of Meloidogyne species in Republic of Korea, galled roots were found on Acer palmatum collected in Naejangsan National Park, Republic of Korea located at 35°29'29.1"N, 126°55'42.7"E, altitude 147.8 m. Morphologically, the perineal patterns of the females was very similar to M. mali due to rounded dorsal arch and smooth, finely-spaced, indistinct striae. Lateral field shallow, narrow, and faint. Phasmids large, very distinct. Head region of second–stage juveniles flattened anteriorly to hemispherical, slightly set-off from body, without annulations, low head cap. Stylet slender, sharply pointed cone, cylindrical shaft with rounded knob sloping posteriorly. Tail conoid with irregular, and rounded end. Rectum undilated. Several micrographs were made from 25 J2s and females for mean, standard deviation and range. J2s were measured with a body length: 408.2 ± 25.1 (366-449) µm, maximum body width: 15.9 ± 1.0 (14.1-17.9) µm, stylet length: 14.1 ± 0.5 (13.1-15.3) µm, hyaline tail terminus: 10.0 ± 0.9 (8.3-11.0) µm and tail length: 31.7 ± 3.0 (26.0-36.1) µm. Females (n=25) were characterized by a body length: 656.7 ± 102.7 (516-947) µm, a stylet length: 16.4 ± 2.2 (13.9-19.0) µm, a vulval slit length: 22.2 ± 1.8 (19.8-25.7) µm, and a vulva-anal distance: 20.2 ± 2.4 (17.1-25.4) µm. Morphological measurements and configuration of perineal patterns (Fig. 1S) were comparable to M. mali (Itoh et al. 1969; Ahmed et al. 2013; Gu et al. 2020). To confirm pathogenicity, a modified version of Koch’s postulates was conducted in the greenhouse by inoculating 300 eggs from a single egg mass onto each of three, two-year-old A. palmatum plants, grown in sterilized sandy soil. After about one year, symptoms developed on the maple tree roots, with numerous galls containing females and egg masses by visual inspection. In addition, PCR was performed for the 28S rDNA D2-D3 segment and ITS region using the primers D2A, D3B, TW81 and AB28. The resulting sequences (MW522548, MW522549, MW523004 and MW523005) were at least 99% identical to other 28S rDNA D2-D3 segment and ITS region sequences on Genbank (MT406757 and JX978229). The molecular phylogenetic relationships of this species strongly supports M. mali (Fig. 2S). To the best of our knowledge, this is the first report of M. mali in Republic of Korea. The host range of M. mali includes many species which are of economic importance in fruit trees (e.g. apple, chestnut, fig, mulberry), forestry trees (e.g. elm, maple, oak, Yew), and vegetable crops (e.g. cabbage, carrot, cucumber, eggplant, soybean, watermelon). The potential danger to these economically important plants caused M. mali to be added the EPPO Alert List and also the Quarantine List of the Korean Animal and Plant Quarantine Agency. Additionally, in our survey around the Naejangsan National Park, M. mali was not found on other economically important host crops, such as grapes. Although this nematode was not detected other crops, it requires regular monitoring because it poses a serious threat to the future production of these crops.

scholarly journals First report of the nematodes Filenchus orientalis and Hemicriconemoides californianus on faba bean in Iran

2016 ◽  
Vol 9 (1) ◽  
pp. 44-50
Author(s):  
S. Azimi ◽  
E. Mahdikhani-Moghadam ◽  
H. Rouhani ◽  
H. Rajabi Memari
Keyword(s):  
Body Length ◽  
Tail Length ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Morphometric Characters ◽  
Lateral Field ◽  
Stylet Length ◽  
First Time ◽  
Plant Parasitic ◽  
Iranian Populations

Summary During a survey in Iran, two known species of plant-parasitic nematodes of the families Tylenchidae and Criconematidae were reported for the first time. The morphological and morphometric characters of Iranian populations of the two recovered species are discussed and illustrated based on morphological and morphometrics data. Iranian population of Filenchus orientalis is characterized by having a 601-755μm body length, stylet length of 9.0-11.3 μm, lateral field with four incisures, tail length of 100-118 μm and males with 15-21 μm long spicules. Hemicriconemoides californianus population is characterized by having a body length of 430-550μm, lip region with two annuli, stylet length of 75-83μm and tail length of 20-28 μm. The morphological and morphometric characters of both species are in agreement with those in original descriptions.

scholarly journals First Report of the Dagger Nematode Xiphinema diversicaudatum in Citrus Orchards in Morocco

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 575-575 ◽  
Author(s):  
F. Mokrini ◽  
F. Abbad Andaloussi ◽  
L. Waeyenberge ◽  
N. Viaene ◽  
M. Moens
Keyword(s):  
Body Length ◽  
Tail Length ◽  
Morphological Identification ◽  
Rrna Gene ◽  
Body Width ◽  
Arabis Mosaic Virus ◽  
First Report ◽  
Citrus Orchards ◽  
Plant Pathol ◽  
Xiphinema Diversicaudatum

Xiphinema species are migratory ectoparasitic nematodes that feed on an extensive range of hosts, and several species are vectors of nepoviruses. In May 2012, during a survey of the citrus-growing areas in the Gharb region of Morocco, several Xiphinema nematodes were detected in three locations: Kénitra (INRA, plot P1), Sidi Kacem, and Sidi Slimane. Samples were taken 30 cm deep at 50 cm distance from the tree trunks, in 40-year-old orange groves planted with the variety Maroc Late, grafted on rootstocks of Sour Orange and Citrange Carrizo. The trees showed yellowing of leaves, reduced tree vigor, and swellings at the tips of the roots. There were no weeds or grasses in the sampled area. Nematodes were extracted from soil using an automated centrifuge for extracting free-living nematode stages (2) and identified morphologically and by sequencing. All specimens were identified as Xiphinema diversicaudatum based on key morphological features from females and males. The average measurements of six females were: body length 4.1 mm, body width 60.4 μm, odontostylet 133.5 μm, odontophore 64.0 μm, spear 197.5 μm, tail length 45 μm, body width at anus 31 μm, and vulval position 48%. The females had two genital branches of similar length and structure, which contained a pseudo-Z differentiation. The average measurements of four males were: body length 4.3 mm, body width 51 μm, odontostylet 139 μm, odontophore 70 μm, spear 209 μm, tail length 45 μm, body width at anus 35 μm. To confirm the morphological identification, molecular observations were made. DNA was extracted from one nematode of each location. The D3 expansion region of the 26S rRNA gene was amplified using the primers D3A (5′-GACCCGTCTTGAAACACGGA-3′) and D3B (5′-TCGGAAGGAACCAGCTACTA-3′) (1). The PCR products were purified and sequenced (Macrogen, Inc., Seoul, Korea). All sequences obtained (GenBank Accession Nos. KF057879, KF057880, and KF057881) were compared with sequences available from the GenBank database including several species of Xiphinema. This comparison revealed a sequence similarity of 99 to 100% with X. diversicaudatum. Morphological and molecular identification demonstrated that the isolates of dagger nematodes from three citrus growing areas in Gharb belonged to X. diversicaudatum. An average of six X. diversicaudatum per 100 cm3 soil were found. This is the first report of this species in Morocco. X. diversicaudatum can transmit Arabis mosaic and Strawberry latent ringspot viruses (3). Arabis mosaic virus is of great economic importance in viticulture as it is associated with grapevine fanleaf degeneration disease, together with Grapevine fan leaf virus transmitted by X. index (4). As vineyards are planted amid citrus orchards in the Gharb region, particular attention should be given to this nematode, especially to the risk of its spread by soil. Our finding of X. diversicaudatum in a citrus orchard does not necessarily imply that X. diversicaudatum causes damage in citrus. However, its presence indicates that this nematode species can survive in this environment from where it could spread to other, more susceptible, crops. References: (1) L. Al-Banna et al. Mol. Phylogenet. Evol. 7:94, 1997. (2) G. Hendrickx. Nematologica 41:30, 1998. (3) J. Hübschen et al. Eur. J. Plant Pathol. 110:779, 2004. (4) A. Marmonier et al. J. Plant Pathol. 92:275, 2010.

Sign in / Sign up

Export Citation Format

Share Document