scholarly journals A truncated haemoglobin implicated in oxygen metabolism by the microaerophilic food-borne pathogen Campylobacter jejuni

Microbiology ◽  
2005 ◽  
Vol 151 (12) ◽  
pp. 4079-4091 ◽  
Author(s):  
Laura M. Wainwright ◽  
Karen T. Elvers ◽  
Simon F. Park ◽  
Robert K. Poole
Keyword(s):  
Campylobacter Jejuni ◽  
Nitrosative Stress ◽  
Bacterial Pathogen ◽  
Oxygen Metabolism ◽  
Wild Type ◽  
Gene Encoding ◽  
Food Borne ◽  
Micro Organisms ◽  
Mutant Cells ◽  
Kinetics Of

Of the three groups of haemoglobins identified in micro-organisms (single-domain globins, flavohaemoglobins and truncated globins), the last group is the least well understood. The function of the truncated haemoglobin (Ctb) encoded by Cj0465c in the microaerophilic food-borne bacterial pathogen Campylobacter jejuni was investigated by constructing a ctb mutant and characterizing its phenotype. The effects of the ctb mutation on the kinetics of terminal oxidase function in C. jejuni were investigated using oxyleghaemoglobin and oxymyoglobin as sensitive reporters of O2 consumption. The V max of ctb mutant cells for O2, calculated using either globin, was greater than that of wild-type cells at extracellular O2 concentrations up to ∼1 μM, suggesting a role for Ctb in moderating O2 supply for reduction by high-affinity terminal oxidases. However, cells mutated in ctb were disadvantaged when grown under conditions of high aeration, as revealed by measurements of growth yields and rates in batch culture. Furthermore, the rate at which ctb mutant cells consumed O2 in an O2 electrode (10–200 μM O2) was approximately half the rate displayed by wild-type cells, reflecting a role for Ctb in respiration at physiologically relevant external O2 concentrations. However, a lack of sensitivity of the mutant to paraquat or H2O2 indicated that increased oxidative stress under such conditions was not the cause of these phenotypes. O2 affinities of cells (K m values of approximately 40 nM and 1 μM) were unaffected by mutation of either Ctb or the full-length C. jejuni globin, Cgb. Although the gene encoding Ctb was found to be upregulated by S-nitrosoglutathione (GSNO) and the NO-donating compound S-nitroso-N-acetylpenicillamine (SNAP), a ctb mutant did not display sensitivity to a number of nitrosative stress-generating compounds. The authors conclude that Ctb is involved in moderating O2 flux within C. jejuni.

scholarly journals Role of Campylobacter jejuni Respiratory Oxidases and Reductases in Host Colonization

2008 ◽  
Vol 74 (5) ◽  
pp. 1367-1375 ◽  
Author(s):  
Rebecca A. Weingarten ◽  
Jesse L. Grimes ◽  
Jonathan W. Olson
Keyword(s):  
Campylobacter Jejuni ◽  
Anaerobic Respiration ◽  
Wild Type ◽  
Respiratory Enzymes ◽  
Host Colonization ◽  
Enzymatic Function ◽  
Food Borne ◽  
Transport Chain ◽  
Respiratory Oxidases

ABSTRACT Campylobacter jejuni is the leading cause of human food-borne bacterial gastroenteritis. The C. jejuni genome sequence predicts a branched electron transport chain capable of utilizing multiple electron acceptors. Mutants were constructed by disrupting the coding regions of the respiratory enzymes nitrate reductase (napA::Cm), nitrite reductase (nrfA::Cm), dimethyl sulfoxide, and trimethylamine N-oxide reductase (termed Cj0264::Cm) and the two terminal oxidases, a cyanide-insensitive oxidase (cydA::Cm) and cbb3-type oxidase (ccoN::Cm). Each strain was characterized for the loss of the associated enzymatic function in vitro. The strains were then inoculated into 1-week-old chicks, and the cecal contents were assayed for the presence of C. jejuni 2 weeks postinoculation. cydA::Cm and Cj0264c::Cm strains colonized as well as the wild type; napA::Cm and nrfA::Cm strains colonized at levels significantly lower than the wild type. The ccoN::Cm strain was unable to colonize the chicken; no colonies were recovered at the end of the experiment. While there appears to be a role for anaerobic respiration in host colonization, oxygen is the most important respiratory acceptor for C. jejuni in the chicken cecum.

The kinetics of the B cyclin p56cdc13 and the phosphatase p80cdc25 during the cell cycle of the fission yeast Schizosaccharomyces pombe

1996 ◽  
Vol 109 (6) ◽  
pp. 1647-1653 ◽  
Author(s):  
J. Creanor ◽  
J.M. Mitchison
Keyword(s):  
Schizosaccharomyces Pombe ◽  
Mammalian Cells ◽  
Size Control ◽  
Base Line ◽  
Wild Type ◽  
Main Band ◽  
The Times ◽  
G1 Cells ◽  
Mutant Cells ◽  
Kinetics Of

The levels of the B cyclin p56cdc13 and the phosphatase p80cdc25 have been followed in selection-synchronised cultures of Schizosaccharomyces pombe wild-type and wee1 mutant cells. p56cdc13 has also been followed in induction-synchronised cells of the mutant cdc2-33. The main conclusions are: (1) cdc13 levels in wild-type cells start to rise from base line at about mid-G2, reach a peak before mitosis and then fall slowly through G1. Cells exit mitosis with appreciable levels of cdc13. (2) cdc13 levels in wee1 cells fall to zero in interphase. They also start to rise at the beginning of G2, which may be related to the absence of a mitotic size control. (3) cdc25 starts to rise later and reaches a peak after mitosis. This is not what would be expected from a simple mitotic inducer and suggests that cdc25 has an important function at the end of mitosis. (4) An upper (heavier) band of cdc25 peaks at the same time as the main band but rises and falls more rapidly. If this is a hyperphosphorylated form, its timing shows that it is most unlikely to function in the ways shown for such a form in eggs and mammalian cells. (5) Experiments with the mutant cdc10-129 and with hydroxyurea show that the initial signal to begin synthesis of cdc13 originates at Start. (6) In induction synchrony, where G2 spans across cell division, there is evidence that some events in one cycle cannot start in the previous one. (7) Revised timings are given for the times of mitosis in these cultures.

scholarly journals The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

Microbiology ◽  
2010 ◽  
Vol 156 (2) ◽  
pp. 374-384 ◽  
Author(s):  
Stijn van der Veen ◽  
Saskia van Schalkwijk ◽  
Douwe Molenaar ◽  
Willem M. de Vos ◽  
Tjakko Abee ◽  
...  
Keyword(s):  
Listeria Monocytogenes ◽  
Sos Response ◽  
Wild Type ◽  
Translesion Dna Synthesis ◽  
Transcription Profiles ◽  
Food Borne ◽  
Operator Sequence ◽  
Survival Studies ◽  
Mutant Cells ◽  
Imperfect Palindrome

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a ΔrecA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; ΔrecA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Stress-survival studies showed ΔrecA mutant cells to be less resistant to heat, H2O2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

scholarly journals The Campylobacter jejuni Thiol Peroxidases Tpx and Bcp Both Contribute to Aerotolerance and Peroxide-Mediated Stress Resistance but Have Distinct Substrate Specificities

2008 ◽  
Vol 190 (15) ◽  
pp. 5279-5290 ◽  
Author(s):  
John M. Atack ◽  
Philippa Harvey ◽  
Michael A. Jones ◽  
David J. Kelly
Keyword(s):  
Hydrogen Peroxide ◽  
Campylobacter Jejuni ◽  
Double Mutant ◽  
Nitrosative Stress ◽  
Growth Defect ◽  
Organic Peroxides ◽  
Wild Type ◽  
Recombinant Enzymes ◽  
Cell Extracts ◽  
Oxidative Protein Damage

ABSTRACT The microaerophilic food-borne pathogen Campylobacter jejuni experiences variable oxygen concentrations during its life cycle, especially during transitions between the external environment and the avian or mammalian gut. Single knockout mutations in either one of two related thiol peroxidase genes, tpx and bcp, resulted in normal microaerobic growth (10% [vol/vol] oxygen) but poorer growth than that of the wild type under high-aeration conditions (21% [vol/vol] oxygen). However, a tpx/bcp double mutant had a severe microaerobic growth defect and did not grow at high aeration in shake flasks. Although the single mutant strains were no more sensitive than the wild-type strains in disc diffusion assays with hydrogen peroxide, organic peroxides, superoxide, or nitrosative stress agents, in all cases the double mutant was hypersensitive. Quantitative cell viability and cellular lipid peroxidation assays indicated some increased sensitivity of the single tpx and bcp mutants to peroxide stress. Protein carbonylation studies revealed that the tpx/bcp double mutant had a higher degree of oxygen- and peroxide-induced oxidative protein damage than did either of the single mutants. An analysis of the peroxidase activity of the purified recombinant enzymes showed that, surprisingly, Tpx reduced only hydrogen peroxide as substrate, whereas Bcp also reduced organic peroxides. Immunoblotting of wild-type cell extracts with Tpx- or Bcp-specific antibodies showed increased abundance of both proteins under high aeration compared to that under microaerobic growth conditions. Taken together, the results suggest that Tpx and Bcp are partially redundant antioxidant enzymes that play an important role in protection of C. jejuni against oxygen-induced oxidative stress.

scholarly journals Sialylation of Lipooligosaccharide Cores Affects Immunogenicity and Serum Resistance of Campylobacter jejuni

2000 ◽  
Vol 68 (12) ◽  
pp. 6656-6662 ◽  
Author(s):  
Patricia Guerry ◽  
Cheryl P. Ewing ◽  
Thomas E. Hickey ◽  
Martina M. Prendergast ◽  
Anthony P. Moran
Keyword(s):  
Electrophoretic Mobility ◽  
Campylobacter Jejuni ◽  
Polyclonal Antiserum ◽  
Wild Type ◽  
Gene Encoding ◽  
Whole Cells ◽  
Acetylneuraminic Acid ◽  
Genes Encoding ◽  
Hyperimmune Antiserum ◽  
Human Sera

ABSTRACT Three genes involved in biosynthesis of the lipooligosaccharide (LOS) core of Campylobacter jejuni MSC57360, the type strain of the HS:1 serotype, whose structure mimics GM2ganglioside, have been cloned and characterized. Mutation of genes encoding proteins with homology to a sialyl transferase (cstII) and a putative N-acetylmannosamine synthetase (neuC1), part of the biosynthetic pathway ofN-acetylneuraminic acid (NeuNAc), have identical phenotypes. The LOS cores of these mutants display identical changes in electrophoretic mobility, loss of reactivity with cholera toxin (CT), and enhanced immunoreactivity with a hyperimmune polyclonal antiserum generated against whole cells of C. jejuni MSC57360. Loss of sialic acid in the core of the neuC1 mutant was confirmed by fast atom bombardment mass spectrometry. Mutation of a gene encoding a putative β-1,4-N-acetylgalactosaminyltransferase (Cgt) resulted in LOS cores intermediate in electrophoretic mobility between that of wild type and the mutants lacking NeuNAc, loss of reactivity with CT, and a reduced immunoreactivity with hyperimmune antiserum. Chemical analyses confirmed the loss of N-acetylgalactosamine (GalNAc) and the presence of NeuNAc in the cgt mutant. These data suggest that the Cgt enzyme is capable of transferring GalNAc to an acceptor with or without NeuNAc and that the Cst enzyme is capable of transferring NeuNAc to an acceptor with or without GalNAc. A mutant with a nonsialylated LOS core is more sensitive to the bactericidal effects of human sera than the wild type or the mutant lacking GalNAc.

scholarly journals Campylobacter jejuni proteins Cj0952c and Cj0951c affect chemotactic behaviour towards formic acid and are important for invasion of host cells

Microbiology ◽  
2010 ◽  
Vol 156 (10) ◽  
pp. 3123-3135 ◽  
Author(s):  
A. Malik Tareen ◽  
Javid Iqbal Dasti ◽  
Andreas E. Zautner ◽  
Uwe Groß ◽  
Raimond Lugert
Keyword(s):  
Formic Acid ◽  
Campylobacter Jejuni ◽  
Formate Dehydrogenase ◽  
Bacterial Pathogen ◽  
Host Cells ◽  
Industrialized Countries ◽  
Transposon Insertion ◽  
Food Borne ◽  
Strain Nctc ◽  
Chemotactic Behaviour

Campylobacter jejuni, an important food-borne bacterial pathogen in industrialized countries and in the developing world, is one of the major causes of bacterial diarrhoea. To identify genes which are important for the invasion of host cells by the pathogen, we screened altogether 660 clones of a transposon-generated mutant library based on the clinical C. jejuni isolate B2. Thereby, we identified a clone with a transposon insertion in gene cj0952c. As in the well-characterized C. jejuni strain NCTC 11168, the corresponding protein together with the gene product of the adjacent gene cj0951c consists of two transmembrane domains, a HAMP domain and a putative MCP domain, which together are thought to act as a chemoreceptor, designated Tlp7. In this report we show that genes cj0952c and cj0951c (i) are important for the host cell invasion of the pathogen, (ii) are not translated as one protein in C. jejuni isolate B2, contradicting the idea of a postulated read-through mechanism, (iii) affect the motility of C. jejuni, (iv) alter the chemotactic behaviour of the pathogen towards formic acid, and (v) are not related to the utilization of formic acid by formate dehydrogenase.

The kinetics of H1 histone kinase activation during the cell cycle of wild-type and wee mutants of the fission yeast Schizosaccharomyces pombe

1994 ◽  
Vol 107 (5) ◽  
pp. 1197-1204 ◽  
Author(s):  
J. Creanor ◽  
J.M. Mitchison
Keyword(s):  
Fission Yeast ◽  
Kinase Activity ◽  
Wild Type ◽  
Kinase Activation ◽  
H1 Histone ◽  
Synchronous Cultures ◽  
Novel Method ◽  
Histone Kinase ◽  
Mutant Cells ◽  
Kinetics Of

H1 histone kinase activity has been followed in selection-synchronised cultures of fission yeast wild-type and wee1 mutant cells, and in induction-synchronised cells of the mutant cdc2-33. The main conclusions are: (1) in all three cases, the peak of activity is near mitosis. (2) The rise in activity is relatively slow starting in wild type at 0.4 of the cycle before mitosis. It is proposed that the beginning of the rise is the first identified event in the mitotic control. (3) The rise is twice as fast in wee and starts nearer to mitosis. (4) In all cases the beginning of the rise is in G2. (5) The fall in activity is also slow, lasting for 0.25 of the cycle, in wild type. Exit from mitosis happens well before activity has fallen to baseline. (6) In a range of size mutants, activity is roughly proportional to cell size. It is suggested that the kinase may have a cytoplasmic function. (7) Estimates have been made of the timing of mitosis in the mutants. In wee, mitosis is 0.14 of the cycle earlier than in wild type because the cells have a longer septated period at the end of the cycle. (8) A novel method has been developed for eliminating the effects of the partial asynchrony in synchronous cultures, without which the kinetic analysis would have been inaccurate.

scholarly journals Roles of the twin-arginine translocase and associated chaperones in the biogenesis of the electron transport chains of the human pathogen Campylobacter jejuni

Microbiology ◽  
2010 ◽  
Vol 156 (10) ◽  
pp. 2994-3010 ◽  
Author(s):  
Andrew Hitchcock ◽  
Stephen J. Hall ◽  
Jonathan D. Myers ◽  
Francis Mulholland ◽  
Michael A. Jones ◽  
...  
Keyword(s):  
Electron Transport ◽  
Campylobacter Jejuni ◽  
Reactive Nitrogen Species ◽  
Formate Dehydrogenase ◽  
Nitrosative Stress ◽  
Nitrite Reduction ◽  
Enzyme Assays ◽  
Wild Type ◽  
Electron Transport Chains ◽  
Twin Arginine Translocase

The zoonotic pathogen Campylobacter jejuni NCTC 11168 uses a complex set of electron transport chains to ensure growth with a variety of electron donors and alternative electron acceptors, some of which are known to be important for host colonization. Many of the key redox proteins essential for electron transfer in this bacterium have N-terminal twin-arginine translocase (TAT) signal sequences that ensure their transport across the cytoplasmic membrane in a folded state. By comparisons of 2D gels of periplasmic extracts, gene fusions and specific enzyme assays in wild-type, tatC mutant and complemented strains, we experimentally verified the TAT dependence of 10 proteins with an N-terminal twin-arginine motif. NrfH, which has a TAT-like motif (LRRKILK), was functional in nitrite reduction in a tatC mutant, and was correctly rejected as a TAT substrate by the tatfind and TatP prediction programs. However, the hydrogenase subunit HydA is also rejected by tatfind, but was shown to be TAT-dependent experimentally. The YedY homologue Cj0379 is the only TAT translocated molybdoenzyme of unknown function in C. jejuni; we show that a cj0379c mutant is deficient in chicken colonization and has a nitrosative stress phenotype, suggestive of a possible role for Cj0379 in the reduction of reactive nitrogen species in the periplasm. Only two potential TAT chaperones, NapD and Cj1514, are encoded in the genome. Surprisingly, despite homology to TorD, Cj1514 was shown to be specifically required for the activity of formate dehydrogenase, not trimethylamine N-oxide reductase, and was designated FdhM.

scholarly journals The Metalloprotease of Listeria monocytogenes Is Activated by Intramolecular Autocatalysis

2007 ◽  
Vol 190 (1) ◽  
pp. 107-111 ◽  
Author(s):  
Alan Pavinski Bitar ◽  
Min Cao ◽  
Hélène Marquis
Keyword(s):  
Listeria Monocytogenes ◽  
Bacterial Pathogen ◽  
Mutant Form ◽  
Wild Type ◽  
Food Borne ◽  
Large N ◽  
N Terminus ◽  
Type Form ◽  
Wild Type Form

ABSTRACT The metalloprotease (Mpl) of Listeria monocytogenes is a thermolysin-like protease that mediates the maturation of a broad-range phospholipase C, whose function contributes to the ability of this food-borne bacterial pathogen to survive intracellularly. Mpl is made as a proprotein that undergoes maturation by proteolytic cleavage of a large N-terminal prodomain. In this study, we identified the N terminus of mature Mpl and generated Mpl catalytic mutants to investigate the mechanism of Mpl maturation. We observed that Mpl activity was a prerequisite for maturation, suggesting a mechanism of autocatalysis. Furthermore, using a strain of L. monocytogenes expressing both the wild-type form and a catalytic mutant form of Mpl simultaneously, we determined that in vivo maturation of Mpl occurs exclusively by an intramolecular autocatalysis mechanism.

Sign in / Sign up

Export Citation Format

Share Document