scholarly journals The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

Microbiology ◽  
2010 ◽  
Vol 156 (2) ◽  
pp. 374-384 ◽  
Author(s):  
Stijn van der Veen ◽  
Saskia van Schalkwijk ◽  
Douwe Molenaar ◽  
Willem M. de Vos ◽  
Tjakko Abee ◽  
...  
Keyword(s):  
Listeria Monocytogenes ◽  
Sos Response ◽  
Wild Type ◽  
Translesion Dna Synthesis ◽  
Transcription Profiles ◽  
Food Borne ◽  
Operator Sequence ◽  
Survival Studies ◽  
Mutant Cells ◽  
Imperfect Palindrome

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a ΔrecA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; ΔrecA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Stress-survival studies showed ΔrecA mutant cells to be less resistant to heat, H2O2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

scholarly journals Listeria monocytogenes utilizes the ClpP1/2 proteolytic machinery for fine-tuned substrate degradation under heat stress

2021 ◽  
Author(s):  
Dóra Balogh ◽  
Konstantin Eckel ◽  
Christian Fetzer ◽  
Stephan A. Sieber
Keyword(s):  
Mass Spectrometry ◽  
Listeria Monocytogenes ◽  
Elevated Temperatures ◽  
Sos Response ◽  
Wild Type ◽  
Substrate Degradation ◽  
Proteomic Approach ◽  
Different Temperatures ◽  
Cellular Pathways

Listeria monocytogenes exhibits two ClpP isoforms (ClpP1/ClpP2) which assemble into a heterooligomeric complex with enhanced proteolytic activity. Herein, we demonstrate that the formation of this complex depends on temperature and reaches a maximum ratio of about 1:1 at heat shock conditions, while almost no complex formation occurred below 4 °C. In order to decipher the role of the two isoforms at elevated temperatures, we constructed L. monocytogenes ClpP1, ClpP2 and ClpP1/2 knockout strains and analyzed their protein regulation in comparison to the wild type (WT) strain via whole proteome mass-spectrometry (MS) at 37 °C and 42 °C. While ΔclpP1 strain only altered the expression of very few proteins, ΔclpP2 and ΔclpP1/2 strains revealed the dysregulation of many proteins at both temperatures. These effects were corroborated by crosslinking co-immunoprecipitation MS analysis. Thus, while ClpP1 serves as a mere enhancer of protein degradation in the heterocomplex, ClpP2 is essential for ClpX binding and thus functions as a gatekeeper for substrate entry. Applying an integrated proteomic approach combining whole proteome and co immunoprecipitation datasets, several putative ClpP2 substrates were identified in the context of different temperatures and discussed with regards to their function in cellular pathways such as the SOS response.

scholarly journals A truncated haemoglobin implicated in oxygen metabolism by the microaerophilic food-borne pathogen Campylobacter jejuni

Microbiology ◽  
2005 ◽  
Vol 151 (12) ◽  
pp. 4079-4091 ◽  
Author(s):  
Laura M. Wainwright ◽  
Karen T. Elvers ◽  
Simon F. Park ◽  
Robert K. Poole
Keyword(s):  
Campylobacter Jejuni ◽  
Nitrosative Stress ◽  
Bacterial Pathogen ◽  
Oxygen Metabolism ◽  
Wild Type ◽  
Gene Encoding ◽  
Food Borne ◽  
Micro Organisms ◽  
Mutant Cells ◽  
Kinetics Of

Of the three groups of haemoglobins identified in micro-organisms (single-domain globins, flavohaemoglobins and truncated globins), the last group is the least well understood. The function of the truncated haemoglobin (Ctb) encoded by Cj0465c in the microaerophilic food-borne bacterial pathogen Campylobacter jejuni was investigated by constructing a ctb mutant and characterizing its phenotype. The effects of the ctb mutation on the kinetics of terminal oxidase function in C. jejuni were investigated using oxyleghaemoglobin and oxymyoglobin as sensitive reporters of O2 consumption. The V max of ctb mutant cells for O2, calculated using either globin, was greater than that of wild-type cells at extracellular O2 concentrations up to ∼1 μM, suggesting a role for Ctb in moderating O2 supply for reduction by high-affinity terminal oxidases. However, cells mutated in ctb were disadvantaged when grown under conditions of high aeration, as revealed by measurements of growth yields and rates in batch culture. Furthermore, the rate at which ctb mutant cells consumed O2 in an O2 electrode (10–200 μM O2) was approximately half the rate displayed by wild-type cells, reflecting a role for Ctb in respiration at physiologically relevant external O2 concentrations. However, a lack of sensitivity of the mutant to paraquat or H2O2 indicated that increased oxidative stress under such conditions was not the cause of these phenotypes. O2 affinities of cells (K m values of approximately 40 nM and 1 μM) were unaffected by mutation of either Ctb or the full-length C. jejuni globin, Cgb. Although the gene encoding Ctb was found to be upregulated by S-nitrosoglutathione (GSNO) and the NO-donating compound S-nitroso-N-acetylpenicillamine (SNAP), a ctb mutant did not display sensitivity to a number of nitrosative stress-generating compounds. The authors conclude that Ctb is involved in moderating O2 flux within C. jejuni.

scholarly journals The Metalloprotease of Listeria monocytogenes Is Activated by Intramolecular Autocatalysis

2007 ◽  
Vol 190 (1) ◽  
pp. 107-111 ◽  
Author(s):  
Alan Pavinski Bitar ◽  
Min Cao ◽  
Hélène Marquis
Keyword(s):  
Listeria Monocytogenes ◽  
Bacterial Pathogen ◽  
Mutant Form ◽  
Wild Type ◽  
Food Borne ◽  
Large N ◽  
N Terminus ◽  
Type Form ◽  
Wild Type Form

ABSTRACT The metalloprotease (Mpl) of Listeria monocytogenes is a thermolysin-like protease that mediates the maturation of a broad-range phospholipase C, whose function contributes to the ability of this food-borne bacterial pathogen to survive intracellularly. Mpl is made as a proprotein that undergoes maturation by proteolytic cleavage of a large N-terminal prodomain. In this study, we identified the N terminus of mature Mpl and generated Mpl catalytic mutants to investigate the mechanism of Mpl maturation. We observed that Mpl activity was a prerequisite for maturation, suggesting a mechanism of autocatalysis. Furthermore, using a strain of L. monocytogenes expressing both the wild-type form and a catalytic mutant form of Mpl simultaneously, we determined that in vivo maturation of Mpl occurs exclusively by an intramolecular autocatalysis mechanism.

The Dps-like protein Fri of Listeria monocytogenes promotes stress tolerance and intracellular multiplication in macrophage-like cells

Microbiology ◽  
2005 ◽  
Vol 151 (3) ◽  
pp. 925-933 ◽  
Author(s):  
Katja N. Olsen ◽  
Marianne H. Larsen ◽  
Cormac G. M. Gahan ◽  
Birgitte Kallipolitis ◽  
Xenia A. Wolf ◽  
...  
Keyword(s):  
Oxidative Stress ◽  
Hydrogen Peroxide ◽  
Listeria Monocytogenes ◽  
Bacterial Species ◽  
Wild Type ◽  
Gene Encoding ◽  
Iron Storage ◽  
Food Borne ◽  
Dps Protein

Members of the ferritin-like Dps protein family are found in a number of bacterial species, where they demonstrate the potential to bind iron, and have been implicated in tolerance to oxidative stress. In this study of the food-borne pathogen Listeria monocytogenes, the fri gene encoding a Dps homologue was deleted, and, compared to wild-type cells, it was found that the resulting mutant was less resistant to hydrogen peroxide, and demonstrated reduced survival following long-term (7–11 days) incubation in laboratory media. In view of this, it is shown that fri gene expression is controlled by the hydrogen peroxide regulator PerR, as well as the general stress sigma factor σ B. When fri mutant cells were transferred to iron-limiting conditions, growth was retarded relative to wild-type cells, indicating that Fri may be required for iron storage. This notion is supported by the observation that the L. monocytogenes genome appears not to encode other ferritin-like proteins. Given the role of Fri in resistance to oxidative stress, and growth under iron-limiting conditions, the ability of the fri mutant to infect mice was examined. When injected by the intraperitoneal route, the fri mutant demonstrated a reduced capacity to proliferate in the organs of infected mice relative to the wild-type, whereas when the bacteria were supplied intravenously this effect was mitigated. In addition, the mutant was impaired in its ability to survive and grow in J774.A1 mouse macrophage cells. Thus, the data suggest that Fri contributes to the ability of L. monocytogenes to survive in environments where oxidative stress and low iron availability may impede bacterial proliferation.

Ultrastructure and Morphology of the Neurospora Crassa Cell Wall Mutants, Slime And Slime X, Using Tem and Sem

1976 ◽  
Vol 34 ◽  
pp. 54-55
Author(s):  
Karen S. Howard ◽  
H. D. Braymer ◽  
M. D. Socolofsky ◽  
S. A. Milligan
Keyword(s):  
Cell Wall ◽  
Neurospora Crassa ◽  
Wild Type ◽  
Morphological Comparison ◽  
Small Areas ◽  
Solid Media ◽  
Thin Sectioning ◽  
X Cells ◽  
Mutant Cells ◽  
Isolated Cell

The recently isolated cell wall mutant slime X of Neurospora crassa was prepared for ultrastructural and morphological comparison with the cell wall mutant slime. The purpose of this article is to discuss the methods of preparation for TEM and SEM observations, as well as to make a preliminary comparison of the two mutants.TEM: Cells of the slime mutant were prepared for thin sectioning by the method of Bigger, et al. Slime X cells were prepared in the same manner with the following two exceptions: the cells were embedded in 3% agar prior to fixation and the buffered solutions contained 5% sucrose throughout the procedure.SEM: Two methods were used to prepare mutant and wild type Neurospora for the SEM. First, single colonies of mutant cells and small areas of wild type hyphae were cut from solid media and fixed with OSO4 vapors similar to the procedure used by Harris, et al. with one alteration. The cell-containing agar blocks were dehydrated by immersion in 2,2-dimethoxypropane (DMP).

Biofilm Formation and Associated Genes in Listeria Monocytogenes

2017 ◽  
Vol 12 (3) ◽  
Author(s):  
S. R. Warke ◽  
V. C. Ingle ◽  
N. V. Kurkure ◽  
P. A. Tembhurne ◽  
Minakshi Prasad ◽  
...  
Keyword(s):  
Public Health ◽  
Listeria Monocytogenes ◽  
Multiplex Pcr ◽  
Food Processing ◽  
Biofilm Formation ◽  
Milk Samples ◽  
Biofilm Production ◽  
Food Borne ◽  
Serious Infections ◽  
Microtiter Assay

Listeria monocytogenes, an opportunistic food borne pathogen can cause serious infections in immunocompromised individuals. L. monocytogenes is capable of producing biofilm on the surface of food processing lines and instruments.The biofilm transfers contamination to food products and impose risk to public health. In the present study biofilm producing ability of L. monocytogenes isolates were investigated phenotypically and genotypically by microtiter assay and multiplex PCR, respectively. Out of 38 L. monocytogenes isolates 14 were recovered from animal clinical cases, 12 bovine environment and 12 from milk samples. A total of 3 (21.42%) clinical, 2 (16.66%) environment and 3 (25%) milk samples respectively, revealed biofilm production in microtiter assay. Cumulative results showed that 23 (60.52%) out of 38 strains of L. monocytogenes were positive for luxS and flaA gene and 1 (2.63%) was positive only for the flaA gene.

scholarly journals EPHA2-dependent outcompetition of KRASG12D mutant cells by wild-type neighbors in the adult pancreas

2021 ◽  
Author(s):  
William Hill ◽  
Andreas Zaragkoulias ◽  
Beatriz Salvador-Barbero ◽  
Geraint J. Parfitt ◽  
Markella Alatsatianos ◽  
...  
Keyword(s):  
Wild Type ◽  
Mutant Cells

scholarly journals Colony spreading of the gliding bacterium Flavobacterium johnsoniae in the absence of the motility adhesin SprB

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Keiko Sato ◽  
Masami Naya ◽  
Yuri Hatano ◽  
Yoshio Kondo ◽  
Mari Sato ◽  
...  
Keyword(s):  
Soft Agar ◽  
Gliding Motility ◽  
Wild Type ◽  
Initial Cell ◽  
Flavobacterium Johnsoniae ◽  
Seeking Behavior ◽  
Colony Spreading ◽  
Gliding Bacterium ◽  
Mutant Cells ◽  
Scanning Electron

AbstractColony spreading of Flavobacterium johnsoniae is shown to include gliding motility using the cell surface adhesin SprB, and is drastically affected by agar and glucose concentrations. Wild-type (WT) and ΔsprB mutant cells formed nonspreading colonies on soft agar, but spreading dendritic colonies on soft agar containing glucose. In the presence of glucose, an initial cell growth-dependent phase was followed by a secondary SprB-independent, gliding motility-dependent phase. The branching pattern of a ΔsprB colony was less complex than the pattern formed by the WT. Mesoscopic and microstructural information was obtained by atmospheric scanning electron microscopy (ASEM) and transmission EM, respectively. In the growth-dependent phase of WT colonies, dendritic tips spread rapidly by the movement of individual cells. In the following SprB-independent phase, leading tips were extended outwards by the movement of dynamic windmill-like rolling centers, and the lipoproteins were expressed more abundantly. Dark spots in WT cells during the growth-dependent spreading phase were not observed in the SprB-independent phase. Various mutations showed that the lipoproteins and the motility machinery were necessary for SprB-independent spreading. Overall, SprB-independent colony spreading is influenced by the lipoproteins, some of which are involved in the gliding machinery, and medium conditions, which together determine the nutrient-seeking behavior.

scholarly journals Targeting the DNA replication stress phenotype of KRAS mutant cancer cells

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tara Al Zubaidi ◽  
O. H. Fiete Gehrisch ◽  
Marie-Michelle Genois ◽  
Qi Liu ◽  
Shan Lu ◽  
...  
Keyword(s):  
Dna Replication ◽  
Single Molecule ◽  
Replication Stress ◽  
Proton Radiation ◽  
Wild Type ◽  
Cellular Effects ◽  
Proton Treatment ◽  
Dna Replication Stress ◽  
Fork Stalling ◽  
Mutant Cells

AbstractMutant KRAS is a common tumor driver and frequently confers resistance to anti-cancer treatments such as radiation. DNA replication stress in these tumors may constitute a therapeutic liability but is poorly understood. Here, using single-molecule DNA fiber analysis, we first characterized baseline replication stress in a panel of unperturbed isogenic and non-isogenic cancer cell lines. Correlating with the observed enhanced replication stress we found increased levels of cytosolic double-stranded DNA in KRAS mutant compared to wild-type cells. Yet, despite this phenotype replication stress-inducing agents failed to selectively impact KRAS mutant cells, which were protected by CHK1. Similarly, most exogenous stressors studied did not differentially augment cytosolic DNA accumulation in KRAS mutant compared to wild-type cells. However, we found that proton radiation was able to slow fork progression and preferentially induce fork stalling in KRAS mutant cells. Proton treatment also partly reversed the radioresistance associated with mutant KRAS. The cellular effects of protons in the presence of KRAS mutation clearly contrasted that of other drugs affecting replication, highlighting the unique nature of the underlying DNA damage caused by protons. Taken together, our findings provide insight into the replication stress response associated with mutated KRAS, which may ultimately yield novel therapeutic opportunities.

Yeast dom34 Mutants Are Defective in Multiple Developmental Pathways and Exhibit Decreased Levels of Polyribosomes

Genetics ◽  
1998 ◽  
Vol 149 (1) ◽  
pp. 45-56
Author(s):  
Luther Davis ◽  
JoAnne Engebrecht
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Cell Cycle ◽  
Heterologous Expression ◽  
Protein Translation ◽  
Developmental Pathways ◽  
G1 Phase ◽  
Growth Defect ◽  
Wild Type ◽  
Drosophila Homolog ◽  
Mutant Cells

Abstract The DOM34 gene of Saccharomyces cerevisiae is similar togenes found in diverse eukaryotes and archaebacteria. Analysis of dom34 strains shows that progression through the G1 phase of the cell cycle is delayed, mutant cells enter meiosis aberrantly, and their ability to form pseudohyphae is significantly diminished. RPS30A, which encodes ribosomal protein S30, was identified in a screen for high-copy suppressors of the dom34Δ growth defect. dom34Δ mutants display an altered polyribosome profile that is rescued by expression of RPS30A. Taken together, these data indicate that Dom34p functions in protein translation to promote G1 progression and differentiation. A Drosophila homolog of Dom34p, pelota, is required for the proper coordination of meiosis and spermatogenesis. Heterologous expression of pelota in dom34Δ mutants restores wild-type growth and differentiation, suggesting conservation of function between the eukaryotic members of the gene family.

Sign in / Sign up

Export Citation Format

Share Document