scholarly journals Induction of a DNA Nickase in the Presence of Its Target Site Stimulates Adaptive Mutation in Escherichia coli

2002 ◽  
Vol 184 (20) ◽  
pp. 5599-5608 ◽  
Author(s):  
Cesar Rodriguez ◽  
Joshua Tompkin ◽  
Jill Hazel ◽  
Patricia L. Foster
Keyword(s):  
Escherichia Coli ◽  
Single Strand ◽  
Target Site ◽  
Adaptive Mutation ◽  
Target Sequence ◽  
Induced Mutations ◽  
Single Base ◽  
Adaptive Mutations ◽  
E Coli ◽  
Nicking Enzyme

ABSTRACT Adaptive mutation to Lac+ in Escherichia coli strain FC40 depends on recombination functions and is enhanced by the expression of conjugal functions. To test the hypothesis that the conjugal function that is important for adaptive mutation is the production of a single-strand nick at the conjugal origin, we supplied an exogenous nicking enzyme, the gene II protein (gIIp) of bacteriophage f1, and placed its target sequence near the lac allele. When both gIIp and its target site were present, adaptive mutation was stimulated three- to fourfold. Like normal adaptive mutations, gIIp-induced mutations were recA+ and ruvC+ dependent and were mainly single-base deletions in runs of iterated bases. In addition, gIIp with its target site could substitute for conjugal functions in adaptive mutation. These results support the hypothesis that nicking at the conjugal origin initiates the recombination that produces adaptive mutations in this strain of E. coli, and they suggest that nicking may be the only conjugal function required for adaptive mutation.

scholarly journals Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

2015 ◽  
Author(s):  
◽  
Blanca Estela Chavez-Sandoval
Keyword(s):  
Escherichia Coli ◽  
Good Alternative ◽  
Noble Metal Nanoparticles ◽  
Biological Synthesis ◽  
Target Sequence ◽  
Inorganic Synthesis ◽  
Fish Farms ◽  
E Coli ◽  
Synthesis Of Nanomaterials

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

scholarly journals RNA minihelices as model substrates for ATP/CTP:tRNA nucleotidyltransferase

1997 ◽  
Vol 327 (3) ◽  
pp. 847-851 ◽  
Author(s):  
Zengji LI ◽  
Yue SUN ◽  
L. David THURLOW
Keyword(s):  
Escherichia Coli ◽  
Saccharomyces Cerevisiae ◽  
Three Dimensional ◽  
Dimensional Structure ◽  
Single Base ◽  
Three Dimensional Structure ◽  
E Coli ◽  
Base Identity

Twenty-one RNA minihelices, resembling the coaxially stacked acceptor- /T-stems and T-loop found along the top of a tRNA's three-dimensional structure, were synthesized and used as substrates for ATP/CTP:tRNA nucleotidyltransferases from Escherichia coli and Saccharomyces cerevisiae. The sequence of nucleotides in the loop varied at positions corresponding to residues 56, 57 and 58 in the T-loop of a tRNA. All minihelices were substrates for both enzymes, and the identity of bases in the loop affected the interaction. In general, RNAs with purines in the loop were better substrates than those with pyrimidines, although no single base identity absolutely determined the effectiveness of the RNA as substrate. RNAs lacking bases near the 5ʹ-end were good substrates for the E. coli enzyme, but were poor substrates for that from yeast. The apparent Km values for selected minihelices were 2-3 times that for natural tRNA, and values for apparent Vmax were lowered 5-10-fold.

scholarly journals Adaptive Mutagenesis at ebgR Is Regulated by PhoPQ

1998 ◽  
Vol 180 (11) ◽  
pp. 2862-2865 ◽  
Author(s):  
Barry G. Hall
Keyword(s):  
Escherichia Coli ◽  
Salmonella Typhimurium ◽  
Error Correction ◽  
Regulatory System ◽  
Adaptive Mutation ◽  
Adaptive Mutagenesis ◽  
Adaptive Mutations ◽  
Nutritional Deprivation ◽  
Two Component ◽  
Stress Signals

ABSTRACT Adaptive mutations are mutations that occur in nondividing or very slowly dividing microbial cells during prolonged nonlethal selection and that are specific to the challenge of the selection in the sense that the only mutations that can be detected are those that provide a growth advantage to the cell. The phoPQ genes encode a two-component positively acting regulatory system that controls expression of at least 25 to 30 genes in Escherichia coliand Salmonella typhimurium. PhoPQ responds to a variety of environmental stress signals including Mg2+ starvation and nutritional deprivation. Here I show that disruption ofphoP or phoQ by Tn10dCam significantly reduces the adaptive mutation rate to ebgR, indicating that the adaptive mutagenesis machinery is regulated, directly or indirectly, byphoPQ. The finding that it is regulated implies that adaptive mutagenesis does not simply result from a failure of various error correction mechanisms during prolonged starvation.

scholarly journals Comparative Structure-Function Analysis of Mannose-Specific FimH Adhesins from Klebsiella pneumoniae and Escherichia coli

2009 ◽  
Vol 191 (21) ◽  
pp. 6592-6601 ◽  
Author(s):  
Steen G. Stahlhut ◽  
Veronika Tchesnokova ◽  
Carsten Struve ◽  
Scott J. Weissman ◽  
Sujay Chattopadhyay ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Klebsiella Pneumoniae ◽  
Function Analysis ◽  
Bacterial Species ◽  
Host Cells ◽  
Structural Basis ◽  
Adaptive Mutation ◽  
Single Mutation ◽  
Dependent Manner ◽  
E Coli

ABSTRACT FimH, the adhesive subunit of type 1 fimbriae expressed by many enterobacteria, mediates mannose-sensitive binding to target host cells. At the same time, fine receptor-structural specificities of FimH from different species can be substantially different, affecting bacterial tissue tropism and, as a result, the role of the particular fimbriae in pathogenesis. In this study, we compared functional properties of the FimH proteins from Escherichia coli and Klebsiella pneumoniae, which are both 279 amino acids in length but differ by some ∼15% of residues. We show that K. pneumoniae FimH is unable to mediate adhesion in a monomannose-specific manner via terminally exposed Manα(1-2) residues in N-linked oligosaccharides, which are the structural basis of the tropism of E. coli FimH for uroepithelial cells. However, K. pneumoniae FimH can bind to the terminally exposed Manα(1-3)Manβ(1-4)GlcNAcβ1 trisaccharide, though only in a shear-dependent manner, wherein the binding is marginal at low shear force but enhanced sevenfold under increased shear. A single mutation in the K. pneumoniae FimH, S62A, converts the mode of binding from shear dependent to shear independent. This mutation has occurred naturally in the course of endemic circulation of a nosocomial uropathogenic clone and is identical to a pathogenicity-adaptive mutation found in highly virulent uropathogenic strains of E. coli, in which it also eliminates the dependence of E. coli binding on shear. The shear-dependent binding properties of the K. pneumoniae and E. coli FimH proteins are mediated via an allosteric catch bond mechanism. Thus, despite differences in FimH structure and fine receptor specificity, the shear-dependent nature of FimH-mediated adhesion is highly conserved between bacterial species, supporting its remarkable physiological significance.

scholarly journals Two Enzymes, Both of Which Process Recombination Intermediates, Have Opposite Effects on Adaptive Mutation in Escherichia coli

Genetics ◽  
1996 ◽  
Vol 142 (1) ◽  
pp. 25-37 ◽  
Author(s):  
Patricia L Foster ◽  
Jeffrey M Trimarchi ◽  
Russell A Maurer
Keyword(s):  
Escherichia Coli ◽  
Holliday Junctions ◽  
High Rate ◽  
Adaptive Mutation ◽  
Adaptive Mutations ◽  
Mutagenic Process

Reversion of a lac  – frameshift allele carried on an F′ episome in Escherichia coli occurs at a high rate when the cells are placed under lactose selection. Unlike Lac+ mutations that arise during nonselective growth, the production of these adaptive mutations requires the RecA-RecBCD pathway for recombination. In this report, we show that enzymes that process recombination intermediates are involved in the mutagenic process. RuvAB and RecG, E. coli’s two enzymes for translocating Holliday junctions, have opposite effects: RuvAB is required for RecA-dependent adaptive mutations, whereas RecG inhibits them.

scholarly journals The antimutagenic effect of monoterpenes against UV-irradiation-, 4NQO- and t-BOOH-induced mutagenesis in coli

2011 ◽  
Vol 63 (1) ◽  
pp. 117-128 ◽  
Author(s):  
Biljana Nikolic ◽  
Dragana Mitic-Culafic ◽  
Branka Vukovic-Gacic ◽  
Jelena Knezevic-Vukcevic
Keyword(s):  
Escherichia Coli ◽  
Dna Repair ◽  
Uv Irradiation ◽  
Mutagenic Effect ◽  
Evolutionary Conservation ◽  
Induced Mutations ◽  
Mutagenic Potential ◽  
E Coli ◽  
Antimutagenic Effect ◽  
Induced Mutagenesis

The aim of this work was to investigate the antimutagenic potential of monoterpenes from sage and basil in Escherichia coli. The mutagenic potential of monoterpenes was pre-screened with Salmonella/microsome reversion assay in strain TA100 and no mutagenic effect was detected. The antimutagenic potential against UV- 4NQO- and t-BOOH induced mutagenesis was evaluated in E. coli K12 and E. coli WP2 by reversion assays. The obtained results indicate that camphor and thujone reduce UV- and 4NQO-induced mutations; myrcene reduces t-BOOH-induced mutations, while eucalyptol and linalool reduce mutagenicity by all tested mutagens. Considering evolutionary conservation of DNA repair and antioxidative protection, the obtained results indicate that further antigenotoxicity studies should be undertaken in eukaryotes.

scholarly journals Biofunctionalization of Cork with Moringa oleifera Seeds and Use of PMA Staining and qPCR to Detect Viability of Escherichia coli

Water ◽  
2021 ◽  
Vol 13 (19) ◽  
pp. 2731
Author(s):  
Nury Infante ◽  
Refugio Rodríguez ◽  
Yaneth Bartolo ◽  
Olga Sánchez ◽  
Isabel Sanz ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Moringa Oleifera ◽  
Antibacterial Properties ◽  
Fractional Factorial ◽  
Target Sequence ◽  
Lacz Gene ◽  
Bacterial Reduction ◽  
E Coli ◽  
Polymerase Chain ◽  
Seed Extracts

Cork matrices biofunctionalized with Moringa oleifera seed extracts (MoSe) have potential for use as a biofilter with antibacterial properties to reduce waterborne pathogens. The aim of this study was to evaluate the effect of cork biofunctionalized with active antimicrobial compounds of MoSe (f-cork) on the inhibition of Escherichia coli (InhEc). The LacZ gene from a strain of E. coli was used as the target sequence using viability quantification Polymerase Chain Reaction (qPCR) and differentiation of viable and dead bacteria through selective cell viability PMA staining. To perform this, a 27−4 fractional factorial design and a biofiltration system were used to evaluate the effect of the active protein in MoSe immobilized in granulated cork on InhEc. We found that the potential for antimicrobial activity increased with f-cork for an effective maximal bacterial reduction (99.99%; p < 0.05). The effect of f-cork functionalized with MoSe on E. coli viability was of 0.024% and 0.005% for the cells exposed to PMA, respectively, being the relevant conditions in treatment 2: (0 L/min) without aeration, (5%) MoSe and (5 mm) cork particle. In conclusion, the f-cork functionalized with MoSe presented biosorbent and antibacterial properties that effectively reduced the E. coli growth.

scholarly journals Evidence for frameshift mutations in the hisH gene of Escherichia coli causing synthesis of a partially active glutamine amidotransferase.

Genetics ◽  
1988 ◽  
Vol 120 (3) ◽  
pp. 657-665
Author(s):  
F W Pons ◽  
U Neubert ◽  
P Müller
Keyword(s):  
Escherichia Coli ◽  
Gene Product ◽  
Distal Part ◽  
Distal Region ◽  
Complementation Analysis ◽  
Induced Mutations ◽  
Frameshift Mutations ◽  
E Coli ◽  
Glutamine Amidotransferase

Abstract Among eight strains carrying acridine-induced mutations in hisH, five which mapped at four different sites in the promoter-distal region of the gene showed His+ phenotypes on media containing a purine. By complementation analysis, hisH enzyme was shown to be required for growth on purines. Purine-sensitive His+ revertants of strains able to grow on purines carried second-site mutations which in one case could be shown to map in hisG. Strains able to grow on purines were able to grow on 2-thiazolyl-DL-alanine, too. We conclude that frameshift mutations in the promoter-distal part of the hisH gene of E. coli do not completely abolish the activity of the gene product.

scholarly journals IS103, a new insertion element in Escherichia coli: characterization and distribution in natural populations.

Genetics ◽  
1989 ◽  
Vol 121 (3) ◽  
pp. 423-431 ◽  
Author(s):  
B G Hall ◽  
L L Parker ◽  
P W Betts ◽  
R F DuBose ◽  
S A Sawyer ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Copy Number ◽  
Insertion Sequence ◽  
Natural Populations ◽  
Single Copy ◽  
Target Sequence ◽  
Wild Type ◽  
Insertion Element ◽  
E Coli ◽  
Natural Isolates

Abstract IS103 is a previously unknown insertion sequence found in Escherichia coli K12. We have sequenced IS103 and find that it is a 1441-bp element that consists of a 1395-bp core flanked by imperfect 23-bp inverted repeats. IS103 causes a 6-bp duplication of the target sequence into which it inserts. There is a single copy of IS103 present in wild-type E. coli K12 strain HfrC. In strain X342 and its descendents there are two additional copies, one of which is located within the bglF gene. IS103 is capable of excising from within bglF and restoring function of that gene. IS103 exhibits 44% sequence identity with IS3, suggesting that the two insertion sequences are probably derived from a common ancestor. We have examined the distribution of IS103 in the chromosomes and plasmids of the ECOR collection of natural isolates of E. coli. IS103 is found in 36 of the 71 strains examined, and it strongly tends to inhabit plasmids rather than chromosomes. Comparison of the observed distribution of IS103 with distributions predicted by nine different models for the regulation of transposition according to copy number and of the effects of copy number on fitness suggest that transposition of IS103 is strongly regulated and that it has only minor effects on fitness. The strong clustering of IS103 within one phylogenetic subgroup of the E. coli population despite its presence on plasmids suggests that plasmids tend to remain within closely related strains and that transfer to distantly related strains is inhibited.

scholarly journals Mutations that improve efficiency of a weak-link enzyme are rare compared to adaptive mutations elsewhere in the genome

eLife ◽  
2019 ◽  
Vol 8 ◽  
Author(s):  
Andrew B Morgenthaler ◽  
Wallis R Kinney ◽  
Christopher C Ebmeier ◽  
Corinne M Walsh ◽  
Daniel J Snyder ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Metabolic Pathway ◽  
Weak Link ◽  
Experimental Studies ◽  
Wild Type ◽  
Gene Encoding ◽  
Evolutionary Trajectory ◽  
Adaptive Mutations ◽  
E Coli ◽  
Essential Function

New enzymes often evolve by gene amplification and divergence. Previous experimental studies have followed the evolutionary trajectory of an amplified gene, but have not considered mutations elsewhere in the genome when fitness is limited by an evolving gene. We have evolved a strain of Escherichia coli in which a secondary promiscuous activity has been recruited to serve an essential function. The gene encoding the ‘weak-link’ enzyme amplified in all eight populations, but mutations improving the newly needed activity occurred in only one. Most adaptive mutations occurred elsewhere in the genome. Some mutations increase expression of the enzyme upstream of the weak-link enzyme, pushing material through the dysfunctional metabolic pathway. Others enhance production of a co-substrate for a downstream enzyme, thereby pulling material through the pathway. Most of these latter mutations are detrimental in wild-type E. coli, and thus would require reversion or compensation once a sufficient new activity has evolved.

Sign in / Sign up

Export Citation Format

Share Document