scholarly journals Detection of the RNA for new multicomponent virus in patients with Crimean-Congo hemorrhagic fever in southern Russia

2020 ◽  
Author(s):  
Vladimir Ternovoi ◽  
Anastasia Gladysheva ◽  
Alexandra Sementsova ◽  
Anna Zaykovskaya ◽  
Anna Volynkina ◽  
...  
Keyword(s):  
Phylogenetic Analyses ◽  
Hemorrhagic Fever ◽  
European Part ◽  
Viral Rna ◽  
Crimean Congo Hemorrhagic Fever ◽  
Viral Genomes ◽  
Cchf Virus ◽  
European Part Of Russia ◽  
Human Sera ◽  
Southern Russia

Background: Recently, a new multicomponent RNA-containing virus was described and called as Jingmen tick virus (JMTV) supposedly belonging to flaviviruses. A virus consists of four viral particles and JMTV was firstly isolated from ticks in China and South America. Aims: Detection viral RNA specific for JMTV complex, sequencing genome fragments and taxonomy identification novel virus from JMTV complex in patients with Crimean-Congo hemorrhagic fever (CCHF) from southern European part of Russia. Materials and methods: Panel of 20 randomly selected sera from patients with confirmed Crimean-Congo hemorrhagic fever was collected in 2016 and was used for detection JMTV and CCHF viral RNA by PCR with experimental primers. Subsequent sequencing of isolated fragments of viral genomes was used for identification JMTV and CCHF virus genetic materials and phylogenetic analyses. Results: The viral RNAs of the CCHF virus and JMTV were detected in blood of four patients. Sequencing of the isolated PCR fragment of S segment CCHF virus allowed identifying these RNA isolates as Europe 1 lineage, subgroups Va and Vb of the CCHF virus that is a typical for the southern European part of the Russia. The nucleotide sequences of segment 2 (GP glycoprotein) of the JMTV were also detected by RP PCR and sequencing in these human sera. The new JMTV isolates were clustered together by phylogenetic analysis. The level of nucleotide identity for newly discovered JMTV isolates was only about 81-82% with comparison to the previously described European variants (Kosovo) of the JMTV. Conclusions: The results suggest that viral genomic RNA for new multicomponent flavivirus named as Manych virus and related to the JMTV complex was discovered in sera of CCHF patients in Russia.

scholarly journals Genetic Monitoring of Crimean-Congo Hemorrhagic Fever Virus in the South of the European Part of Russia

2012 ◽  
pp. 80-85 ◽  
Author(s):  
A. S. Volynkina ◽  
A. N. Kulichenko
Keyword(s):  
Genetic Variants ◽  
Hemorrhagic Fever ◽  
Nucleotide Sequences ◽  
European Part ◽  
Clinical Samples ◽  
Virus Variant ◽  
Hemorrhagic Fever Virus ◽  
Cchf Virus ◽  
European Part Of Russia ◽  
First Time

Presented are the results of gene-typing of CCHF virus detected in clinical samples from CHF patients from the Stavropol, Rostov and Astrakhan Regions in 2011. For 28 samples determined are nucleotide sequences of the fragments 115–652 (S segment) and fragments 984–1469 (M segment). Philogenetic analysis of these nucleotide sequences demonstrated that typical strains circulated in 2011 in the regions under surveillance, importation of the new genetic variants of the virus did not take place. CCHF virus variant affiliated to the subgroup “Astrakhan-2” was detected in the clinical samples for the first time and characterized for its genome S- and M-segment fragments.

scholarly journals Serologic and molecular evidence for circulation of Crimean-Congo hemorrhagic fever virus in ticks and cattle in Zambia

2021 ◽  
Vol 15 (6) ◽  
pp. e0009452
Author(s):  
Masahiro Kajihara ◽  
Martin Simuunza ◽  
Ngonda Saasa ◽  
George Dautu ◽  
Akina Mori-Kajihara ◽  
...  
Keyword(s):  
Phylogenetic Analyses ◽  
Case Fatality ◽  
Hemorrhagic Fever ◽  
Epidemiologic Studies ◽  
Immunofluorescence Assay ◽  
Molecular Evidence ◽  
African Countries ◽  
Crimean Congo Hemorrhagic Fever ◽  
Hemorrhagic Fever Virus ◽  
Cchf Virus

Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne zoonosis with a high case fatality rate in humans. Although the disease is widely found in Africa, Europe, and Asia, the distribution and genetic diversity of CCHF virus (CCHFV) are poorly understood in African countries. To assess the risks of CCHF in Zambia, where CCHF has never been reported, epidemiologic studies in cattle and ticks were conducted. Through an indirect immunofluorescence assay, CCHFV nucleoprotein-specific serum IgG was detected in 8.4% (88/1,047) of cattle. Among 290 Hyalomma ticks, the principal vector of CCHFV, the viral genome was detected in 11 ticks. Phylogenetic analyses of the CCHFV S and M genome segments revealed that one of the detected viruses was a genetic reassortant between African and Asian strains. This study provides compelling evidence for the presence of CCHFV in Zambia and its transmission to vertebrate hosts.

scholarly journals Epidemiological Situation on Crimean-Congo Hemorrhagic Fever in the Russian Federation in 2019 and Forecast for 2020

2020 ◽  
pp. 14-20
Author(s):  
A. S. Volynkina ◽  
E. S. Kotenev ◽  
O. V. Maletskaya ◽  
O. N. Skudareva ◽  
L. I. Shaposhnikova ◽  
...  
Keyword(s):  
Russian Federation ◽  
Hemorrhagic Fever ◽  
The South ◽  
Natural Focus ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus ◽  
European Part Of Russia ◽  
Federal Districts ◽  
The Russian Federation ◽  
Epidemiological Situation

The review presents an analysis of epidemic and epizootic situation of Crimean-Congo hemorrhagic fever in the Russian Federation in 2010–2019, summarizes the results of epizootiological monitoring of the CCHF natural focus territory in the south of European part of Russia. An unfavorable epidemiological situation regarding CCHF is maintained in the Russian Federation. In 2010–2019, 999 CCHF cases were registered in nine regions of Southern and North-Caucasian Federal Districts. In 2019, an increase in the CCHF incidence level in the entities of the SFD and NCFD was observed as compared to 2017–2018. The expansion of the territory with registered epidemic manifestations of CCHF continues. In 2010–2019, the number of imago and pre-imaginal phases of Hyalomma marginatum – the main vector of the CCHF virus in Russia, remained consistently high. High numbers of H. marginatum ticks and their CCHFV infection rates can contribute to the development of an unfavorable epidemiological situation in the south of the Russian Federation with a possible increase in the CCHF incidence in 2020.

scholarly journals Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tahmineh Jalali ◽  
Mostafa Salehi-Vaziri ◽  
Mohammad Hassan Pouriayevali ◽  
Seyed Latif Mousavi Gargari
Keyword(s):  
Point Of Care ◽  
Hemorrhagic Fever ◽  
Diagnostic Methods ◽  
Clinical Samples ◽  
Crimean Congo Hemorrhagic Fever ◽  
Point Of Care Test ◽  
Specificity And Sensitivity ◽  
Rural And Remote Areas ◽  
Cchf Virus ◽  
Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Virus-derived DNA forms mediate the persistent infection of tick cells by Hazara virus and Crimean-Congo hemorrhagic fever virus

2021 ◽  
Author(s):  
Maria Vittoria Salvati ◽  
Claudio Salaris ◽  
Vanessa Monteil ◽  
Claudia Del Vecchio ◽  
Giorgio Palù ◽  
...  
Keyword(s):  
Viral Replication ◽  
Cell Lines ◽  
Persistent Infection ◽  
Hemorrhagic Fever ◽  
Viral Reservoir ◽  
Tick Cell ◽  
Infected Tick ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus ◽  
Model Virus

Crimean-Congo hemorrhagic fever (CCHF) is a severe disease of humans caused by CCHF virus (CCHFV), a biosafety level (BSL)-4 pathogen. Ticks of the genus Hyalomma are the viral reservoir and they represent the main vector transmitting the virus to its hosts during blood feeding. We have previously shown that CCHFV can persistently infect Hyalomma -derived tick cell lines. However, the mechanism allowing the establishment of persistent viral infections in ticks is still unknown. Hazara virus (HAZV) can be used as a BSL-2 model virus instead of CCHFV to study virus/vector interactions. To investigate the mechanism behind the establishment of a persistent infection, we developed an in vitro model with Hyalomma -derived tick cell lines and HAZV. As expected, HAZV, like CCHFV, persistently infects tick cells without any sign of cytopathic effect, and the infected cells can be cultured for more than three years. Most interestingly, we demonstrated the presence of short viral-derived DNA forms (vDNAs) after HAZV infection. Furthermore, we demonstrated that the antiretroviral drug AZT could inhibit the production of vDNAs, suggesting that vDNAs are produced by an endogenous retrotranscriptase activity in tick cells. Moreover, we collected evidence that vDNAs are continuously synthesized, thereby downregulating viral replication to promote cell survival. Finally, vDNAs were also detected in CCHFV-infected tick cells. In conclusion, vDNA synthesis might represent a strategy to control the replication of RNA viruses in ticks allowing their persistent infection. IMPORTANCE Crimean-Congo hemorrhagic fever (CCHF) is an emerging tick-borne viral disease caused by CCHF virus (CCHFV). Ticks of the genus Hyalomma can be persistently infected with CCHFV representing the viral reservoir, and the main vector for viral transmission. Here we showed that tick cells infected with Hazara virus, a nonpathogenic model virus closely related to CCHFV, contained short viral-derived DNA forms (vDNAs) produced by endogenous retrotranscriptase activity. vDNAs are transitory molecules requiring viral RNA replication for their continuous synthesis. Interestingly, vDNA synthesis seemed to be correlated with downregulation of viral replication and promotion of tick cell viability. We also detected vDNAs in CCHFV-infected tick cells suggesting that they could represent a key element in the cell response to nairovirus infection and might represent a more general mechanism of innate immunity against RNA viral infection.

scholarly journals The Distribution of Puumala orthohantavirus Genome Variants Correlates with the Regional Landscapes in the Trans-Kama Area of the Republic of Tatarstan

Pathogens ◽  
2021 ◽  
Vol 10 (9) ◽  
pp. 1169
Author(s):  
Yuriy N. Davidyuk ◽  
Emmanuel Kabwe ◽  
Anton F. Shamsutdinov ◽  
Anna V. Knyazeva ◽  
Ekaterina V. Martynova ◽  
...  
Keyword(s):  
Bank Vole ◽  
Phylogenetic Analyses ◽  
Genetic Material ◽  
Hemorrhagic Fever ◽  
Federal District ◽  
Genetic Lineage ◽  
Bank Voles ◽  
European Part Of Russia ◽  
The Republic ◽  
River Valleys

In the European part of Russia, the highest number of hemorrhagic fever with renal syndrome (HFRS) cases are registered in the Volga Federal District (VFD), which includes the Republic of Tatarstan (RT). Puumala orthohantavirus (PUUV) is the main causative agent of HFRS identified in the RT. The goal of the current study is to analyze the genetic variations of the PUUV strains and possible presence of chimeric and reassortant variants among the PUUV strains circulating in bank vole populations in the Trans-Kama area of the RT. Complete S segment CDS as well as partial M and L segment coding nucleotide sequences were obtained from 40 PUUV-positive bank voles and used for the analysis. We found that all PUUV strains belonged to RUS genetic lineage and clustered in two subclades corresponding to the Western and Eastern Trans-Kama geographic areas. PUUV strains from Western Trans-Kama were related to the previously identified strain from Teteevo in the Pre-Kama area. It can be suggested that the PUUV strains were introduced to the Teteevo area as a result of the bank voles’ migration from Western Trans-Kama. It also appears that physical obstacles, including rivers, could be overcome by migrating rodents under favorable circumstances. Based on results of the comparative and phylogenetic analyses, we propose that bank vole distribution in the Trans-Kama area occurred upstream along the river valleys, and that watersheds could act as barriers for migrations. As a result, the diverged PUUV strains could be formed in closely located populations. In times of extensive bank vole population growth, happening every 3–4 years, some regions of watersheds may become open for contact between individual rodents from neighboring populations, leading to an exchange of the genetic material between divergent PUUV strains.

DEVELOPMENT AND ASSESSMENT OF A REAGENT KIT FOR RNA DETECTION OF CRIMEAN-CONGO HEMORRHAGIC FEVER VIRUS WITH USING REVERSE TRANSCRIPTION LOOP-MEDIATED ISOTHERMAL AMPLIFICATION METHOD

2019 ◽  
Vol 64 (9) ◽  
pp. 571-577
Author(s):  
V. A. Ternovoi ◽  
Yu. V. Kononova ◽  
A. V. Zaykovskaya ◽  
E. V. Chub ◽  
A. S. Volynkina ◽  
...  
Keyword(s):  
Reverse Transcription ◽  
High Speed ◽  
Hemorrhagic Fever ◽  
Fever Virus ◽  
Isothermal Amplification ◽  
Viral Rna ◽  
Rna Detection ◽  
Crimean Congo Hemorrhagic Fever ◽  
Loop Mediated Isothermal Amplification ◽  
Hemorrhagic Fever Virus

This study presents the results of laboratory trials of the reagent kit for the rapid detection of RNA of the Crimean-Congo hemorrhagic fever virus (CCHFV) using loop-mediated isothermal amplification with reverse transcription (RT-LAMP). The developed RT-LAMP reagent kit was used to detect the CCHFV and showed a sensitivity of 103 GE/ml of viral RNA, which is sufficient for detection of the CCHFV in the early stage of human infections. The kit showed high specificity and no cross-reactivity with viral panel from the State collection of viruses of the FBRI SRC VB «Vector» (arboviruses and hemorrhagic fever viruses). Laboratory trials of the RT-LAMP kit are showed a high analytical and diagnostic sensitivity and specificity for RNA detection of the CCHFV and high speed of the analysis (60-70 min with sample preparation) compared to real-time PCR. Approbation of the kit field version has showed the possibility of setting the RT-LAMP reaction and viral RNA detection without the using of analytical equipments.

scholarly journals Epidémiologie de la fièvre Hémorragique de Crimée-Congo (FHCC) chez les bovins dans le département de Boboye au Niger

2020 ◽  
Vol 14 (3) ◽  
pp. 698-705
Author(s):  
Alima Maïna ◽  
Abdoulkarim Issa Ibrahim ◽  
Abdou Alassane ◽  
Hassane Adakal
Keyword(s):  
Immunosorbent Assay ◽  
Disease Transmission ◽  
Local Governments ◽  
Indirect Elisa ◽  
Hemorrhagic Fever ◽  
Elisa Test ◽  
Enzyme Linked Immunosorbent Assay ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus ◽  
Made In

La distribution et la dynamique des populations des tiques est un élément clé dans la connaissance des maladies transmises par ces vecteurs. C’est ainsi que cette étude a été conduite afin de mieux connaître l’épidémiologie de la Fièvre Hémorragique de Crimée-Congo (FHCC) dans les 8 communes du département de Boboye au Niger, où 355 sérums de bovins ont été collectés. En plus des sérums, des tiques ont été collectées sur 144 bovins, soit 18 par commune. Les sérums ont été soumis à un test ELISA (Enzyme Linked Immunosorbent Assay) indirect pour la détection d’anticorps anti-FHCC. Soixante-douze (72) éleveurs ont été interviewés sur leur connaissance de l’écologie des tiques, vecteurs du virus de la FHCC. Les résultats de l’enquête ont révélé que les éleveurs n’ont pas recours aux acaricides et que, dans leur majorité (55/72 soit 76,4 %), ils pratiquent la transhumance. L’étude a permis l’identification de 1342 tiques réparties en trois genres : Hyalomma (91,7%), Amblyomma (5,7%) et Rhipicephalus (Boophilus) (2,6%). La séroprévalence globale a été de 9,1±0,03%. Les communes de Harikanassou et Kiota ont été celles où les fortes prévalences ont été observées de 26,7 ± 12,9% et 22,5 ±12,9%. Le virus de la FHCC est en circulation chez la population animale, alors des investigations doivent être faites chez la population humaine.Mots clés : Anticorps anti-FHCC, Enzyme Linked Immunosorbent Assay Indirecte, Prévalence, Sérums, Tiques.   English Title: Crimean-Congo Hemorrhagic Fever (CCHF) ’s Epidemiology in cattle in Boboye’s department of Niger Republic To understand disease transmission by ticks, knowledge of population dynamics and distribution of these vectors are essentials. To sought that, the epidemiology of Crimean-Congo Hemorrhagic Fever (CCHF) in Niger Republic was studied by sampling 355 bovines (sera and ticks) in eight (8) local governments in Boboye’s department. Eighteen (18) bovines were sampled for ticks collection per local government making them a total of 144 bovine. Indirect ELISA test (enzyme-linked immunosorbent assay) was used to detect anti- CCHF antibodies. Seventy-two (72) farmers were surveyed on their knowledge on ticks’ ecology, main vectors of CCHF virus. The results revealed that farmers are not using acaricides, and their majority (55/72 thus 76.4%) practice Transhumance. The study allowed the identification of 1342 ticks distributed in 3 genus: Hyalomma (91.7%), Amblyomma (5.7%) and Rhipicephalus (Boophilus) (2.6%). The global seroprevalence against CCHF was (9.1 ± 0.03) %. Harikanassou and Kiota were the most affected local governments with respectively (26.7±12.9) % and (22.5±12,9) % prevalence. CCHV virus is circulating in animal population, so investigations must be made in human population. Keywords: Anti-CCHF antibodies, Indirect Enzyme Linked Immunosorbent Assay, Prevalence, Sera, Ticks.

scholarly journals Molecular Assay on Detection of Crimean Congo Hemorrhagic Fever (CCHF) Virus in Ixodid Ticks Collected from Livestock in Slaughterhouse from South of Iran

2020 ◽  
Author(s):  
Mostafa Salehi-Vaziri ◽  
Hassan Vatandoos ◽  
Alireza Sanei-Dehkordi ◽  
Mehdi Fazlalipour ◽  
Mohammad Hassan Pouriayevali ◽  
...  
Keyword(s):  
Tick Infestation ◽  
Hemorrhagic Fever ◽  
The Body ◽  
Ixodid Ticks ◽  
Public Health Issue ◽  
Hard Tick ◽  
Crimean Congo Hemorrhagic Fever ◽  
Hard Ticks ◽  
Slaughter House ◽  
Cchf Virus

Background: Ticks are vectors of a wide variety of pathogens that can be transmitted to humans, and tick-borne diseas­es are a significant public health issue worldwide. The present study was carried out on the hard tick infestation of live­stock transported to Rafsanjan slaughter house in the southeast of Iran. Methods: A cross-sectional survey was carried out biweekly from April to September 2016 to determine tick infesta­tion of the meat-producing animals. All the livestock included in our study were thoroughly inspected for the presence of hard ticks on different parts of their bodies. Results: A total of 258 hard ticks were collected from the body of livestock hosts. The ticks that were sampled were classified into two genera and five species: Hyalomma marginatum, Hy. anatolicum, Hy. asiaticum, Hy. dromedarii, and Rhipicephalus sanguineus. Hyalomma dromedarii was the most abundant species in the study area. More than 50 per­cent of the sampled ticks were collected from the body of camels brought to the slaughter house however molecular analysis showed no Crimean Congo Hemorrhagic Fever (CCHF) virus infection in tick specimens. The Sex ratio of the sampled hard ticks shows that female tick infestation was more common among the study livestock. Conclusion: Due to the crucial role of hard ticks in the transmission of different pathogens to humans, additional inves­tigations are necessary to determine the risk of consumption of infested meat-producing animals in the study area.

scholarly journals Crimean-Congo Hemorrhagic Fever in Iraq During 2010

2012 ◽  
Vol 36 (0E) ◽  
pp. 99-103
Author(s):  
Emad S. Abul-Eis ,
Keyword(s):  
Human Serum ◽  
Hemorrhagic Fever ◽  
Zoonotic Disease ◽  
Immunoglobulin M ◽  
Serum Samples ◽  
Crimean Congo Hemorrhagic Fever ◽  
Human Serum Samples ◽  
Specific Immunoglobulin ◽  
Cchf Virus

Crimean-Congo hemorrhagic fever (CCHF) is a viral zoonotic disease with a highmortality rate in humans. CCHF is caused by genus Nairovirus, in family of Bunyaviridae,and is transmitted to humans through the bite of ticks Hyalomma spp or contact with blood ortissues of CCHF patients or infected livestock.The total numbers of positive patients to CCHF virus was 11 out of 44 suspected sampleswere examined from eight provinces during the period from January to December 2010 . Theway of transmission is due to contact with blood and tissues of infected animals, and onepatient slaughtered sheep in his house. ELISA was used to detect Crimean-Congohemorrhagic fever (CCHF) virus-specific immunoglobulin M (IgM) in human serum samples.

Sign in / Sign up

Export Citation Format

Share Document